ID: 901110825

View in Genome Browser
Species Human (GRCh38)
Location 1:6793010-6793032
Sequence ATATATAAGATATATATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 855
Summary {0: 1, 1: 0, 2: 13, 3: 96, 4: 745}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901110825 Original CRISPR ATATATAAGATATATATGAG TGG (reversed) Intronic
901110825 1:6793010-6793032 ATATATAAGATATATATGAGTGG - Intronic
901110831 1:6793063-6793085 ATATAAGATATATATAAGAGTGG - Intronic
901840583 1:11951630-11951652 ATATATAATATATATATTGGTGG + Intronic
903823670 1:26125867-26125889 ATATATATTAAATAAATGAGAGG + Intergenic
904023556 1:27487397-27487419 TTATATAAAATATATATTATAGG - Intronic
905815144 1:40944266-40944288 ATATATATGGTATATATATGCGG - Intergenic
906133267 1:43475269-43475291 ATATATGACAAATATATGAGGGG + Intergenic
906807005 1:48788927-48788949 AAATTTTATATATATATGAGAGG + Intronic
907175357 1:52516197-52516219 ATATATAAAATATAGGTAAGAGG + Intronic
907665204 1:56428522-56428544 CTATATAAAGTAAATATGAGGGG + Intergenic
908142578 1:61202357-61202379 ATATATAAGATTCATATGGCAGG + Intronic
908341555 1:63185391-63185413 ATATATATGACATATAAGATGGG - Intergenic
908629791 1:66090406-66090428 ATAAATATGATATTTTTGAGGGG + Intronic
908814028 1:68013349-68013371 ATATAAAATATATATATAAAAGG + Intergenic
908855699 1:68425082-68425104 AGATATAATATGTATATGATTGG - Intergenic
909127682 1:71695196-71695218 AGATATCAGTTATATATGTGTGG + Intronic
909224155 1:72994741-72994763 ATAAGTAAGATATATCTGAGCGG + Intergenic
909240046 1:73201308-73201330 ATATATAAAATATATATATATGG + Intergenic
910674559 1:89803520-89803542 TTAAATAAGAAATATATGAAAGG - Intronic
911018575 1:93362975-93362997 ATATATAACATATATTCAAGGGG - Exonic
911139621 1:94485025-94485047 ATATATAATACATGAATGAGTGG + Intronic
911296264 1:96119539-96119561 AGAAATAAAATATATATGGGTGG - Intergenic
911384052 1:97152630-97152652 GTATATAACATATATATGCAAGG + Intronic
911562664 1:99425507-99425529 AGGTGTAAGATAAATATGAGGGG - Intergenic
911815565 1:102345114-102345136 ATAAATAAGATTCCTATGAGAGG + Intergenic
912149234 1:106836724-106836746 ATATATAACCTATATATGGTGGG + Intergenic
913014096 1:114715431-114715453 ATATTTAAGTTATTTATGAATGG - Intronic
913026607 1:114849514-114849536 ATATATAATAAATTTAGGAGTGG - Intergenic
913451568 1:118996354-118996376 AGATCTAAAATATACATGAGAGG + Intergenic
915155059 1:153868716-153868738 GTATATAGTATATATATTAGTGG - Intronic
915687675 1:157651422-157651444 ATATATGATGTATATATGACTGG + Intergenic
916242233 1:162651543-162651565 ATATAGTAGATATATATGTCTGG - Intronic
916387700 1:164294888-164294910 TTATATAAGATAAATATTATTGG - Intergenic
916658245 1:166897239-166897261 ATTTAAAAGATATTTAGGAGGGG + Intergenic
918469581 1:184857870-184857892 TTATATATGATGTATATGAGTGG - Intronic
918746719 1:188210766-188210788 ATATATAATATATATATATCTGG + Intergenic
918779511 1:188680207-188680229 ATATATATAATATATATAATAGG - Intergenic
919010334 1:191951652-191951674 ATATATCACATATATAAAAGGGG + Intergenic
919249960 1:195041686-195041708 ATAAATTATATTTATATGAGAGG - Intergenic
919302267 1:195785705-195785727 ATTTATAATTTATAAATGAGAGG - Intergenic
919510100 1:198451740-198451762 ATATATGAGACAAATATGATAGG + Intergenic
919531195 1:198723327-198723349 ATATGTAACATATGTAAGAGAGG - Intronic
919630182 1:199952647-199952669 ATATATGATATATATAGTAGAGG - Intergenic
920143287 1:203836299-203836321 ATATTTAAATTATAAATGAGGGG + Intronic
920153173 1:203925921-203925943 ATATATATGAGTTATCTGAGAGG + Intergenic
920726480 1:208440056-208440078 ATATATCACATATATATGATGGG - Intergenic
921410745 1:214834310-214834332 ATATATTATATGTATATAAGGGG + Intergenic
921454425 1:215350599-215350621 ATATATCATATATATATGATAGG - Intergenic
921454426 1:215350670-215350692 ATATTTTATATATATATGATAGG + Intergenic
921558788 1:216631684-216631706 ATATATAATATAGGTATGTGTGG - Intronic
921762619 1:218934165-218934187 ATATATTATATATATATAATTGG + Intergenic
921768208 1:218999288-218999310 ATATATAAAATATATATAACTGG + Intergenic
922908192 1:229192426-229192448 ATATATTATATATATATTAAAGG - Intergenic
923814729 1:237364499-237364521 ATATATCAGCTATATATATGTGG + Intronic
924365506 1:243289080-243289102 ATATAATATATATATATGAAGGG + Intronic
924390626 1:243551559-243551581 ATATATTATATATATATGAGTGG - Intronic
1063196851 10:3751539-3751561 ATATTTAAAATATTTCTGAGTGG + Intergenic
1063263138 10:4413361-4413383 ATATATACTATATGTATGTGTGG - Intergenic
1063433968 10:6015798-6015820 ATGTATTAGATACATCTGAGGGG + Intronic
1063863478 10:10338659-10338681 ATAAATAAGAGATAAATAAGAGG - Intergenic
1064822676 10:19355927-19355949 ATATATAATATATATATGCTAGG + Intronic
1064888953 10:20146853-20146875 ATATATCAGATATTTATTACTGG + Intronic
1064917525 10:20477064-20477086 ATATATATCATATATATCATAGG - Intergenic
1064917526 10:20477089-20477111 ATATATATCATATATATCATAGG - Intergenic
1065064132 10:21942504-21942526 ATATATAAGATAAATATAAGCGG + Intronic
1066562560 10:36685889-36685911 ATATACAAAATATATATGGCCGG - Intergenic
1066569929 10:36760146-36760168 ACAGATAAGATATTTCTGAGGGG + Intergenic
1066619554 10:37330875-37330897 ATATATAATATATATATAATAGG + Intronic
1067264347 10:44724286-44724308 TTATACAATATAAATATGAGTGG + Intergenic
1068314959 10:55328944-55328966 ATATATAAAATATATAATATGGG + Intronic
1068812771 10:61275147-61275169 AAATATAAGGTATATATCAATGG + Intergenic
1068910072 10:62369803-62369825 ATATATGAGATATATATATATGG - Intergenic
1068910074 10:62369831-62369853 ATATATGAGATATATATATATGG - Intergenic
1068910076 10:62369859-62369881 ATATATGAGATATATATATATGG - Intergenic
1068910080 10:62369917-62369939 ATATATGAGATATATATATATGG - Intergenic
1068910082 10:62369945-62369967 ATATATGAGATATATATATATGG - Intergenic
1068910084 10:62369973-62369995 ATATATGAGATATATATATATGG - Intergenic
1068910086 10:62370001-62370023 ATATATGAGATATATATATATGG - Intergenic
1068910088 10:62370029-62370051 ATATATGAGATATATATATATGG - Intergenic
1068910090 10:62370057-62370079 ATATATGAGATATATATATATGG - Intergenic
1068910092 10:62370085-62370107 ATATATGAGATATATATATATGG - Intergenic
1068910094 10:62370113-62370135 ATATATGAGATATATATATATGG - Intergenic
1068910096 10:62370141-62370163 ATATATGAGATATATATATATGG - Intergenic
1070109586 10:73471708-73471730 AGCTATAAGATATAAAGGAGGGG - Intronic
1070229889 10:74554357-74554379 ATATATAAGGGATATATGAAAGG - Intronic
1070814807 10:79316335-79316357 ATTTATTAGATAAATATTAGAGG - Exonic
1071070998 10:81693811-81693833 ATATATGGGATATATATATGTGG + Intergenic
1071071010 10:81693895-81693917 ATATATGGGATATATATATGTGG + Intergenic
1071278816 10:84080867-84080889 ATATATATGATATACTTTAGAGG - Intergenic
1071693105 10:87843453-87843475 AATTTTAAGAGATATATGAGAGG + Intergenic
1072042081 10:91616938-91616960 ATATATAATGTATATATAAAAGG + Intergenic
1072074815 10:91959389-91959411 ATAAATAATAGATATATGACCGG + Intronic
1072411826 10:95209731-95209753 ATATATAAAATAAATATTTGTGG - Intronic
1072823363 10:98580876-98580898 ATATATAAAATATATATATATGG + Intronic
1072983597 10:100120270-100120292 ATATATATGATATAGTTGAGTGG + Intergenic
1073621540 10:105054396-105054418 AGATATTAGATATATATAAAAGG + Intronic
1073699563 10:105910659-105910681 AAATATCAGACATATAAGAGGGG - Intergenic
1073702418 10:105943475-105943497 ATAGATGAGCTATGTATGAGAGG - Intergenic
1073790591 10:106936583-106936605 CTATATGAGATAAATATGTGAGG + Intronic
1073980425 10:109147608-109147630 ATACATAAAATATATCTGAAAGG + Intergenic
1074144387 10:110703557-110703579 TTTTATAAGATAAATAAGAGAGG - Intronic
1074614453 10:115053428-115053450 ATATTTAATATATATCTGTGTGG + Intergenic
