ID: 901115024

View in Genome Browser
Species Human (GRCh38)
Location 1:6836644-6836666
Sequence GGGCGTCTGCGGTAGCACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901115024 Original CRISPR GGGCGTCTGCGGTAGCACCG AGG Intronic
901115024 1:6836644-6836666 GGGCGTCTGCGGTAGCACCGAGG + Intronic
903221546 1:21872398-21872420 GGGCGTCAGCCTGAGCACCGGGG + Intronic
904130551 1:28272486-28272508 GGGTGTCTGAGGGAGCACAGAGG + Intronic
916754473 1:167755767-167755789 GTGCGGCTGCAGAAGCACCGTGG - Intronic
922758540 1:228109792-228109814 GGGGGACTGCGGGAGCACCCGGG + Intergenic
1070471940 10:76789320-76789342 GGGTGTTTGGGGTAGCACAGTGG + Intergenic
1072783633 10:98266531-98266553 GGGCTTCTGCTGTAGGACCCTGG + Intronic
1080333835 11:31174144-31174166 GGGCGGCTGCAGTTGCACCTGGG - Intronic
1085514074 11:77102315-77102337 GGGCGTCAGGGGTAGCTCCAAGG + Intronic
1091295995 11:134474376-134474398 GGGCCTCTGCGGTGGCTCCAGGG - Intergenic
1096583173 12:52601389-52601411 GGGCTTCAGCGGTTGCTCCGCGG - Exonic
1098597989 12:72295228-72295250 GGGCGGCTGCAGCAGCACTGGGG + Intronic
1102441799 12:112969365-112969387 AGGGGTAAGCGGTAGCACCGTGG + Intronic
1103562606 12:121800309-121800331 GGGCGTCTGCGGCCACCCCGAGG + Intronic
1108240464 13:48458054-48458076 GGGCGGCTGCAGAAGCACTGGGG + Intronic
1113979647 13:114263668-114263690 GGGCGTGTGTGCTAGCACCAGGG - Intronic
1122796832 14:104210251-104210273 GGGGGCCTGAGGGAGCACCGAGG + Intergenic
1129784918 15:78303844-78303866 GGGCGGCTGCAGCAGCACCTGGG - Intergenic
1132046313 15:98565745-98565767 GCCCGTCTGCGGTTACACCGCGG - Intergenic
1132286802 15:100669387-100669409 GGGCGGCTGCTGGAGCACCGAGG + Intergenic
1132580088 16:680706-680728 GGGCGGCGGCGGTGGCACCGGGG + Intronic
1133233024 16:4375217-4375239 GGGTGCCTTCAGTAGCACCGTGG - Intronic
1141462762 16:84187469-84187491 GTGCGTCAGCAGTAGCACCTGGG + Intergenic
1142282999 16:89159336-89159358 GGACGACCGCGGTAGCAACGTGG + Intergenic
1147934621 17:44004695-44004717 GGGCAGCTGCTGTAGCCCCGAGG + Exonic
1152587522 17:81195675-81195697 GGCTGTCTGGGGGAGCACCGTGG - Intronic
1161337520 19:3722381-3722403 GGGCGCCCGCGGTGGCACGGTGG + Intronic
1161579817 19:5074713-5074735 GGGTGTCAGCAGAAGCACCGTGG + Intronic
1162412283 19:10513847-10513869 GGGCGGCTGTGGGTGCACCGGGG + Exonic
1163554485 19:17984406-17984428 GGCCAACTGGGGTAGCACCGAGG - Intronic
1167605780 19:50480726-50480748 GGGCGGCTGCAGCTGCACCGAGG - Exonic
927555066 2:24025361-24025383 GGGCTTCTGCGGCAGGACAGAGG + Intronic
938081536 2:128372973-128372995 GGGACCCTGCGGTGGCACCGCGG + Intergenic
943736880 2:191365982-191366004 GTGGGTCTGGGGTAGGACCGAGG + Intronic
944383692 2:199141248-199141270 GGGCGACTGCAGTGGCACCCAGG - Intergenic
946493452 2:220172083-220172105 TGGCATCCGCTGTAGCACCGCGG + Intergenic
1169278323 20:4248207-4248229 GCGCTTCTGCGGTATCACCGAGG - Exonic
1169810552 20:9605121-9605143 GGGCATCTGCTGCAGCACAGAGG - Intronic
1171123279 20:22583178-22583200 AGGCGACAGCGTTAGCACCGCGG + Intronic
1171447305 20:25214020-25214042 GGGCTTCAGCTGCAGCACCGGGG - Intronic
1178534867 21:33403267-33403289 GGGCCTCTGCGGCTGCAGCGCGG - Exonic
1182145767 22:27995890-27995912 GGACGTCTGCAGAAGCACCCTGG + Intronic
1182435455 22:30326923-30326945 GGGCGTCGGCGGCAGCAGGGCGG - Intronic
1184711179 22:46250325-46250347 CTGCGTCTGCGGCTGCACCGGGG - Exonic
957705011 3:83769963-83769985 GGGCGGCTGCGGCAGCACCTGGG - Intergenic
960634391 3:119768741-119768763 GGGTGGCTGCAGTGGCACCGGGG + Intergenic
967896043 3:194396961-194396983 GGGTGGCTGCGGCAGCACCTAGG - Exonic
968575847 4:1365808-1365830 GTGCGTCTGCGGTGCCCCCGGGG - Intronic
975444377 4:74445353-74445375 CGGCGCCGGCGGTAGCAGCGGGG - Exonic
992172641 5:74119545-74119567 GGGTGTCTGCAGTAGCTCCACGG - Intergenic
995749701 5:115441281-115441303 TGGCGTCTGTGGTAGCAATGGGG + Intergenic
1000622948 5:163505766-163505788 GGGCGTCTCCGGTGGGAGCGGGG + Intronic
1011042519 6:83046676-83046698 GGGGGTGGGCGGTGGCACCGGGG + Intronic
1013709522 6:112880361-112880383 GGGCGGCTGCAGTGGCACCCGGG + Intergenic
1029199055 7:98826657-98826679 GCGTGTCTGCGGTCGCACCGTGG + Intergenic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1035384573 7:158462059-158462081 GGGCGTGGGCGGAAGCACAGGGG - Intronic
1053128044 9:35598898-35598920 GGGCGGCTGCAGCAGCACCCAGG - Intergenic
1055572517 9:77631937-77631959 GGGCGGCTGCTGCAGCACCCAGG - Intronic
1058967199 9:110048953-110048975 GGGAGTCCTCGGAAGCACCGCGG + Intronic
1062021512 9:134321675-134321697 GGGCGTCTGGGGGTGCACGGTGG + Intronic
1062587391 9:137255436-137255458 GGGTGTCTGCGGCGGCGCCGGGG + Exonic
1186825936 X:13340188-13340210 GGGCTTCTCAGGTACCACCGAGG + Intergenic
1199608611 X:149595380-149595402 GGGTGTCTGCGGTCACATCGCGG + Intergenic
1199630511 X:149773980-149774002 GGGTGTCTGCGGTCACATCGCGG - Intergenic