ID: 901117877

View in Genome Browser
Species Human (GRCh38)
Location 1:6863328-6863350
Sequence TCCCCAACCCCTGTGAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 211}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901117868_901117877 4 Left 901117868 1:6863301-6863323 CCCTTTGACCACCATCTCCCCAT 0: 2
1: 124
2: 405
3: 757
4: 1320
Right 901117877 1:6863328-6863350 TCCCCAACCCCTGTGAGTTCAGG 0: 1
1: 0
2: 2
3: 15
4: 211
901117867_901117877 17 Left 901117867 1:6863288-6863310 CCAAAAGTTTATACCCTTTGACC 0: 1
1: 6
2: 12
3: 83
4: 270
Right 901117877 1:6863328-6863350 TCCCCAACCCCTGTGAGTTCAGG 0: 1
1: 0
2: 2
3: 15
4: 211
901117871_901117877 -7 Left 901117871 1:6863312-6863334 CCATCTCCCCATTCCCTCCCCAA 0: 1
1: 1
2: 20
3: 185
4: 1417
Right 901117877 1:6863328-6863350 TCCCCAACCCCTGTGAGTTCAGG 0: 1
1: 0
2: 2
3: 15
4: 211
901117869_901117877 3 Left 901117869 1:6863302-6863324 CCTTTGACCACCATCTCCCCATT 0: 2
1: 135
2: 522
3: 1154
4: 2077
Right 901117877 1:6863328-6863350 TCCCCAACCCCTGTGAGTTCAGG 0: 1
1: 0
2: 2
3: 15
4: 211
901117870_901117877 -4 Left 901117870 1:6863309-6863331 CCACCATCTCCCCATTCCCTCCC 0: 1
1: 1
2: 93
3: 422
4: 2519
Right 901117877 1:6863328-6863350 TCCCCAACCCCTGTGAGTTCAGG 0: 1
1: 0
2: 2
3: 15
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901117877 Original CRISPR TCCCCAACCCCTGTGAGTTC AGG Intronic
900149563 1:1172153-1172175 TCCCCAGCCCCTGCCAGCTCAGG + Intergenic
900568708 1:3347889-3347911 AGCCCATCCCCTGTGACTTCAGG + Intronic
900982962 1:6057023-6057045 CCCCCAGCCTCTGTGAGTTTAGG + Intronic
901117877 1:6863328-6863350 TCCCCAACCCCTGTGAGTTCAGG + Intronic
901462747 1:9401200-9401222 TCCCCAGTCCCTTTGGGTTCTGG - Intergenic
901663984 1:10816099-10816121 TCCCAAGCCCCTCTGTGTTCCGG + Intergenic
901671753 1:10860243-10860265 TCCCCATCCCCAGTGATTTGGGG + Intergenic
902286286 1:15410400-15410422 TCCCCAACCCCGGTGCGTCTGGG - Intronic
902560429 1:17273908-17273930 TCACAAACCCCTGTGAGGCCAGG - Intronic
905733313 1:40310991-40311013 TCCCCTTCCCCTGTGGGTTCTGG - Intronic
906608509 1:47187060-47187082 TGCCCACTCCCTGTGAGTTTTGG - Intronic
909236748 1:73162224-73162246 AGTCCAACCCCTGTGAGTTCAGG - Intergenic
909617187 1:77624391-77624413 GCCCCAACCCTTGTGTGCTCTGG + Intronic
914746869 1:150507716-150507738 TCCCCTACCAGTGTGAGGTCTGG - Intergenic
916498541 1:165366868-165366890 TCCCAAAACCCTGAGAGTACAGG + Intergenic
919292407 1:195649220-195649242 CCCCCACCCCCTGAGAGTCCCGG - Intergenic
920480022 1:206312699-206312721 TCCCCCATCCCTGTGAATTGTGG + Intronic
920543567 1:206797425-206797447 TCCCCCACCTCCGAGAGTTCAGG + Intergenic
920688898 1:208130856-208130878 TTCTCACCACCTGTGAGTTCTGG - Intronic
922440483 1:225652486-225652508 TCCCCAACCCGTGTGGTTTGGGG - Intronic
923033941 1:230271176-230271198 TCCCCAGCCCCTGTGAGTGCAGG + Intronic
924627959 1:245711428-245711450 TCGCCAACCTCACTGAGTTCTGG - Intergenic