1074633155 10:115281951-115281973 ATATATAATATATATATTTTAGG - Intronic
1074926809 10:118081582-118081604 ATATATACGATATATATCAATGG - Intergenic
1075455622 10:122583023-122583045 AGATATCAGATATATAGGAAAGG - Intronic
1075457745 10:122595726-122595748 AGATATCAGATATATAGGAAAGG - Intronic
1078574936 11:12492987-12493009 ACTTATGATATATATATGAGTGG + Intronic
1078678126 11:13446204-13446226 ATATAGAAGGTATACAGGAGTGG - Intronic
1080580945 11:33643268-33643290 ATATATAACATATATATGTGTGG + Intronic
1080690277 11:34551065-34551087 ATATTTAAAATATAAATGAAGGG - Intergenic
1080962766 11:37179742-37179764 ATATACAAGATACATAAAAGAGG + Intergenic
1081653751 11:44843075-44843097 CTATATTAGATATATATGGAAGG - Intronic
1082024058 11:47558426-47558448 ATATATATAATATATATATGAGG - Intronic
1082652662 11:55812838-55812860 ATATATGGAATATATATGTGTGG + Intergenic
1082946530 11:58767203-58767225 ATATATATAATATATATAAAGGG - Intergenic
1083358319 11:62084966-62084988 ATAAATAAAATAAATATGATTGG - Intergenic
1085594263 11:77793628-77793650 ATATATCAGATATGGATGTGAGG + Intronic
1086147914 11:83574331-83574353 GTATAAAAGATATATATGTAGGG + Intronic
1086999911 11:93407048-93407070 ATGTATAAGATTTATAGGGGAGG + Intronic
1087095691 11:94315218-94315240 ATATAAAATATATATATAATAGG - Intergenic
1087311940 11:96554895-96554917 ATATATAATATATATTTTGGAGG - Intergenic
1087311942 11:96555570-96555592 ATAAATAATATATATATAATAGG + Intergenic
1087315213 11:96594374-96594396 ATACAAATGATACATATGAGAGG - Intergenic
1087480696 11:98696999-98697021 ATATTTTATATATATATGAGTGG + Intergenic
1087522142 11:99252440-99252462 ATATATAAGATAAATGTTACTGG - Intronic
1089928886 11:122288487-122288509 ATAGCTAATATATATATGATTGG - Intergenic
1090145365 11:124315532-124315554 ATATATAATATATATATATATGG - Intergenic
1090892242 11:130934094-130934116 ATATATGTTATATATATGACAGG - Intergenic
1091186524 11:133652550-133652572 ATTTCTAAGATATATCTGACAGG + Intergenic
1091870896 12:3890430-3890452 ATATAAAAGATATATAGGCCAGG + Intergenic
1091954259 12:4624938-4624960 TTATGTATGTTATATATGAGGGG + Intronic
1091982033 12:4872757-4872779 ATATTTTATATATATATGACTGG - Intergenic
1092040089 12:5376572-5376594 ATATATAATATATATAATAGGGG + Intergenic
1092647203 12:10588411-10588433 CTGTGTAAGATATATATGTGTGG + Intergenic
1093404061 12:18783152-18783174 ATATACAATTTATATGTGAGGGG - Intergenic
1093897362 12:24589407-24589429 TTATATAATATATAAATGAAAGG + Intergenic
1094274132 12:28650811-28650833 ATATATAATATATATATGCAAGG + Intergenic
1095638743 12:44462309-44462331 TTAAATGAGATGTATATGAGAGG + Intergenic
1095786399 12:46113224-46113246 ATATATATGTTATATATTATAGG - Intergenic
1096442503 12:51655992-51656014 ATCCATAAGTTATATAAGAGAGG - Intronic
1096563548 12:52455188-52455210 ATATTTTAAATATAAATGAGTGG - Intergenic
1097251649 12:57636553-57636575 ATTTATATAATATATATGTGTGG + Intergenic
1097819262 12:64111353-64111375 AAATCTGAGATATATTTGAGTGG + Intronic
1098230836 12:68370531-68370553 ATGTCTAAGATATTTGTGAGTGG - Intergenic
1098261432 12:68675922-68675944 ATATATAATATATATATATATGG - Intergenic
1098531382 12:71545774-71545796 ATATATGAGATATGTATAAAGGG + Intronic
1098759102 12:74401898-74401920 ATATATTACATATATATGATAGG + Intergenic
1099039804 12:77637713-77637735 ATTTAGAAGATATTTGTGAGAGG - Intergenic
1099260903 12:80381651-80381673 ATATATAAGATATATTTCAGAGG + Intergenic
1099346864 12:81511736-81511758 ATATATTGAATATATATGAAGGG - Intronic
1099587782 12:84543637-84543659 ATATATATTATATATATATGTGG + Intergenic
1099642229 12:85305506-85305528 GTATATAAAATATATATAATAGG - Intergenic
1099740947 12:86633048-86633070 ATATATATTATATATTTGAAGGG + Intronic
1099974286 12:89530159-89530181 ATATATATAATATATATGATGGG + Intergenic
1099997415 12:89794242-89794264 GTATATAAGAAATATGTGAGAGG - Intergenic
1100022998 12:90094011-90094033 ATATATAAAATATATATTATAGG + Intergenic
1100022999 12:90094045-90094067 TTATATAAAATATATATTATAGG + Intergenic
1100037517 12:90271076-90271098 ATATATTAGCAATATATTAGAGG + Intergenic
1100124706 12:91409383-91409405 ATATATTATACATATATGATTGG + Intergenic
1101074556 12:101115184-101115206 ATAAGTAAGATAAACATGAGTGG - Intronic
1101312167 12:103591182-103591204 ATATATAAAATATATATTGTTGG + Intronic
1101440122 12:104697593-104697615 ATATATAAGACATATATAAGAGG - Intronic
1101531392 12:105576532-105576554 ATATCTAAGATCTATAGGAATGG + Intergenic
1101716461 12:107317632-107317654 AGATATAATATATATATGCATGG - Intergenic
1102827111 12:115957617-115957639 ATATAAAAGTTATATATGTAAGG + Exonic
1103597989 12:122035755-122035777 ATTTATATAATTTATATGAGGGG - Intronic
1105229649 13:18479873-18479895 ATATATAAAATATATAAAATTGG - Intergenic
1105238764 13:18590317-18590339 CTATATAAAATATATATTATAGG - Intergenic
1107126764 13:36854849-36854871 ATTTATATGATTTATATTAGTGG - Intronic
1107923802 13:45238404-45238426 ATAAAGCAGAAATATATGAGGGG - Intronic
1108297787 13:49042002-49042024 AAAAATAAAATATATGTGAGGGG + Intronic
1108845337 13:54671662-54671684 ATATATGTCATATATAGGAGTGG + Intergenic
1109157478 13:58928723-58928745 ACATGTAAGATATATATTGGAGG + Intergenic
1109495195 13:63160830-63160852 ATATATATGATATATATATTTGG - Intergenic
1109579568 13:64309635-64309657 AGATATAATATATATATAACAGG + Intergenic
1109647749 13:65282002-65282024 ATATATAATATATATCTTGGGGG - Intergenic
1109733847 13:66454535-66454557 GTATAAAAGATATATATGAAAGG + Intronic
1110105830 13:71674905-71674927 ATATCTAGGAAATATTTGAGAGG - Intronic
1110461905 13:75754505-75754527 ATATATAGGATATATACCTGGGG + Intronic
1110580151 13:77112274-77112296 ATATATAATATAAAGAAGAGGGG - Intronic
1110918333 13:81051492-81051514 AAATATAAGATGTATATAAATGG - Intergenic
1111277591 13:85970395-85970417 TTATATATGCTATATTTGAGAGG + Intergenic
1111422738 13:88036894-88036916 AAATATAAAAGATATATTAGAGG + Intergenic
1111447504 13:88367691-88367713 TTATATATTATATATATGTGAGG - Intergenic
1111685864 13:91500148-91500170 ATATATAAAAAATATGTCAGTGG - Intronic
1111712218 13:91830980-91831002 ATATATATTATATATATAATAGG - Intronic
1111712220 13:91831030-91831052 ATATATATAATATATATAATAGG - Intronic
1111847617 13:93531282-93531304 ATATATAATATATATGATAGAGG + Intronic
1112366417 13:98759452-98759474 TTATTTAATATACATATGAGTGG - Intergenic
1112616417 13:101011026-101011048 ATATATCATATATATATAAATGG - Intergenic
1112616430 13:101011397-101011419 ATATATATCATATATATAAATGG - Intergenic
1112616432 13:101011443-101011465 ATATATCATATATATATAAATGG - Intergenic
1112616433 13:101011469-101011491 ATATATATCATATATATAAATGG - Intergenic
1112868882 13:103943711-103943733 ATATAAAATATATATATAATAGG + Intergenic
1113765685 13:112879858-112879880 ATATATAACATATACATCTGAGG - Intronic
1114303832 14:21402749-21402771 ATAGATAATATGTAAATGAGTGG - Intronic
1114678709 14:24464187-24464209 ATTTATAAAATATCTATGGGAGG + Intergenic
1115164133 14:30429069-30429091 ATTTAAAAAATATATATGATTGG - Intergenic
1115567158 14:34634665-34634687 AAATATGAGAAGTATATGAGAGG - Intergenic
1116105611 14:40500053-40500075 ATATATATAATATATATAATTGG + Intergenic
1116118338 14:40687478-40687500 ATATACAAGAGATATATGTCTGG + Intergenic
1116340370 14:43715211-43715233 ATATATAAGACAAATATTAATGG + Intergenic
1116398603 14:44476955-44476977 TTATAAAAGATCTATATGAAAGG - Intergenic
1116445641 14:45006690-45006712 ATACATAAGACATATATAAATGG - Intronic
1116616348 14:47144974-47144996 ATATATAAGTTATAAATAATTGG - Intronic
1116616449 14:47146543-47146565 ATATATATGATGTATATGAAAGG - Intronic
1117203983 14:53421642-53421664 ATATATAGGAGATTGATGAGTGG + Intergenic
1117453921 14:55878979-55879001 GTATATAAGTTAATTATGAGTGG + Intergenic
