ID: 901117877

View in Genome Browser
Species Human (GRCh38)
Location 1:6863328-6863350
Sequence TCCCCAACCCCTGTGAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 211}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901117867_901117877 17 Left 901117867 1:6863288-6863310 CCAAAAGTTTATACCCTTTGACC 0: 1
1: 6
2: 12
3: 83
4: 270
Right 901117877 1:6863328-6863350 TCCCCAACCCCTGTGAGTTCAGG 0: 1
1: 0
2: 2
3: 15
4: 211
901117870_901117877 -4 Left 901117870 1:6863309-6863331 CCACCATCTCCCCATTCCCTCCC 0: 1
1: 1
2: 93
3: 422
4: 2519
Right 901117877 1:6863328-6863350 TCCCCAACCCCTGTGAGTTCAGG 0: 1
1: 0
2: 2
3: 15
4: 211
901117868_901117877 4 Left 901117868 1:6863301-6863323 CCCTTTGACCACCATCTCCCCAT 0: 2
1: 124
2: 405
3: 757
4: 1320
Right 901117877 1:6863328-6863350 TCCCCAACCCCTGTGAGTTCAGG 0: 1
1: 0
2: 2
3: 15
4: 211
901117869_901117877 3 Left 901117869 1:6863302-6863324 CCTTTGACCACCATCTCCCCATT 0: 2
1: 135
2: 522
3: 1154
4: 2077
Right 901117877 1:6863328-6863350 TCCCCAACCCCTGTGAGTTCAGG 0: 1
1: 0
2: 2
3: 15
4: 211
901117871_901117877 -7 Left 901117871 1:6863312-6863334 CCATCTCCCCATTCCCTCCCCAA 0: 1
1: 1
2: 20
3: 185
4: 1417
Right 901117877 1:6863328-6863350 TCCCCAACCCCTGTGAGTTCAGG 0: 1
1: 0
2: 2
3: 15
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901117877 Original CRISPR TCCCCAACCCCTGTGAGTTC AGG Intronic