1062816584 10:505581-505603 TCCCCATCTCCTGTGGGGTCAGG - Intronic
1064273377 10:13885124-13885146 TCCCCAAGCCCTGGGATTACAGG - Intronic
1064935479 10:20674245-20674267 TCCCCAACCCCACTGGGTTGAGG + Intergenic
1065165742 10:22975294-22975316 TCCCAAACCGCTGGGAGTACAGG - Intronic
1065325161 10:24544403-24544425 TCCCCGACCCTTGCTAGTTCCGG + Exonic
1068017517 10:51535979-51536001 TCCCAAAGCCCTGTGATTACAGG + Intronic
1068123161 10:52805787-52805809 TCCCCATGCCCTGTGTTTTCCGG + Intergenic
1069551640 10:69368394-69368416 TCCCCAAGCCCAGTGTGATCTGG + Intronic
1071497886 10:86181031-86181053 TGCCCAAGCACTGTGTGTTCGGG - Intronic
1072720630 10:97778733-97778755 TCCTCAAGCCATGTGAGATCAGG - Intergenic
1072787914 10:98296626-98296648 TGCCTAACCCCTGTGGGCTCTGG - Intergenic
1073182025 10:101589292-101589314 TTCCCAACCACTCTGAGTCCTGG - Intronic
1073254211 10:102140678-102140700 TCCACAACCTCTTTGACTTCAGG - Exonic
1074638898 10:115355509-115355531 TCCCCAACTCCAGACAGTTCAGG - Intronic
1076779662 10:132717249-132717271 TCCCCCACCCCCGTGACCTCAGG + Intronic
1079318464 11:19430141-19430163 ACCCCCACCCCTCTCAGTTCTGG + Intronic
1079601645 11:22317370-22317392 CCCCCAACCCTTCTGAGTTGGGG - Intergenic
1079617300 11:22511273-22511295 TCCCAAACTCCTGTGATTACAGG + Intergenic
1081749365 11:45498704-45498726 TCCCAGACCCCTCTGAGCTCTGG + Intergenic
1082566382 11:54683878-54683900 TCCCCATCCACTCTCAGTTCTGG - Intergenic
1083171052 11:60924366-60924388 TCCCCAATCCCTGCGCGCTCAGG - Intergenic
1083894143 11:65611780-65611802 TCCCCTCCCCCTGTGCCTTCGGG + Intronic
1089745784 11:120615926-120615948 TCCCCAACTCCTGGGATTTCAGG - Intronic
1090304478 11:125678897-125678919 TCCCCAATCCATGTGGGTTGGGG + Intronic
1092001771 12:5038702-5038724 CCCCCAGCCCCTGTGTGTTTAGG + Intergenic
1096672035 12:53205839-53205861 TCCCCACCACCTGTGACCTCAGG + Intronic
1097015508 12:55983916-55983938 TCCCAAACCCCTGGGATTACAGG + Intronic
1097056311 12:56251959-56251981 TCCCCAACCCATGCAAGCTCTGG - Intronic
1097124589 12:56763816-56763838 TCCTCAACCTCTCAGAGTTCTGG - Intronic
1100091546 12:90978105-90978127 CCCAGAACCCCTGTGAATTCAGG + Exonic
1100835563 12:98563802-98563824 TCCCAAAGCCCTGTGATTACAGG - Intergenic
1101201649 12:102442540-102442562 ACCTCAACCCCTATGATTTCAGG + Intronic
1101546699 12:105720081-105720103 TACCGTACCCCTGTGAGTTAGGG + Intergenic
1102170638 12:110839838-110839860 TCCCAAACTCCTGGGAGTACAGG - Intergenic
1102859217 12:116320993-116321015 TCCCCCACCCCTCTGACTTAAGG - Intergenic
1105322932 13:19345399-19345421 ACCCCAACCCCTGTCAATCCCGG - Intergenic
1106483413 13:30153829-30153851 TACAGAACCCCAGTGAGTTCTGG + Intergenic
1108508825 13:51136583-51136605 TCCCACACCCCGGTGAGCTCTGG - Intergenic
1108844436 13:54660373-54660395 TCCGGAGCCCCTGAGAGTTCAGG + Intergenic
1114705871 14:24726429-24726451 TCCCCTTCCCCTGTGGCTTCAGG - Intergenic
1114986859 14:28239720-28239742 TCCCCAACACCTGGGAATTGTGG - Intergenic