1117710594 14:58525239-58525261 ATGTATAAGATATATCTTAGGGG + Intronic
1117865629 14:60146029-60146051 ATATATAAAATATAAAATAGTGG + Exonic
1118577267 14:67255480-67255502 ATATATATGATTTATTTGTGTGG + Intronic
1118682719 14:68260006-68260028 ATATATAAGATATTTTCGAGTGG + Intronic
1119075188 14:71630854-71630876 ATATATAATATATAAAAGAAAGG - Intronic
1119954287 14:78778919-78778941 ATATTTAAAATAAATATGACAGG - Intronic
1120351383 14:83363938-83363960 ATATACATGATATATATAAGGGG + Intergenic
1121637689 14:95464921-95464943 AAATATAAGCTATATCTGGGAGG + Intronic
1122336210 14:100987849-100987871 ATATATAAAATATATATTATAGG + Intergenic
1123559162 15:21467833-21467855 ATATCAAGGATTTATATGAGAGG - Intergenic
1123686720 15:22803402-22803424 ATATATAACATATATCTGTATGG - Intronic
1123809745 15:23911876-23911898 ATATATAAGATAAATTAGTGGGG - Intergenic
1124817258 15:33007067-33007089 ATATAAATGATAAATATGTGAGG + Intronic
1125164839 15:36690566-36690588 ATACATAAGATAAATGTTAGTGG - Intronic
1125907902 15:43410182-43410204 CTTTATAAGTTATATATGAAGGG + Intronic
1126001625 15:44216322-44216344 ATATATTAAATATTTATGGGGGG - Intergenic
1126147239 15:45486918-45486940 AAATGTAAGATATATACAAGAGG + Intronic
1126908776 15:53397000-53397022 ATATGTAAGAGATATATAATGGG + Intergenic
1128005120 15:64231325-64231347 ATATATAATATATATATATTTGG - Intronic
1128192471 15:65715966-65715988 ATATATCATATATATATAAATGG + Intronic
1128504601 15:68257791-68257813 ATATATGAGATATATATATGAGG + Intergenic
1129311596 15:74716167-74716189 ATATATAATACATATATAATTGG - Intergenic
1129901671 15:79156378-79156400 ATAGATAAGATAGAGAGGAGGGG - Intergenic
1131701245 15:94938460-94938482 ATATATTTCATATATATGAAAGG + Intergenic
1132048801 15:98589989-98590011 GAATATAAGATATATATGGCTGG + Intergenic
1133434696 16:5769104-5769126 ATATATAGGATATGGAAGAGAGG + Intergenic
1133453874 16:5925661-5925683 ATATATAATATGTATATTTGTGG - Intergenic
1134567032 16:15260565-15260587 TTATATAGGATACATATGTGTGG + Intergenic
1134735461 16:16496135-16496157 TTATATAGGATACATATGTGTGG - Intergenic
1134826912 16:17292168-17292190 ATATATTATATATACATGATGGG + Intronic
1134932066 16:18216082-18216104 TTATATAGGATACATATGTGTGG + Intergenic
1135128177 16:19829004-19829026 ATATATATTATATATATGCATGG + Intronic
1135632146 16:24044669-24044691 ATAGATAATATATAAATGAATGG - Intronic
1137032943 16:35542477-35542499 ATATATAAAATATATATATATGG + Intergenic
1137032945 16:35542479-35542501 ATATAAAATATATATATATGGGG + Intergenic
1137557439 16:49480283-49480305 AAATATAACTTATATATAAGGGG + Intergenic
1137885869 16:52102874-52102896 ATATATAAGAAATATACAAGTGG - Intergenic
1138640173 16:58379500-58379522 AAATAAAAGATAAATATCAGAGG + Intronic
1138715764 16:59020438-59020460 ATATTTGAGATATATTTAAGAGG + Intergenic
1138890313 16:61135182-61135204 ATATATATGGTATATATATGTGG - Intergenic
1138992081 16:62403357-62403379 ATATATGTCATATATATGATAGG - Intergenic
1140845815 16:78886656-78886678 ATGTAAAATATATATATGAAGGG + Intronic
1141129117 16:81422852-81422874 ATATATACGGTATATATATGTGG - Intergenic
1143821775 17:9570394-9570416 ATATATGATATATACATGAATGG - Intronic
1143829875 17:9642720-9642742 ATATACATCATATATATGATTGG - Intronic
1144042352 17:11423249-11423271 ATATATAATATATATATATATGG + Intronic
1144110558 17:12027551-12027573 ATATCTCAGATATATATGTCTGG - Intronic
1144376949 17:14652586-14652608 AGATATAAGATTGATATCAGAGG + Intergenic
1145949435 17:28804632-28804654 AAATATAAAATCTATATTAGAGG - Intronic
1146131240 17:30277857-30277879 ATTTATAAAATATATGTGAAGGG - Intronic
1146132382 17:30290168-30290190 ATATATAGCATATAGAAGAGAGG - Intronic
1146846627 17:36185602-36185624 ATAGATAATATATAAAAGAGTGG + Intronic
1149047140 17:52259340-52259362 ATATATAAAATACATATTATAGG - Intergenic
1149153838 17:53602189-53602211 ATATATATGGTATATATATGTGG + Intergenic
1149911947 17:60574723-60574745 ATATTCAAAATATATTTGAGAGG - Intronic
1150189528 17:63223560-63223582 ATATATAAAATAATTAAGAGTGG - Intronic
1150233213 17:63570516-63570538 CTATCAAGGATATATATGAGAGG - Intronic
1150762237 17:67973072-67973094 ATATATAATATATATATATAAGG + Intronic
1151131103 17:71896747-71896769 ATAAATATGATACATATCAGAGG + Intergenic
1153349518 18:4063396-4063418 CTATATAAGATACAGAAGAGAGG + Intronic
1153857221 18:9161758-9161780 ATATATAAAATATATATATATGG + Intronic
1154512167 18:15118150-15118172 CTATATAAAATATATATTATAGG - Intergenic
1154994872 18:21630866-21630888 ATATATCTAATATATATGACAGG - Intergenic
1155051886 18:22155579-22155601 ATATCTAATATATATGTGTGTGG - Intergenic
1155689784 18:28605270-28605292 ATAGATAATATATAAATGAATGG + Intergenic
1155975840 18:32130008-32130030 TTCTAGAAGATATAAATGAGAGG + Exonic
1156423524 18:36982160-36982182 ATATATATAATATATATAACTGG + Intronic
1158089293 18:53692144-53692166 ATATATATGATAAATATTAAAGG + Intergenic
1158136511 18:54213878-54213900 ATATGTAAGATATATGTGTAAGG - Intronic
1158142915 18:54275613-54275635 ATCTATATGATGAATATGAGAGG - Intronic
1158721568 18:59929884-59929906 ATATATATGATATATATATATGG + Intergenic
1158778119 18:60612378-60612400 AAATATAAGATATGTATATGTGG - Intergenic
1159153038 18:64545442-64545464 ATATATAGGATATATATATAGGG + Intergenic
1159292016 18:66435337-66435359 ATATGTACAATATATATGAAGGG + Intergenic
1159706532 18:71696246-71696268 ATAAATAAGTCATATATGAATGG + Intergenic
1160038903 18:75326225-75326247 ATATTAAAGATAATTATGAGGGG + Intergenic
1160390871 18:78531408-78531430 GTATTTATTATATATATGAGGGG + Intergenic
1160890475 19:1375390-1375412 ATATATTATATATATATGAGAGG - Intronic
1165203175 19:34161663-34161685 ATTGATAAGATATGTATGATTGG - Intergenic
1166833275 19:45651153-45651175 AGATATAAATTATATATGAGTGG + Intergenic
1167805412 19:51780192-51780214 ATATGTAACATAGATATCAGTGG + Intronic
1167903829 19:52642006-52642028 ATACACAATTTATATATGAGAGG + Intronic
925508795 2:4601038-4601060 TTATATATGATATATATAAAGGG + Intergenic
925580439 2:5405172-5405194 ATATATATAATATATATGTGGGG + Intergenic
925873218 2:8288801-8288823 ATATAAAAAATATGTATCAGTGG + Intergenic
926017325 2:9465579-9465601 ATATAAAAAATATATAAAAGAGG + Intronic
926390340 2:12384300-12384322 ATATATAATATATATATATTTGG - Intergenic
926495365 2:13580364-13580386 ATATATATGAAATATGTGAAAGG - Intergenic
926495514 2:13581819-13581841 ATATGAAAAATATATATGAAAGG - Intergenic
926870697 2:17412418-17412440 ATATATAAGAAACTTAGGAGAGG - Intergenic
926955741 2:18294225-18294247 ATATATAAAATATATATTATGGG - Intronic
926955744 2:18294246-18294268 ATATATAATGGATATATGTGTGG + Intronic
927033579 2:19149089-19149111 AGATATACCATATATATGGGTGG + Intergenic
927119993 2:19949878-19949900 ATATATATTCTATATATCAGTGG - Intronic
927403354 2:22740071-22740093 ATATTTTATATATATATGAAGGG - Intergenic
927977501 2:27349978-27350000 ATATAAAAGATATAAATGTCAGG + Intronic
928578119 2:32676893-32676915 ATATATGGAATATATATAAGTGG - Intronic
928976972 2:37097968-37097990 ATATATAATATTTATATGTTTGG + Exonic
929503177 2:42507487-42507509 ATACATAAAATAGTTATGAGTGG + Intronic
929658979 2:43763889-43763911 AAATATAAGAGATATATGAAAGG + Intronic
930316677 2:49804743-49804765 ATATTTAGGATATATATGTATGG - Intergenic
930441492 2:51413260-51413282 ATATATATGATATATATATCAGG - Intergenic
930572379 2:53103309-53103331 AATTATAGGATAAATATGAGGGG - Intergenic
931545132 2:63374625-63374647 TTATGTAAAATATATATGATAGG - Intronic
931972591 2:67605522-67605544 ATATATGAGATACATATAGGAGG - Intergenic
932546939 2:72722094-72722116 ATATATGAGATATATATCACTGG + Intronic
933305384 2:80591133-80591155 TTATGAAAGATATATTTGAGGGG + Intronic
933450196 2:82439366-82439388 ATATATAAAATAAATGTCAGAGG - Intergenic
933518570 2:83339169-83339191 ATATATGACATGTATATAAGGGG + Intergenic
933656612 2:84892393-84892415 ATATATATTATATATAAAAGAGG - Intronic
934162456 2:89264606-89264628 ATATATAAAATATTTATGTGTGG + Intergenic
934204818 2:89918110-89918132 ATATATAAAATATTTATGTGTGG - Intergenic
934585181 2:95486141-95486163 ATATATTATATATATATATGTGG + Intergenic
936887576 2:117331352-117331374 GTATATTATATATATATGTGTGG + Intergenic
936952869 2:117995562-117995584 ATTTATAAGACATATCTGAGTGG - Intronic
937750273 2:125468550-125468572 ATATATAAATTATATATGCATGG - Intergenic
937785793 2:125895857-125895879 ATTTATAATAAATAAATGAGAGG + Intergenic
938034133 2:128021894-128021916 CTAAAGAAGATATATATGAATGG - Intronic
938204256 2:129403825-129403847 ATTTATAAGATATCAAAGAGAGG + Intergenic
938511731 2:131954917-131954939 CTATATAAAATATATATTATAGG - Intergenic
939085856 2:137717172-137717194 ATATAAAAGATGTATGTTAGGGG - Intergenic
939228301 2:139391615-139391637 ATATATATTTTATATATTAGTGG - Intergenic
939624381 2:144459061-144459083 ATATGTAATACATATATGTGTGG - Intronic
939764871 2:146235134-146235156 ATATAAAAAATATATTTGTGTGG - Intergenic
940097225 2:149991126-149991148 AGGTATTAGATATAAATGAGAGG - Intergenic
940207137 2:151215675-151215697 ATATATTAGGTAGATATCAGGGG + Intergenic
940512547 2:154636819-154636841 ATATATAGCATATATATAATAGG - Intergenic
941124992 2:161573971-161573993 GTATATAATATATATAGCAGAGG - Intronic
941240574 2:163031404-163031426 ATATATATCATATATATGATAGG - Intergenic
941264445 2:163342692-163342714 AAATATAAATTAAATATGAGAGG - Intergenic
941400184 2:165021128-165021150 ATATTTCATATATATATAAGGGG + Intergenic
941446558 2:165608067-165608089 ATATATAATATATATATACGTGG - Intronic
941840647 2:170079660-170079682 ATGTATAAGATGGAAATGAGAGG + Intronic
942006920 2:171711910-171711932 ATATATAAGATAATTATGTATGG - Intronic
942126425 2:172829976-172829998 ATATATAATACATATATTAATGG + Intronic
942625844 2:177899733-177899755 ATATATTTTATATATATGAAGGG - Intronic
942667314 2:178333742-178333764 ACCTATAATATATACATGAGAGG + Intronic
942726608 2:179015228-179015250 ATATATGAGATATATATATGAGG - Intronic
943171326 2:184404785-184404807 ATGTATATGATAAAAATGAGAGG - Intergenic
943240139 2:185373569-185373591 ATATATAAGTTAAAAATAAGAGG + Intergenic
943268413 2:185767425-185767447 ATATATAAGATGAATAAGTGTGG - Intronic
943309167 2:186305578-186305600 ATATATAAAACATATATATGAGG + Intergenic
943585540 2:189735018-189735040 ATATAAAATATATATATATGTGG + Intronic
943874870 2:193053039-193053061 AAATATAACATATATATAAATGG - Intergenic
944003491 2:194872631-194872653 ATATCTAAATTCTATATGAGTGG - Intergenic
944037384 2:195311320-195311342 ATAGATAAGATAGATATGACTGG + Intergenic
944790751 2:203123054-203123076 ATATAAAAGATAATTATAAGAGG + Intronic
945031893 2:205673193-205673215 ATATATAATATGTATATAAAAGG - Intergenic
945149653 2:206776134-206776156 ATATATAATATATATATTATGGG + Intronic
945514211 2:210742657-210742679 ATAAATAACTTAAATATGAGCGG - Intergenic
945526552 2:210895084-210895106 TTATGTAAAATATATATCAGTGG + Intergenic
945639058 2:212399521-212399543 ATATATAAAATATATATCAGGGG - Intronic
945763609 2:213945329-213945351 ATATATAGTATATATATATGTGG + Intronic
946550134 2:220792282-220792304 ATATATAGGTTATATATAGGTGG - Intergenic
946716809 2:222561503-222561525 ATATATATCATATATATGAGAGG - Intergenic
947073081 2:226312642-226312664 ATAAATAAGATATAAATGTAAGG + Intergenic
947297028 2:228642675-228642697 ATAAAGAAGATAGAAATGAGGGG + Intergenic
947508362 2:230727727-230727749 ATATATTAAATATATATTAAAGG + Intronic
947559620 2:231136920-231136942 ATATATTATATATATAAAAGTGG - Intronic
948600125 2:239103075-239103097 ATATTTAAGAAATATTTTAGAGG + Intronic
1169568140 20:6878237-6878259 ATATATCAGATATTTAAAAGAGG - Intergenic
1169619482 20:7489392-7489414 ATATATAATATATATCTGGCTGG - Intergenic
1169940998 20:10937198-10937220 ATATGTAATCTATATATGTGTGG - Intergenic
1170019862 20:11825389-11825411 ATTTATAACAAATATATGTGTGG - Intergenic
1170383791 20:15793900-15793922 ATATATAATATAAAAATTAGTGG + Intronic
1170754720 20:19189732-19189754 ATGTATAAGAAATTTATGAGGGG - Intergenic
1171114341 20:22511660-22511682 GTATAAAACATATATCTGAGAGG + Intergenic
1171201204 20:23243820-23243842 ATATTTAAAATATAGCTGAGTGG + Intergenic
1172377498 20:34456703-34456725 ATATCAAATATATATATTAGTGG + Intronic
1172954468 20:38746327-38746349 TTATTTTATATATATATGAGAGG - Intergenic
1173077790 20:39836407-39836429 ATATATATTATATATATTATAGG - Intergenic
1173077791 20:39836415-39836437 ATATATAATATATATATTATAGG + Intergenic
1173218100 20:41106160-41106182 ATATATCTGATATACAAGAGAGG - Intronic
1173371131 20:42437031-42437053 ATATACAAGATTTAGAAGAGTGG + Intronic
1174371747 20:50094068-50094090 ATATATAATATATATAGGCTTGG + Intronic
1174716476 20:52764352-52764374 ATATATATAATATATATGTAGGG - Intergenic
1175447746 20:59036004-59036026 ATATATCATATACATATGTGTGG - Intronic
1175883395 20:62273422-62273444 ATTTACAAGATATTTATGATGGG - Intronic
1176334701 21:5585177-5585199 AAATCTAAGATATAAAAGAGAGG + Intergenic
1176393056 21:6235771-6235793 AAATCTAAGATATAAAAGAGAGG - Intergenic
1176468363 21:7080403-7080425 AAATCTAAGATATAAAAGAGAGG + Intronic
1176491924 21:7462181-7462203 AAATCTAAGATATAAAAGAGAGG + Intergenic
1176508718 21:7676202-7676224 AAATCTAAGATATAAAAGAGAGG - Intergenic
1176782757 21:13218584-13218606 CTATATAAAATATATATTATAGG - Intergenic
1177006686 21:15681760-15681782 ATATATATTATATATATATGTGG + Intergenic
1177218879 21:18164936-18164958 ATATTCAAGATATATATCAGAGG - Intronic
1177979744 21:27897012-27897034 CTATATAAAATATATATTATAGG + Intergenic
1178167383 21:29995453-29995475 ATATCTAAGATATATTCGGGAGG - Intergenic
1178549876 21:33527806-33527828 ATCAATAAGATATATTTTAGAGG - Intronic
1181597013 22:23922353-23922375 AAATATAGGATATATCTGAGAGG - Intergenic
1182243738 22:28938320-28938342 ATAGATAAGATATATTTAAAAGG - Intronic
1182643618 22:31789439-31789461 ATATATAATATAGAGATTAGTGG + Intronic
1184125758 22:42485742-42485764 ATATATATTATATATATAATTGG + Intergenic
1184303022 22:43573970-43573992 TTATTTAAAATATATATAAGGGG + Intronic
1185151472 22:49166203-49166225 ATATATATAATAAATATGTGGGG + Intergenic
949125318 3:440236-440258 ATATATAATATATATAATATTGG - Intergenic
949274938 3:2268810-2268832 ACATGTAAGATATATGAGAGTGG + Intronic
950091064 3:10294882-10294904 TTATATAAGATATTCACGAGTGG - Intronic
950826971 3:15833467-15833489 ATATATTATATATATATGAAGGG - Intronic
951405694 3:22294448-22294470 TTATATACGATAAATATGCGGGG - Intronic
951616435 3:24551262-24551284 AAATGTAAGGTATACATGAGTGG - Intergenic
952034462 3:29182627-29182649 AGAAATAAGATATATTTTAGTGG - Intergenic
952092535 3:29906849-29906871 ATACATATGATATATATAATGGG - Intronic
952398704 3:32943818-32943840 ATATATAATATATATATATGAGG - Intergenic
952790873 3:37199855-37199877 ATATATATAATATATATAAATGG + Intergenic
952908431 3:38160215-38160237 ATATATAATATAAATATAATAGG - Intergenic
953091870 3:39735899-39735921 ATATTTAATATATAACTGAGGGG - Intergenic
953790179 3:45941415-45941437 AAATCTAAGACATATATGATTGG + Intronic
953938147 3:47064741-47064763 ATATATAATATATATAAGCCTGG - Intronic
955309352 3:57869046-57869068 ATATATATTATATATATAAAGGG + Intronic
955453493 3:59096064-59096086 GTATATAAGAATTACATGAGCGG + Intergenic
955459289 3:59163135-59163157 ATAGATAAGATAGGGATGAGGGG - Intergenic
955764196 3:62323578-62323600 TTATATAAGAAATAAATGAGTGG + Intronic
955891836 3:63658422-63658444 ATATGTAAAATATATATAAGTGG + Intronic
956158963 3:66327448-66327470 ATGTATTATATATTTATGAGTGG - Intronic
956245216 3:67175261-67175283 ATATAAAAGAATTATTTGAGTGG - Intergenic