1117095385 14:52291823-52291845 CCCCCAGCCCCTGTGGGTTATGG - Intergenic
1117980306 14:61336346-61336368 CCCCCAATCCCTGTGATTCCGGG - Intronic
1118311101 14:64693786-64693808 CCCCCAAGCCCTTTGAGTTCTGG + Intergenic
1118356534 14:65018549-65018571 TCCCCAAGCCCTGGGATTACAGG - Intronic
1119436162 14:74599343-74599365 GCCCCAGCCCCTGTGCGTCCAGG + Intronic
1120077921 14:80181256-80181278 TCTCCAACCCATGTGAGGGCAGG - Intergenic
1120263084 14:82213305-82213327 GCCTCAACCTATGTGAGTTCTGG + Intergenic
1120319788 14:82944824-82944846 TCCCTAACCCCTGTGACATTAGG - Intergenic
1122980672 14:105191179-105191201 GCCCCCACCACTGTGTGTTCTGG + Intergenic
1124863659 15:33468289-33468311 TACCTAACCCCTCTGAGTTTTGG + Intronic
1127895750 15:63297306-63297328 TCTCAAACTCCTGGGAGTTCAGG - Intronic
1128383309 15:67129124-67129146 TCCCCAACCCCTGGGACCCCTGG + Intronic
1128659053 15:69484575-69484597 CCCCCAACACCTGTGGGTCCAGG + Intergenic
1129077330 15:73008237-73008259 TCCCCACCCCCTCTCAATTCTGG - Intergenic
1129109739 15:73330388-73330410 TCCCCACGCCTTGTGTGTTCCGG - Intronic
1129780615 15:78268043-78268065 CCCCCATCCCATGTGAGATCTGG + Intronic
1137321067 16:47383028-47383050 TCCTCTACCCCTGTGAGGTCAGG + Intronic
1137767910 16:50991885-50991907 GCCCCAGCCACTGTGAGTCCTGG + Intergenic
1138175376 16:54893216-54893238 CTGCCAACCCCTGTGAGTACAGG - Intergenic
1139949367 16:70661693-70661715 TCCCCCTCCCCTGTGAGCCCCGG - Exonic
1141484249 16:84328355-84328377 TACCCAGCCCCTGTGAATGCTGG + Intronic
1142190925 16:88716973-88716995 TTCCCATCCCCTGGGGGTTCTGG - Intronic
1143087425 17:4426653-4426675 TGCCCAACTCCTGGGAGTTCTGG + Intergenic
1144456971 17:15426756-15426778 GCCCCAACCACTGTCAGATCAGG - Intergenic
1144619801 17:16810564-16810586 TCACCAACTCCTGTTGGTTCAGG - Intergenic
1145810480 17:27761088-27761110 CCGCCGACCCCTGGGAGTTCCGG - Intronic
1146139793 17:30355764-30355786 CCCCCAACACATGTGAATTCTGG + Intergenic
1146473686 17:33144742-33144764 TCCCCAACCCTCATGAGCTCTGG - Intronic
1149983658 17:61331175-61331197 TCCCCTACCCCTGTGTGCTGAGG - Intronic
1151608045 17:75153019-75153041 TCTCTAACCCCTGTGAGATATGG + Intronic
1151994490 17:77600186-77600208 CCTCTTACCCCTGTGAGTTCAGG + Intergenic
1152038633 17:77889198-77889220 TCCCCAACCCCTGAGACTTAAGG + Intergenic
1152576074 17:81141596-81141618 CCCCCAACCCCTGTGCCTCCTGG + Intronic
1154057700 18:11027155-11027177 TCCCCAAGCCCCTTGAATTCTGG - Intronic
1155775589 18:29756579-29756601 GTCCCAACCTCTGTGAATTCTGG + Intergenic
1156489838 18:37489549-37489571 TCCTCAACCCCTGTGAGATGTGG - Intronic
1156910507 18:42406527-42406549 TCCCCATCTCCTGTCAGTTAAGG + Intergenic
1160524521 18:79527050-79527072 TCCCCGTCACCTGTGACTTCTGG - Intronic
1161982638 19:7637746-7637768 TCCTCCACCCCGGGGAGTTCCGG + Intronic
1162904869 19:13817578-13817600 TCCCCCAACCCCGTGAGTGCTGG + Intronic
1163763445 19:19149436-19149458 TCCCCTGCCCCTGTGGGTCCTGG - Intronic