957120531 3:76085151-76085173 ACATATATGATATATATGCATGG + Intronic
957124482 3:76141071-76141093 ATATATAAAATATATGTGCCTGG + Intronic
957156698 3:76552696-76552718 ATATATAATCTATATTTGAGTGG + Intronic
957215179 3:77311323-77311345 ATGTATAAGACATATTTGATTGG - Intronic
957550140 3:81693758-81693780 ATGTATATGATATATATAGGTGG - Intronic
957657696 3:83102602-83102624 ATATATCAGATTTTTAAGAGGGG + Intergenic
958483253 3:94671990-94672012 ATATAAAACATATATATGTATGG + Intergenic
958670840 3:97202137-97202159 ATATATGAGTTCTATCTGAGGGG - Intronic
958873419 3:99588716-99588738 ATATATTATATATATATGTTTGG + Intergenic
959424699 3:106172369-106172391 TCATATAACATAAATATGAGAGG + Intergenic
959560905 3:107779707-107779729 ATATTTAAGATATATAGATGAGG + Intronic
959704456 3:109327009-109327031 ATATATTATGTATTTATGAGCGG + Exonic
959807314 3:110572637-110572659 ATATATACTATATTTATGAATGG + Intergenic
960357247 3:116668723-116668745 ATATATAGGATAAATAGCAGTGG + Intronic
960976542 3:123180903-123180925 ATATATATGAGATACATGGGTGG + Intronic
961843949 3:129744661-129744683 ATATATTAAATATGTATGATTGG - Intronic
962025702 3:131545130-131545152 ATATTTAAAATGAATATGAGAGG + Intronic
963566455 3:146937369-146937391 ATATATATGATATATATAAAGGG - Intergenic
963694393 3:148546931-148546953 ATACATAACACACATATGAGAGG + Intergenic
963694607 3:148549878-148549900 ATAAATAAGATTAATGTGAGAGG - Intergenic
964166968 3:153719371-153719393 ATATACAATACATAAATGAGTGG + Intergenic
964869353 3:161296395-161296417 TTACAGAAGATATTTATGAGGGG + Intergenic
964958316 3:162390778-162390800 TTCTATACGATATATATTAGAGG + Intergenic
964977616 3:162639178-162639200 ATATATATCCTATATATGTGAGG + Intergenic
964977618 3:162639203-162639225 ATATATATCCTATATATGTGAGG + Intergenic
964977620 3:162639230-162639252 ATATATATCCTATATATGTGAGG + Intergenic
964977622 3:162639255-162639277 ATATATATCCTATATATGTGAGG + Intergenic
964977624 3:162639284-162639306 ATATATATTCTATATATGTGAGG + Intergenic
964977625 3:162639311-162639333 ATATATATTCTATATATGTGAGG + Intergenic
964977626 3:162639340-162639362 ATATATATTCTATATATGTGAGG + Intergenic
964977627 3:162639367-162639389 ATATATATTCTATATATGTGAGG + Intergenic
965008878 3:163060077-163060099 ATATATATGATATATATCAAAGG + Intergenic
965022119 3:163244015-163244037 ATATATATGATATATATGAAAGG + Intergenic
965425257 3:168514891-168514913 ATATATAAGAGATATACGAGAGG - Intergenic
965516089 3:169622563-169622585 TTTTATGAGATATATTTGAGTGG - Intronic
965688378 3:171329345-171329367 ATATTTTTGATATATATTAGTGG - Intronic
966066119 3:175823980-175824002 ATATATGATATATATAAGGGAGG - Intergenic
966173859 3:177114307-177114329 ATATATGATATATATATGATAGG + Intronic
966174579 3:177122259-177122281 TTATATAAGTTATGTATTAGAGG - Intronic
966967722 3:185012388-185012410 ATATAGAATATATATATAATTGG + Intronic
967385560 3:188907529-188907551 ATATATAACATAAATATGATGGG + Intergenic
967463195 3:189771509-189771531 ATATATAATATAGCTATGTGTGG + Intronic
968150301 3:196332517-196332539 ATATAAAAGATATGGATCAGAGG + Intronic
968353126 3:198079614-198079636 ATATGTAAGATATAGATGTAAGG - Intergenic
968594627 4:1476042-1476064 ATGGATAATAGATATATGAGTGG + Intergenic
968663343 4:1807909-1807931 ATATATAACATATATGGAAGAGG + Exonic
969127762 4:4966060-4966082 AGATATACGATATATAAGATAGG - Intergenic
969557543 4:7923079-7923101 ATATATAAGGTAAATGAGAGAGG + Intronic
969885449 4:10211259-10211281 ATATATAATATATATATTTTAGG + Intergenic
970034772 4:11720663-11720685 ATATATATAATATATATGTATGG - Intergenic
970257941 4:14188763-14188785 ATGTATATGATGTATATGAAAGG - Intergenic
970473222 4:16397230-16397252 ATATAAAAAATATGTATGAATGG + Intergenic
970662886 4:18305880-18305902 AAATATATGATATTTATAAGGGG + Intergenic
971769533 4:30878590-30878612 ATATAAAAGAAATATTTGGGGGG + Intronic
972071814 4:35029871-35029893 ACACATAAGGAATATATGAGGGG - Intergenic
972408773 4:38770742-38770764 ATATATAGGATATATATAATAGG - Intergenic
972408775 4:38770772-38770794 ATATATAGGATATATATAATAGG - Intergenic
972408777 4:38770804-38770826 ATATATAGGATATATATAATAGG - Intergenic
972628265 4:40821457-40821479 ATAAATAAAATATATAAGAACGG + Intronic
972672194 4:41223972-41223994 ATATATATAATATATATATGAGG - Intergenic
972845908 4:42989115-42989137 ATATATAAGCGATATAAAAGAGG - Intronic
972877454 4:43381038-43381060 ATACATAAGATATATATGAATGG + Intergenic
972883300 4:43452812-43452834 ATATTAAATATATATATGAAGGG + Intergenic
972946003 4:44256464-44256486 ATATATAGTAAATATATGAAAGG + Intronic
973036353 4:45412189-45412211 GTATATAATATATATATTTGGGG - Intergenic
973140560 4:46762938-46762960 ATATATATGACATATATATGTGG - Intronic
973165942 4:47077987-47078009 ATATATAATATATATATATTGGG + Intronic
973211774 4:47623261-47623283 ATATATGTGATATATTTAAGAGG + Intronic
974369966 4:61003285-61003307 ATATAGAATATATATATATGTGG + Intergenic
974420959 4:61672900-61672922 ATAAATAAGATAAATATAATTGG + Intronic
974435202 4:61848101-61848123 TTATATAATATATATATTAGAGG + Intronic
974528936 4:63081728-63081750 GTGTATAATATATATATGAAAGG + Intergenic
974652304 4:64769941-64769963 AAATATAAAGTAAATATGAGAGG + Intergenic
974694387 4:65346491-65346513 ATATATAAAATATACATGTGAGG - Intronic
974781240 4:66556410-66556432 ATATATAATTTACATGTGAGAGG - Intergenic
975114618 4:70665606-70665628 AAATATATGATATATATAATGGG - Intronic
975397170 4:73889905-73889927 ATATATAATCTATATATGAGTGG + Intergenic
975535868 4:75449381-75449403 AGATATAAGACTTACATGAGTGG - Intergenic
975948918 4:79744181-79744203 ATCTATAAGATGTAAATGACTGG + Intergenic
976317109 4:83670281-83670303 TAATATAATATATATATGAAGGG - Intergenic
977436836 4:97008072-97008094 ACATTTGAGAAATATATGAGGGG + Intergenic
977444411 4:97110970-97110992 ATATATCACATATATATGTCAGG - Intergenic
978107299 4:104918654-104918676 ATATATCTGTTATATATGAATGG + Intergenic
978119866 4:105065489-105065511 ACATGTAAGATATATATTGGGGG + Intergenic
978297538 4:107224198-107224220 ATATAAAAGAAAAATATTAGAGG + Intronic
978345080 4:107758481-107758503 TTATATAATATATATAACAGAGG + Intergenic
978654142 4:111046761-111046783 ATATATAATATATATAGTAGTGG + Intergenic
978706157 4:111714429-111714451 ATATTTTATATATATATGTGGGG - Intergenic
978750001 4:112235614-112235636 ATATATATTATATATATTATAGG + Intronic
979032663 4:115670257-115670279 CTATAGCAGTTATATATGAGAGG - Intergenic
979142725 4:117198438-117198460 ATATATATAATATATATATGTGG - Intergenic
979483677 4:121247021-121247043 AGACATTAGATATTTATGAGTGG + Intergenic
979595368 4:122528638-122528660 ATAGATAATATATATATGAAGGG - Intergenic
979633880 4:122935225-122935247 ATATATAAGATTTATGAGAAAGG - Intronic
979681285 4:123462793-123462815 ATATATTAGACATATATGAAGGG - Intergenic
980209415 4:129766668-129766690 ATATTTAATACATAAATGAGTGG - Intergenic
980209637 4:129770786-129770808 AAATATAACATATTTATTAGAGG - Intergenic
980259505 4:130430176-130430198 ATATATAATAAATAAATGACAGG + Intergenic
980374713 4:131929442-131929464 ATATATAATATATATATATTTGG + Intergenic
980681922 4:136173750-136173772 ATATAGTAGATATATAGTAGAGG + Intergenic
980801739 4:137760164-137760186 TTGTATATGATATAGATGAGTGG - Intergenic
980840074 4:138248324-138248346 ATAGAAAATATATAAATGAGTGG - Intergenic
980976721 4:139617996-139618018 ATATTTCAAAAATATATGAGTGG - Intergenic
982370024 4:154624479-154624501 ATATATGATGTATATATGAAAGG + Intergenic
982370171 4:154625612-154625634 ATATATGATGTATATATGAAAGG - Intergenic
982471772 4:155800622-155800644 ATATAAAACATTTCTATGAGTGG + Intronic
982998775 4:162385227-162385249 TTATATAATATATATGTGAATGG - Intergenic
983260056 4:165446077-165446099 ATATATAAAATATACATGTGAGG + Intronic