1163767411 19:19171172-19171194 TCCCCTAACCCTGTGGGGTCAGG + Intronic
1166971900 19:46574453-46574475 TCCTCAGCCCCAGTGTGTTCAGG + Intronic
1167450061 19:49562054-49562076 TGCCCAGCCTCTGTGGGTTCAGG - Intronic
926083085 2:10004484-10004506 ACACCAACCCCTGTGGGTTGGGG + Intergenic
926147261 2:10404375-10404397 TCCCCAGCCCCGCTGAGCTCAGG + Intronic
926603349 2:14870418-14870440 TCCCTAATCCCTGTAAGTCCTGG - Intergenic
927248998 2:20981471-20981493 TCTCCAAGCCCAGTGAGTCCAGG + Intergenic
927866551 2:26591621-26591643 TCCCCAACCCCCTTGAGTGTGGG + Intronic
928025675 2:27736686-27736708 TCACCATACCCTGTGAGGTCAGG + Intergenic
928206662 2:29289495-29289517 TCCCCAGCCCCTGTAGCTTCGGG + Intronic
928399877 2:30970148-30970170 TTTCCAGCCCCTGTGAGATCTGG - Intronic
928403985 2:31000187-31000209 TCCCTAAACCCTGAGTGTTCTGG + Intronic
930269002 2:49233598-49233620 CCCCCAACCCCTGTGCTTCCCGG + Intergenic
932323914 2:70842379-70842401 CCCCCAACCCCTGTGCTTCCTGG - Intergenic
935037034 2:99387164-99387186 TCCCAAAGCCCTGGGATTTCAGG + Intronic
935524881 2:104153288-104153310 TCTCCAACCCTAGTGATTTCAGG - Intergenic
937100601 2:119265168-119265190 TCCCCAACCCCGGTGGGTACTGG + Exonic
937982061 2:127621640-127621662 CCCCCAACCCCAGTGCCTTCTGG - Intronic
938014938 2:127859210-127859232 TCCCCGATCCCTGTGACTACAGG - Intergenic
939982414 2:148797442-148797464 TCCCCAACCCCTGTCACTGGAGG + Intergenic
940303457 2:152200640-152200662 ACCCCAGCCACTGTGAGTACTGG + Intergenic
942065833 2:172270667-172270689 CCCCCAACCCCTGTGCTTCCCGG + Intergenic
944668523 2:201976224-201976246 TCCCCATCCTCTGTGTGTACAGG - Intergenic
946337075 2:219044976-219044998 TCCCCAAACCCTGACAGTTTTGG - Intergenic
947825714 2:233104946-233104968 TCCACAGCTCCTGTGAGATCAGG - Intronic
948535150 2:238640438-238640460 TCCCCAGGCACTGTGATTTCTGG + Intergenic
948780507 2:240318928-240318950 TCCCAACCCTCTGTGAGCTCTGG - Intergenic
948915127 2:241030560-241030582 TCCTCATCCCCTGTGAGTCCAGG + Exonic
1168845731 20:943291-943313 GCCTCAACCCCCCTGAGTTCAGG - Intergenic
1169167804 20:3439567-3439589 TCCCCAACCCCTTTGAGGGTAGG + Intergenic
1170837171 20:19894508-19894530 TCCCAAATCCCTGGGATTTCAGG + Intronic
1171487801 20:25496601-25496623 TCCCCAGCCCCTTTGAGGGCAGG - Intronic
1172941831 20:38659454-38659476 TCCCCAACCACTTTGCATTCTGG + Intergenic
1174309736 20:49642664-49642686 TGACCAACCCATGGGAGTTCTGG + Intronic
1175911214 20:62406396-62406418 ACCCCCAGCCCTGTGGGTTCTGG - Intronic
1176305577 21:5121397-5121419 CCCCCAACCCCGCTGACTTCTGG - Intronic
1179851479 21:44140634-44140656 CCCCCAACCCCGCTGACTTCTGG + Intronic
1179880641 21:44292033-44292055 TCCCCAACACCTGCGAGCCCTGG - Intronic
1180202498 21:46233350-46233372 CCCCCAACCTCTGGGAGTTTGGG + Intergenic
1182310496 22:29401935-29401957 TCCCAACCCTCCGTGAGTTCAGG - Intronic
1182690782 22:32160402-32160424 TCCCAACCCTCAGTGAGTTCAGG + Intergenic
1183598001 22:38823683-38823705 CCACCAACCCCTGTGTGATCTGG + Intronic