983311887 4:166075360-166075382 ATATACAAGATATTTTTGGGAGG - Intronic
983358335 4:166695117-166695139 TAATATATAATATATATGAGAGG + Intergenic
983411564 4:167404856-167404878 ATATATTATGTATATATGGGTGG + Intergenic
984141820 4:176012999-176013021 ATATAGTAGACATATATTAGAGG - Intergenic
984444337 4:179815833-179815855 ATATATATGATATATATAAATGG - Intergenic
984659287 4:182355896-182355918 ATATATAATATATATATAATTGG - Intronic
984748472 4:183247471-183247493 ATATATAGTATATATATATGAGG - Intronic
985846789 5:2355714-2355736 AAATATTAGAAATATGTGAGTGG + Intergenic
985899341 5:2776381-2776403 ATATATTAAATATATAAGAGAGG - Intergenic
986159671 5:5215774-5215796 ATATATGGTATATATATGTGTGG + Intronic
986412841 5:7498948-7498970 ATTTTTAAGATTTATATGAATGG - Intronic
986934728 5:12868658-12868680 ATCAATAAGAGATATATAAGTGG + Intergenic
986956998 5:13164350-13164372 ATATATAATATATATAAAAAAGG - Intergenic
987138292 5:14920057-14920079 TTCTATAAGATAGAGATGAGCGG + Intergenic
987556253 5:19454824-19454846 ATATATAAGATGAAAATGAAAGG + Intergenic
987628350 5:20432916-20432938 ATATATATTATATCTATAAGAGG - Intronic
987661945 5:20889137-20889159 ATATATATCCTATATATGAAAGG + Intergenic
987782902 5:22462271-22462293 ATATATATGATAGAAATGTGAGG + Intronic
987881119 5:23747606-23747628 ATATAAAAGATATATTTTAAAGG - Intergenic
988033144 5:25792280-25792302 TTAAATAACAAATATATGAGAGG - Intergenic
988088654 5:26506043-26506065 AAATATAAGAAGTATATGAAGGG - Intergenic
988147020 5:27323168-27323190 CTATACAAAATATATATAAGGGG + Intergenic
988211275 5:28208168-28208190 ATATATAATTTTTATAAGAGAGG - Intergenic
988279859 5:29130864-29130886 ATATGTGAGAGATATATGAGAGG - Intergenic
988344243 5:30017572-30017594 ATATATAACATATATAAGTCAGG - Intergenic
988622698 5:32839946-32839968 ATATATATGATTTATGTCAGGGG + Intergenic
988649739 5:33135506-33135528 ATATATAAAATAAATATTAAAGG - Intergenic
988761640 5:34316182-34316204 ATATATATCCTATATATGAAAGG - Intergenic
989084532 5:37661604-37661626 AAACATAAGATAGATATAAGTGG + Intronic
989503045 5:42191724-42191746 AGATATATGTTATATATGACAGG - Intergenic
989773325 5:45171374-45171396 ATTTATAAGTTATATATTAATGG + Intergenic
990125437 5:52511183-52511205 ATGTATGATATATAAATGAGGGG + Intergenic
990194309 5:53296088-53296110 ATATATAGGAAATATATTAAAGG + Intergenic
990275243 5:54188588-54188610 GTATATAAAATGTATCTGAGAGG + Intronic
990409711 5:55529332-55529354 TTCTAGAAGATATAAATGAGAGG - Intronic
990961136 5:61394588-61394610 GTGTATATGATATATATGAGGGG + Intronic
991375334 5:65959700-65959722 ATATATATGCTATATAAAAGGGG - Intronic
991506106 5:67326085-67326107 ATATATGGGATATATATATGTGG - Intergenic
991506110 5:67326111-67326133 ATATATGGGATATATATATGTGG - Intergenic
992170990 5:74102032-74102054 ATAAATAATATATATATGCCAGG + Intergenic
992339602 5:75809069-75809091 ATATATATGATATATATATAAGG + Intergenic
992782282 5:80138734-80138756 AAATAAAAGATATATATCTGTGG - Exonic
992975401 5:82112328-82112350 ATTTTTAAAATATATTTGAGGGG + Intronic
993080576 5:83293206-83293228 ATACATAAGAGAAATATGACTGG - Intronic
993144094 5:84071933-84071955 ATAAATAATATTTAAATGAGAGG + Intronic
993152309 5:84176308-84176330 ATATATAATATATATATATTAGG + Intronic
993891028 5:93473605-93473627 ATATATAATATATATATTTAAGG - Intergenic
994011557 5:94909639-94909661 ATATATAAATTATATAGAAGAGG + Intronic
994529069 5:100943817-100943839 ATATATATTATATATATATGGGG + Intergenic
994564807 5:101429950-101429972 ATATACTAGCTAAATATGAGGGG - Intergenic
994935504 5:106248029-106248051 ATTTATAACATATATATTGGTGG - Intergenic
994967109 5:106687938-106687960 ATATATAACATATTCATGAGAGG - Intergenic
995815674 5:116165375-116165397 GTACATAAGATGTATGTGAGTGG - Intronic
995896922 5:117023966-117023988 ATATATAAAATATATATTTATGG - Intergenic
996221218 5:120935379-120935401 AGATATATGTTATATATGTGAGG + Intergenic
996377384 5:122826549-122826571 ATATATAATACATATATATGGGG - Intronic
997050347 5:130372884-130372906 ATATATCCAATATATATGATTGG + Intergenic
997493804 5:134303370-134303392 ATATATAAGATTTATAGGCTGGG - Intronic
997730456 5:136168948-136168970 ATATATGTAATATATATGAAAGG + Intronic
998120093 5:139569009-139569031 ATATATTAGATTAATATTAGAGG + Intronic
998680976 5:144466943-144466965 ATATATAATATATATAGTAACGG - Intronic
999675732 5:154000459-154000481 ATACATAATATATATATATGGGG - Intronic
999832667 5:155335778-155335800 ATGACTAAGAAATATATGAGGGG - Intergenic
1000002325 5:157150793-157150815 ATATATAATATATATATTGGGGG - Intronic
1000132316 5:158311654-158311676 ATATATAAAGTATATATTTGGGG + Intergenic
1000225178 5:159254531-159254553 ATATGTAAAATAAATATAAGGGG + Intergenic
1000460186 5:161506563-161506585 ATAGATAATATATAAATGAATGG - Intronic
1000598239 5:163241071-163241093 ATATATGGGATAAATATGAAGGG - Intergenic
1000894617 5:166840660-166840682 ATAAATAAGATATTTTGGAGAGG + Intergenic
1001089007 5:168723260-168723282 ATAAATATGATAAATATGTGAGG - Intronic
1001207285 5:169776102-169776124 ATATATATGATACAAAAGAGAGG - Intronic
1001726289 5:173904484-173904506 ATACAAATGATATATATCAGAGG - Intronic
1002010033 5:176271846-176271868 ATATATAATATATATCTATGGGG - Intronic
1004349905 6:14881989-14882011 ATATATAAAAAATATATAAGAGG + Intergenic
1004909980 6:20273545-20273567 ATATATAACATTTCTCTGAGAGG + Intergenic
1005269182 6:24145142-24145164 ATATATAATATATATATCTTTGG + Intronic
1005509954 6:26503605-26503627 ATATATGATATATATGTGAAAGG - Intronic
1005511321 6:26514207-26514229 ATATATAAAATATATATATGTGG + Intergenic
1006696580 6:35935743-35935765 TCCTATAAGATATATATTAGGGG + Intergenic
1006901946 6:37508108-37508130 ACATACAAGATAAATATCAGAGG - Intergenic
1006913112 6:37577065-37577087 ATATAAATGATATATATGGCAGG - Intergenic
1007037959 6:38695489-38695511 ATATTTAAGATAATTATAAGCGG - Intronic
1008135163 6:47767196-47767218 ATATATAAAATATATATATCAGG + Intergenic
1008170461 6:48199087-48199109 ATATATTATATATATATAATAGG + Intergenic
1008860371 6:56141898-56141920 ATTTATAAAATGTATATAAGTGG + Intronic
1009541235 6:64961438-64961460 ATATATATGATATATTGGAAAGG - Intronic
1010002962 6:70966852-70966874 AGATATATGAGTTATATGAGAGG + Intergenic
1010350958 6:74873787-74873809 ATTTATAAAATACTTATGAGAGG + Intergenic
1010475672 6:76284002-76284024 ATATATAAAACAAATATTAGAGG - Intergenic
1010497072 6:76546991-76547013 ATATATTATATATATATAATAGG - Intergenic
1010952336 6:82051568-82051590 GTATATGAGAAGTATATGAGAGG - Intergenic
1011021367 6:82816780-82816802 ATATATAATATATATATAAAGGG - Intergenic
1011021371 6:82816838-82816860 ATATATATAATATATATAAAGGG - Intergenic
1011021373 6:82816866-82816888 CTATATAATATATATATAAAGGG - Intergenic
1011021375 6:82816898-82816920 ATATATAATATATATATAAAGGG - Intergenic
1011021377 6:82816926-82816948 ATATATAATATATATATAAAGGG - Intergenic
1011021379 6:82816952-82816974 ATATATAATATATATATAAAGGG - Intergenic
1011021381 6:82816978-82817000 ATATATATAATATATATAAAGGG - Intergenic
1011021383 6:82817002-82817024 ATATATATTATATATATAAAGGG - Intergenic
1011021385 6:82817030-82817052 ATATATAATATATATGTAAAGGG - Intergenic
1011021387 6:82817058-82817080 ATATATTATATATATATAAAGGG - Intergenic
1011320700 6:86089344-86089366 ATATATATAATATATATAATTGG + Intergenic
1011913902 6:92477617-92477639 ATATGTACAATATATATGAGAGG + Intergenic
1012082476 6:94778738-94778760 AGATATAGGATATATATTAACGG - Intergenic
1012092212 6:94913521-94913543 AAATATAACATAAATATAAGAGG + Intergenic
1012369702 6:98488196-98488218 ATGATCAAGATATATATGAGTGG - Intergenic
1012562912 6:100608313-100608335 ATATATAAGGTATATATATAAGG - Intronic
1012562914 6:100608341-100608363 ATATATAAGGTATATATATAAGG - Intronic
1012562916 6:100608369-100608391 ATATATAAGGTATATATATAAGG - Intronic