1184415771 22:44350950-44350972 TCCCCACCCCCCGTGACTCCTGG - Intergenic
1184534544 22:45077642-45077664 TCCCCAACCCCAGTTAGCTTTGG + Intergenic
953397622 3:42585585-42585607 TCCCCATCAGCTGAGAGTTCAGG + Intronic
953769971 3:45772294-45772316 TCCCCACTCCCTGTTAATTCTGG - Intronic
956673094 3:71709637-71709659 TCCCAAACTCCTGGGATTTCAGG + Intronic
956898861 3:73692946-73692968 ACCCCAACCCCTTTGAGATGAGG + Intergenic
957280867 3:78149715-78149737 TCCCCAAACCCTCTGTGGTCTGG + Intergenic
958459327 3:94374562-94374584 TCCTCAGTCCCTGTGAGATCTGG - Intergenic
961977444 3:131041984-131042006 TCCCCAACCCCTTGCACTTCCGG - Intronic
962950690 3:140215958-140215980 TCCCCAACCCCTGGGGCCTCGGG + Intronic
963697974 3:148586138-148586160 TCCCCAGCTGCTGTGAGTTTTGG + Intergenic
967345969 3:188456139-188456161 TCCCCAACCACTGCGATTACAGG + Intronic
967851636 3:194086971-194086993 TGCCCATGCCCTGTGATTTCAGG + Intergenic
968480041 4:829218-829240 TCCCCAGCCCCAGTGAGGCCAGG + Intergenic
969012479 4:4077750-4077772 TCCCAAACCACTGGGATTTCAGG + Intergenic
969616519 4:8256005-8256027 TCCCCAAGCACTCTGAGTCCTGG - Intergenic
969849152 4:9943048-9943070 TCCCCAGGCCCTGCCAGTTCTGG - Intronic
972410698 4:38791231-38791253 TCCCCAACCCCTGTGTTTACAGG - Intronic
974096918 4:57373953-57373975 TCTCCAAACCCTGTGATTTAGGG + Intergenic
974296120 4:60000594-60000616 TTCCCAACCCCTGAGAGTGGTGG + Intergenic
974913339 4:68149313-68149335 TCCCCTCCCTCTGGGAGTTCAGG + Intergenic
975527859 4:75370962-75370984 TCCCCAACCCCTGTAAATTCAGG + Intergenic
976632202 4:87250439-87250461 TGCTCAACCTCTCTGAGTTCAGG - Intergenic
979200562 4:117973087-117973109 TCCCCAACTGCTGTGATTTCTGG + Intergenic
981249412 4:142581833-142581855 TTCCCTGCCCCTGTGAATTCAGG - Intronic
989342928 5:40396828-40396850 TCTTAAACCCCAGTGAGTTCAGG + Intergenic
997103754 5:130995469-130995491 TCCCTCACCTCTGTCAGTTCAGG + Intergenic
1001402270 5:171452501-171452523 TCCCCAGCCCCTGCATGTTCAGG + Intronic
1002374948 5:178782055-178782077 TCCCCAGCTCCTGAGAGGTCAGG - Intergenic
1004926872 6:20424664-20424686 CCCCCATCCACTGTGAGTTTAGG + Intronic
1005310539 6:24554995-24555017 ACCCCTACCCCTGAAAGTTCTGG + Intronic
1009006698 6:57797525-57797547 TCCCCAAACCCTTTAAATTCTGG - Intergenic
1009008864 6:57819934-57819956 TCCCCAAACCCTTTAAATTCTGG - Intergenic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1010298051 6:74223247-74223269 TCCCCAACCCCTGTGCTTCCTGG + Intergenic
1013375448 6:109509921-109509943 TCCCCAACCCCTGCAGGCTCAGG + Intronic
1013692887 6:112667176-112667198 TCCCCACCCCTTCTGAGTTGGGG + Intergenic
1018485558 6:164238024-164238046 TCCCCCAGACCTGTGTGTTCTGG - Intergenic
1021784051 7:24135045-24135067 TCCCAAGCCCCTTTGAGTTAAGG + Intergenic
1022394187 7:29970999-29971021 TCCCCAACCCCTGGCATTACAGG + Intronic
1022582016 7:31564887-31564909 ACCCCAATCCCTGTGAGAACTGG + Intronic
1023999108 7:45179278-45179300 CCCCCAACCCCTGGAAGCTCTGG + Intronic
1027211211 7:76150318-76150340 TCCCCGACCCCTGCGAGCGCCGG - Intergenic
1030943759 7:115690362-115690384 TCCCCAATCCCTGTGACCTATGG + Intergenic
1031886747 7:127252319-127252341 TCTCCAAGCCTTGGGAGTTCCGG + Intronic
1032528936 7:132604125-132604147 TCCACTACCCCTCTGTGTTCTGG + Intronic
1032605630 7:133348142-133348164 TCACAAAACCCTGTGAGGTCAGG - Intronic
1033713411 7:143974075-143974097 CTCCCCACCCCTGTGAGTGCTGG - Intergenic
1033835024 7:145300032-145300054 CCCACAACCCCTGGGAATTCTGG + Intergenic
1035129521 7:156639816-156639838 TTCCCCGCCCCTGTGAGCTCGGG - Exonic
1035635675 8:1142609-1142631 TCCCAAAACCCTGTGACTCCAGG - Intergenic
1037987527 8:23299222-23299244 TCACCCACTCCTGGGAGTTCTGG + Intronic
1038382543 8:27110129-27110151 TCACCAAGCCCTGAAAGTTCAGG + Intergenic
1038439331 8:27560538-27560560 TCCCCATCCCCCATGGGTTCAGG + Intergenic
1040628019 8:49174883-49174905 TCCCCAACCCCTGGCAGTGGGGG + Intergenic
1042383016 8:68140711-68140733 TCCCTCAACCCTGTGAGTTAGGG - Intronic
1042653823 8:71072908-71072930 TCCCAAACCCCTGGGATTACAGG - Intergenic
1045560254 8:103254755-103254777 CCCCCAACCCCAGTCAGTTCAGG - Intergenic
1047195048 8:122713443-122713465 TCCACAACACCTGGGAATTCTGG - Intergenic
1047402559 8:124558747-124558769 TCCCCCACCTCTGTCAGCTCGGG - Intronic
1049248881 8:141577668-141577690 TCCCCAGCCCCTGAGAGGTGGGG + Intergenic
1049662049 8:143823938-143823960 TCCTCAAGCACTGCGAGTTCTGG + Intronic
1051715026 9:19973624-19973646 TCCCCAAATCCTGTGAGTTATGG - Intergenic
1052991004 9:34519429-34519451 ACCCCATCCCCTGGGAGTTAGGG - Intronic
1054719815 9:68593608-68593630 TCCCAGACCCCTGTGACTCCTGG - Intergenic
1055343398 9:75309091-75309113 TACCCAAGCCCTGGGAATTCTGG - Intergenic
1056763676 9:89431754-89431776 TCCCAAAGCCCTGTGATTACAGG + Intronic
1057312260 9:93949777-93949799 TCCCCAACCCCTCAGAGCCCTGG + Intergenic
1057526124 9:95803435-95803457 TCCCCAACCCTAGTGACTTAAGG + Intergenic
1059948779 9:119440337-119440359 TCCCTGACTCCTGTGGGTTCTGG - Intergenic
1060552993 9:124494530-124494552 TCACCAATACCTGTGAGGTCTGG + Intronic
1060806919 9:126583499-126583521 TCCCCACCCCCAGGGAGATCTGG - Intergenic
1060810266 9:126607940-126607962 ACCACAACCCCTGTGACGTCAGG - Intergenic
1062175623 9:135160560-135160582 TTCCCAGACCATGTGAGTTCTGG - Intergenic
1190104289 X:47547822-47547844 TCCCCAAGCGCTGGGATTTCAGG - Intergenic
1190424483 X:50320157-50320179 TCCCCAACCCTTCTGTTTTCTGG + Intronic
1192598229 X:72434140-72434162 TCCCAAACCTGTGTGATTTCTGG - Intronic
1194590492 X:95794648-95794670 TCCCAAACCCCTGGGATTACAGG - Intergenic
1195274712 X:103270372-103270394 TCCCGAACTGCTGTGATTTCAGG - Intergenic
1195352251 X:104006548-104006570 CCCCCACCACCTGTGATTTCCGG + Intergenic
1195860786 X:109380641-109380663 TCCCCAACCCCAGGGAATTTGGG - Intronic
1197553971 X:127932089-127932111 TCCCCAACAGCTGGGAGTACAGG - Intergenic
1200071177 X:153530236-153530258 ACCCCAACCCCTGGGGGATCTGG - Intronic