1012641492 6:101622403-101622425 AAATATAAAATTTATATGAGTGG + Intronic
1012688388 6:102282125-102282147 ATATATAATATATGTATAATTGG + Intergenic
1012731075 6:102881850-102881872 ATATTTTATATATATATTAGTGG - Intergenic
1013350424 6:109300921-109300943 ATAAATAAGTTTTGTATGAGAGG + Intergenic
1013720556 6:113022117-113022139 ATATATCAGATATGAAAGAGAGG + Intergenic
1013870836 6:114757825-114757847 ATACATAAGATATATGGGGGTGG - Intergenic
1013881851 6:114914229-114914251 ATGTATAATATATATATATGTGG - Intergenic
1014085952 6:117344293-117344315 ATCTATACTATATATATGAGAGG + Intronic
1014900195 6:126954081-126954103 ATATATGAGAAATATATTTGAGG - Intergenic
1015067686 6:129051198-129051220 ATATATAAAATATATATAGCAGG + Intronic
1015218251 6:130775007-130775029 ATTTAATAGATCTATATGAGGGG + Intergenic
1015282937 6:131453340-131453362 AGATATAAAATTTATATAAGTGG - Intergenic
1015851071 6:137573275-137573297 ATATATGAAATATATTTGAAAGG + Intergenic
1016506175 6:144782632-144782654 ATATATAATATATATATATATGG + Intronic
1016854914 6:148657738-148657760 ATAAATGATAAATATATGAGGGG + Intergenic
1017780923 6:157714715-157714737 ATATATATGGTATATATGGAAGG - Intronic
1018276505 6:162137906-162137928 ATATATAAAATACATATGATTGG + Intronic
1018440905 6:163812247-163812269 ATTTAGAGGATATATATAAGAGG - Intergenic
1020104288 7:5414288-5414310 ATATATAATATATATATTTATGG - Intronic
1020576655 7:9940417-9940439 ATATAAAATATATATATTTGTGG - Intergenic
1020741684 7:12027940-12027962 ATACATAAGAAAAATGTGAGTGG + Intergenic
1020908029 7:14090132-14090154 AGATAGAAGATATAAATAAGTGG - Intergenic
1021128042 7:16877339-16877361 ATATTTTATATATATATCAGAGG + Intronic
1021338839 7:19438529-19438551 ATAGACAATACATATATGAGTGG + Intergenic
1022073403 7:26940523-26940545 ATATATTAAATATATAATAGTGG - Intronic
1023344267 7:39255037-39255059 ATATAAAGGATATATATAAAAGG - Intronic
1023384339 7:39640539-39640561 TTACATCAGATATATATGAATGG + Intronic
1023662941 7:42489278-42489300 ATATATAGCATATATATGTGTGG - Intergenic
1023662942 7:42489284-42489306 ATATATATGCTATATATGTGAGG + Intergenic
1023794383 7:43779847-43779869 ATATAAAATATATATATGTAAGG - Intronic
1024412510 7:49061702-49061724 ATATATATGAGAGAGATGAGTGG + Intergenic
1024504203 7:50147643-50147665 GTATATAAGTTAAATATGAGAGG - Intronic
1024802434 7:53096183-53096205 ATATATAAGAAATTAAGGAGAGG + Intergenic
1024804104 7:53116227-53116249 ATACATAATATAAATATTAGGGG + Intergenic
1025483415 7:61015451-61015473 ATAATTAAGATATATATTAACGG + Intergenic
1026242115 7:68585157-68585179 ATCTATCAGAAATAAATGAGCGG - Intergenic
1027125005 7:75550202-75550224 AGGTATAAAATATATATGAATGG + Intronic
1027587840 7:80079836-80079858 ATATATAGGATATATATATATGG + Intergenic
1027615647 7:80420406-80420428 ATATATAACATACAGATGAAGGG - Intronic
1028033391 7:85948124-85948146 ATATAAAAAATATAAATGAGGGG - Intergenic
1028278205 7:88886046-88886068 AAATGTAAGATATATATTTGTGG - Intronic
1029878082 7:103774576-103774598 ATATCTAATATATTTATTAGAGG - Intronic
1029975912 7:104833287-104833309 ATATATATTATATATATAATAGG + Intronic
1029975913 7:104833314-104833336 ATATATATTATATATATAATAGG + Intronic
1029975914 7:104833341-104833363 ATATATATTATATATATAATAGG + Intronic
1029975915 7:104833368-104833390 ATATATATTATATATATAATAGG + Intronic
1029975936 7:104833715-104833737 ATATATATTATATATATAATAGG - Intronic
1029975937 7:104833742-104833764 ATATATATTATATATATAATAGG - Intronic
1029975938 7:104833769-104833791 ATATATATTATATATATAATAGG - Intronic
1029975939 7:104833796-104833818 ATATATATTATATATATAATAGG - Intronic
1030264919 7:107610365-107610387 ATATATAAGAAAAATATTATTGG - Intronic
1030714888 7:112795987-112796009 ATATATATGATATAAAAGAAAGG + Intergenic
1031232652 7:119128937-119128959 ATATATTAAATATATATTATAGG + Intergenic
1031458634 7:122016692-122016714 ACATATATGACATATATGATAGG + Intronic
1031770523 7:125835627-125835649 AGATATAAAATATGAATGAGGGG - Intergenic
1031968217 7:128043605-128043627 ATATATCTGAAATATATGAATGG + Intronic
1033232167 7:139608323-139608345 ATATAAAATATATATATAACAGG + Intronic
1033872042 7:145765688-145765710 ATATACAAAATATATATGGAAGG + Intergenic
1033932003 7:146535076-146535098 ATATATAAAATATACATGTTAGG - Intronic
1033972806 7:147063323-147063345 ATATATAGGATAGATAAAAGAGG - Intronic
1034587275 7:152105629-152105651 AGATATAAAATATATTTGAGGGG - Intronic
1035920567 8:3671224-3671246 GTATATGGGATATATATGTGTGG + Intronic
1036038894 8:5052296-5052318 ATATATATAATATATATAAAGGG - Intergenic
1037679359 8:21082254-21082276 ATATGTAAGATATATATAGGTGG + Intergenic
1039387632 8:37150077-37150099 ATATATATTATATATATATGTGG - Intergenic
1039622759 8:39013923-39013945 ATAGATAACATATATATAAACGG + Intronic
1039663351 8:39491721-39491743 ATAGATATGATATGTATAAGGGG - Intergenic
1039680179 8:39726425-39726447 ATATCAAAAATATATATGGGTGG - Intronic
1040477174 8:47789307-47789329 ATATATAACTTATATATGTATGG - Intronic
1040618515 8:49063726-49063748 ATATATAAAAAATGCATGAGTGG + Intronic
1040662499 8:49591939-49591961 ATATATAAGAGAGATCAGAGCGG + Intergenic
1041160719 8:55040613-55040635 TTATACTAAATATATATGAGAGG + Intergenic
1041250667 8:55931477-55931499 TTAAATAAGGTATATATGATGGG + Intronic
1041400637 8:57440684-57440706 ATATTTCATATATATATGGGTGG - Intergenic
1041620257 8:59959212-59959234 ATGTATAAAATATATTTAAGTGG + Intergenic
1041872504 8:62650838-62650860 ATATATAGAAAATATATGATTGG + Intronic
1041880813 8:62747941-62747963 ATAGATAACACAAATATGAGTGG + Intronic
1041989537 8:63968993-63969015 ATATATATGATATATTTAGGAGG - Intergenic
1042314118 8:67407524-67407546 ATATATAGGATGTATATGCATGG + Intergenic
1042368400 8:67962906-67962928 ATATATAAAATATATAAAATTGG - Intronic
1042827565 8:72993965-72993987 ATATATGAAGTATATATGAAGGG - Intergenic
1043115225 8:76243427-76243449 ATATATATTATATATATGGTAGG + Intergenic
1043121764 8:76334320-76334342 ATAAATATGATAGATATGATGGG - Intergenic
1043207396 8:77463513-77463535 ATATATAAAATATATATATTAGG + Intergenic
1043258348 8:78163001-78163023 TTATATATTATATATATAAGGGG - Intergenic
1043654681 8:82647721-82647743 ATAAAAAAAATATATAGGAGGGG + Intergenic
1043848329 8:85186623-85186645 ATATATATGGTATATATGTAAGG + Intronic
1044167767 8:89008847-89008869 ATATATGACATATATATGTGTGG - Intergenic
1044377133 8:91488794-91488816 ATCTATAAGATAAATATCATTGG - Intergenic
1044406640 8:91834591-91834613 ATATATAATATATATATATATGG - Intergenic
1044406655 8:91834989-91835011 ATATATAATATATATATATATGG - Intergenic
1044436906 8:92175355-92175377 AGAGATGAAATATATATGAGAGG + Intergenic
1045014442 8:97987570-97987592 ATAAATTAGATATATATAATTGG - Intronic
1045193889 8:99910498-99910520 ATATAACACATATATATGTGTGG - Intergenic
1045435413 8:102158586-102158608 AGATATAATAAATATCTGAGTGG + Intergenic
1045629441 8:104100792-104100814 ATATATAATATATATATAACAGG - Intronic
1045717041 8:105059181-105059203 ATATATAAAATATATAATATAGG + Intronic
1045862113 8:106825378-106825400 ATATAAAAGATATTGATGACTGG + Intergenic
1045884816 8:107083287-107083309 ATACATAAAATAAATATGGGTGG - Intergenic
1046255234 8:111688150-111688172 TTATATATTATATATATGAATGG + Intergenic
1046273530 8:111926731-111926753 ACATATAACATATATATATGTGG + Intergenic
1046469728 8:114655004-114655026 ATATATAGGATATATATATATGG + Intergenic
1046474677 8:114726614-114726636 ATATACAAAATATATGTGTGTGG + Intergenic
1046537978 8:115540821-115540843 ATATATTAGATATATATTTATGG - Intronic
1046580267 8:116083866-116083888 ATATATAAAATGTATATAATTGG - Intergenic
1046644070 8:116766081-116766103 ATATATTGGATAGCTATGAGTGG - Intronic
1046921066 8:119729048-119729070 ATATATAAGAGAAATATTAAAGG + Intergenic
1047752917 8:127895882-127895904 ATAGATAATATGTAAATGAGTGG + Intergenic
1047867710 8:129045756-129045778 GTATATAAAATATATATTATAGG + Intergenic
1048004537 8:130408636-130408658 ATTTATAGGATATATGTAAGGGG - Intronic
1048757186 8:137752811-137752833 AGATAAAAGAGATATATGAGAGG - Intergenic
1049460227 8:142723825-142723847 ATATAAATGATATATACCAGGGG + Intergenic
1049481176 8:142823774-142823796 ATATAAATGATATATACCAGGGG - Intergenic
1050604429 9:7285912-7285934 ATATATAAGAAGTATGTGTGTGG + Intergenic
1050952582 9:11616696-11616718 ATATGTCAAATATATTTGAGGGG - Intergenic
1050958740 9:11699632-11699654 ATATATAAGATATTTATAAGAGG - Intergenic
1051442017 9:17095294-17095316 ATACATAAAATATATATGTGTGG - Intergenic
1051680679 9:19604684-19604706 AGAGATAAGAGAAATATGAGAGG + Intronic
1052161456 9:25265240-25265262 ATATATAATATATATATCAAAGG - Intergenic
1052161457 9:25265246-25265268 ATATATATATTATATATGTGTGG + Intergenic
1052198326 9:25745627-25745649 ACATATAATATATATATTTGTGG + Intergenic
1052449907 9:28615620-28615642 ATTTATAAAATACATATGAATGG + Intronic
1052590933 9:30493616-30493638 CTTTATAATATATTTATGAGTGG - Intergenic
1052592299 9:30514045-30514067 ATATATCAGAGATCTGTGAGAGG + Intergenic
1052629528 9:31019482-31019504 ATATAAACAATATAAATGAGAGG + Intergenic
1052652159 9:31319410-31319432 ATATATAAGACAAATTTTAGGGG - Intergenic
1053116601 9:35509800-35509822 ATATATAAGACATCTAGGACAGG - Intronic
1053183986 9:35999243-35999265 ATATATATAATATATATAATAGG - Intergenic
1053318173 9:37070688-37070710 AGATAAATGCTATATATGAGAGG - Intergenic
1053547632 9:39040605-39040627 AGATATAAGATATATTTTAAAGG - Intergenic
1054709368 9:68496000-68496022 ATAGACAAGATATAAATGAATGG + Intronic
1055124355 9:72702114-72702136 ATATTTCAAATATATTTGAGAGG - Intronic
1055165855 9:73192501-73192523 ATAGATATGATATGTATAAGGGG + Intergenic
1055203759 9:73701008-73701030 ATATATACTATATATATGTGTGG - Intergenic
1055793881 9:79953258-79953280 AGATATAAGATAAATATACGTGG - Intergenic
1056084802 9:83136038-83136060 ATATATATGATATATAGTAGCGG + Intergenic
1056240157 9:84637171-84637193 ATATATAAGATATTCTTAAGAGG + Intergenic
1057101488 9:92365175-92365197 ATATATTAGATATCGATAAGTGG + Intronic
1058003309 9:99889548-99889570 ATTTTAAAGATATATATGACGGG + Intergenic
1058155820 9:101513702-101513724 ATAGATAAGAGATTTATTAGGGG + Intronic
1058491603 9:105507040-105507062 ATATGTAAAATATATATGAAGGG + Intronic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1059625681 9:116062530-116062552 ATTTCTAAAATATACATGAGGGG - Intergenic
1060388863 9:123260830-123260852 ACATTTCAGATGTATATGAGTGG - Intronic
1062132281 9:134904789-134904811 AAATAAAAAATATATATGAAAGG + Intergenic
1185522426 X:751249-751271 ATATTTAATATTTATATGAAGGG + Intergenic
1186032352 X:5382248-5382270 TTATATAAGATATATGTTATAGG - Intergenic
1186258404 X:7748084-7748106 ATAAATAAAACATATATGCGTGG - Intergenic
1186573104 X:10736981-10737003 ATATATAAGATATATTTTTGTGG + Intronic
1186721071 X:12304761-12304783 ATATATAAAATATAGATGCCTGG + Intronic
1187064284 X:15818032-15818054 ATATGTATGATACATATGTGTGG + Intronic
1187326138 X:18291025-18291047 AAATATAAGATACAGAAGAGGGG + Intronic
1187585604 X:20658188-20658210 ATGTATAGGATATATCTGAAAGG + Intergenic
1187655523 X:21467311-21467333 ATATATAAGAATCATTTGAGGGG - Intronic
1187754372 X:22504797-22504819 AAATATAACAAATATATAAGGGG - Intergenic
1188208923 X:27394804-27394826 ATATATATGCAATATATGAATGG + Intergenic
1188364200 X:29294621-29294643 ATACACAAGATATAAATGAGTGG + Intronic
1188424074 X:30025794-30025816 ATAGTAAAGATGTATATGAGAGG + Intergenic
1188666805 X:32833467-32833489 TTATATAGAATATATATTAGAGG + Intronic
1190520570 X:51275818-51275840 ATATAAAATATATATATAAAGGG + Intergenic
1190996127 X:55611383-55611405 ATATAAAGGATATATATATGTGG + Intergenic
1190996131 X:55611441-55611463 ATATAAAGGATATATATATGTGG + Intergenic
1190996140 X:55611565-55611587 ATATAAAGGATATATATATGTGG + Intergenic
1190996142 X:55611596-55611618 ATATAAAGGATATATATATGTGG + Intergenic
1190996146 X:55611658-55611680 ATATAAAGGATATATATATGTGG + Intergenic
1190996156 X:55611809-55611831 ATATAAAGGATATATATATGTGG + Intergenic
1190996313 X:55613397-55613419 ATATAAAGGATATATATATGTGG + Intergenic
1190996316 X:55613428-55613450 ATATAAAGGATATATATATGTGG + Intergenic
1191177998 X:57527085-57527107 ACATAAAATATATATATAAGTGG - Intergenic
1191636649 X:63384906-63384928 ATATCTAAGACACATATGACAGG - Intergenic
1191788886 X:64946663-64946685 ATATATGAAATATATATGTTTGG + Intronic
1192757410 X:74060933-74060955 ATATATACGAAATCTAGGAGAGG + Intergenic
1192759407 X:74080103-74080125 ATTTATAAGACATAATTGAGTGG + Intergenic
1192862738 X:75094882-75094904 CTATATAAGATGTATTTTAGCGG - Intronic
1193701141 X:84762416-84762438 ATATATAAGCTATGGAAGAGAGG + Intergenic
1193727284 X:85057509-85057531 ATATAATATATATATATGAGAGG + Intronic
1193797913 X:85899032-85899054 ATGTAAAAGAAATATGTGAGTGG - Intronic
1193889348 X:87024780-87024802 ATATATTATATATATATGTATGG + Intergenic
1194009497 X:88542496-88542518 ATACACTAGATATATATGATAGG + Intergenic
1194375174 X:93123474-93123496 ATATATATTATATATATAATAGG + Intergenic
1194375175 X:93123499-93123521 ATATATATTATATATATAATAGG + Intergenic
1194375177 X:93123543-93123565 ATATATATTATATATATAATAGG + Intergenic
1194375178 X:93123568-93123590 ATATATATTATATATATAATAGG + Intergenic
1194465059 X:94224096-94224118 ATAAATAAGGTTTATATGAAAGG + Intergenic
1194523974 X:94954219-94954241 TTGTACAAGAAATATATGAGAGG - Intergenic
1195423353 X:104699730-104699752 ATAGATAATATATAAATGAATGG - Intronic
1195702909 X:107718141-107718163 ATAAATAAGATATATTTTAATGG - Intronic
1196356993 X:114806986-114807008 ATATATATGGTATATATATGTGG - Intronic
1197891049 X:131270813-131270835 ATATATAAAATATATCAAAGAGG + Intergenic
1198000657 X:132432176-132432198 ATATATAATATCTATGGGAGAGG + Intronic
1198220441 X:134595585-134595607 ATATATATTATATATATAAATGG - Intronic
1198304078 X:135363365-135363387 GTATATTTGATATAAATGAGAGG - Intergenic
1198628269 X:138604037-138604059 ATATTTTACATATATATGAAAGG + Intergenic
1198727697 X:139693767-139693789 ATAAATAAGACACAAATGAGGGG + Intronic
1198832024 X:140760724-140760746 ATATATAATATATATATATCTGG + Intergenic
1198981418 X:142400874-142400896 TTAAATAATATATATATGAATGG - Intergenic
1199010236 X:142749661-142749683 ATATATAAAATATATAAATGAGG + Intergenic
1199438561 X:147842486-147842508 ATATATTATATATATATATGAGG + Intergenic
1201285078 Y:12372562-12372584 ATATATAAAATCTATATTATAGG + Intergenic
1201285079 Y:12372587-12372609 ATATATAAAATCTATATTATAGG + Intergenic
1201285080 Y:12372612-12372634 ATATATAAAATCTATATTATAGG + Intergenic
1201285081 Y:12372637-12372659 ATATATAAAATCTATATTATCGG + Intergenic
1201461272 Y:14227616-14227638 ATATATGACATCTATATGATGGG - Intergenic
1201756231 Y:17488650-17488672 ATATATATGGTATATATATGTGG + Intergenic
1201845321 Y:18417335-18417357 ATATATATGGTATATATATGTGG - Intergenic
1201917664 Y:19199648-19199670 ATATATAAAATATGGATGAATGG - Intergenic
1202190714 Y:22241184-22241206 ATATATGGGATATATATATGTGG - Intergenic
1202190716 Y:22241199-22241221 ATATATAGGATATATATATATGG - Intergenic
1202190731 Y:22241309-22241331 ATATATAGGATATATATATATGG - Intergenic
1202190734 Y:22241337-22241359 ATATATAGGATATATATATATGG - Intergenic
1202190737 Y:22241365-22241387 ATATATAGGATATATATATATGG - Intergenic
1202190740 Y:22241393-22241415 ATATATAGGATATATATATATGG - Intergenic
1202338738 Y:23837760-23837782 ATAAATAAGCTATAAATGAAAGG - Intergenic
1202532028 Y:25832312-25832334 ATAAATAAGCTATAAATGAAAGG + Intergenic