ID: 901122277

View in Genome Browser
Species Human (GRCh38)
Location 1:6905549-6905571
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901122277_901122281 -7 Left 901122277 1:6905549-6905571 CCCGCTTCCCTCTCATAATAAAG 0: 1
1: 0
2: 0
3: 12
4: 229
Right 901122281 1:6905565-6905587 AATAAAGCTTCAGCTCCTAGTGG 0: 1
1: 0
2: 0
3: 19
4: 157
901122277_901122285 19 Left 901122277 1:6905549-6905571 CCCGCTTCCCTCTCATAATAAAG 0: 1
1: 0
2: 0
3: 12
4: 229
Right 901122285 1:6905591-6905613 CCTTTGTCCATGCAGTCCCTTGG 0: 1
1: 0
2: 1
3: 28
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901122277 Original CRISPR CTTTATTATGAGAGGGAAGC GGG (reversed) Intronic
901122277 1:6905549-6905571 CTTTATTATGAGAGGGAAGCGGG - Intronic
907428483 1:54396582-54396604 CTCTATTTTGTGAGGGAGGCAGG - Intronic
907843814 1:58185225-58185247 CTAAAAAATGAGAGGGAAGCAGG + Intronic
909098894 1:71325151-71325173 CTTGAGTAGGAGAAGGAAGCTGG - Intergenic
909679578 1:78276970-78276992 GGTTTTTATGAAAGGGAAGCAGG + Intergenic
910964415 1:92793982-92794004 CTTTATAATGAGAGGGCACAGGG - Intergenic
911058637 1:93728985-93729007 CTTTTAAATGATAGGGAAGCCGG - Intronic
912221898 1:107687819-107687841 CTTTATTCTGAGAGGTAACATGG + Intronic
912332092 1:108829264-108829286 CTTTTTTATGATAGACAAGCTGG - Intronic
912598156 1:110900271-110900293 CTTCCTTATGACATGGAAGCTGG + Intergenic
915244668 1:154547859-154547881 CTCTCTTTTGAGAGGGAAGCTGG - Exonic
921388373 1:214594406-214594428 CTGAATGATGAGAGGGAAGTGGG + Intergenic
921712648 1:218388149-218388171 TTTTATTGTCAGAAGGAAGCTGG - Intronic
921778911 1:219137150-219137172 CTTTAGTATCAGAGTAAAGCTGG - Intergenic
922625217 1:227033724-227033746 ATTTATTATGGGAGGCAAGAGGG - Intronic
922932584 1:229402061-229402083 CATCCTTATGAGAGGGAGGCAGG - Intergenic
923509720 1:234639844-234639866 GTGTATTATGAGTGGGAAGAAGG + Intergenic
924327029 1:242905827-242905849 CTTTAGTATGAGAGTAAAGCTGG - Intergenic
1063403594 10:5771697-5771719 CTTTGATATGAAAGGGAAGGAGG - Intronic
1065796230 10:29310968-29310990 CCTGAGGATGAGAGGGAAGCAGG - Exonic
1066649945 10:37644874-37644896 CATTATCATGAGAGGCAAACAGG + Intergenic
1067032839 10:42890413-42890435 CATTATCATGAGAGGCAAACAGG + Intergenic
1067092707 10:43277431-43277453 CTTTATGATGGGAAGGAAGAAGG - Intergenic
1068584380 10:58780329-58780351 TTTTATTGTGAGTGGGAGGCGGG + Intronic
1071704449 10:87982183-87982205 CTCTAAAATGAGAGGGAGGCAGG - Intergenic
1071729580 10:88234253-88234275 CTTATAAATGAGAGGGAAGCAGG - Intergenic
1073075317 10:100821846-100821868 CTTTATGATGACAGGGAAGGAGG + Intronic
1074283539 10:112076557-112076579 CATCATTATGATAGAGAAGCAGG - Intergenic
1075131143 10:119740961-119740983 ATTTATTATGTGACGGATGCTGG + Intronic
1076086815 10:127639433-127639455 CTTTATAATGAGAGAAATGCAGG - Intergenic
1076180754 10:128405439-128405461 CTTCATTATGAAGGGGAACCTGG - Intergenic
1077397154 11:2330446-2330468 ATTTATTTTGAGATGGAATCTGG - Intergenic
1078168255 11:8909667-8909689 CTTTTTTATAAGGGGAAAGCAGG + Intronic
1078969454 11:16390481-16390503 CTTTATTATCAGAGAGTAGTTGG - Intronic
1079238309 11:18705181-18705203 TTTTACCATGAGAGGAAAGCTGG + Intronic
1079515505 11:21263257-21263279 CTTAAGTATGAGTGGAAAGCCGG - Intronic
1079969623 11:27020270-27020292 CTCTATTGTGAGAGGAAAGAGGG - Intergenic
1080945315 11:36966346-36966368 CTTTATTTTGCGATGGAAGAGGG - Intergenic
1081293604 11:41357531-41357553 CTTGATTCTGGGAGGGAAGAAGG + Intronic
1081985105 11:47296090-47296112 CTTTAATGGGGGAGGGAAGCAGG + Intronic
1082615383 11:55353941-55353963 CCTTATTAACAAAGGGAAGCTGG - Intergenic
1085161247 11:74348086-74348108 CGTTATTATCAGATGGAAGAAGG - Intronic
1086405931 11:86499000-86499022 CATGATTCTGGGAGGGAAGCTGG + Intronic
1087332989 11:96806421-96806443 GTGTATTATGAAAGGGAAACAGG - Intergenic
1087871782 11:103303503-103303525 GTTTTTTATAAGAGGGAGGCAGG + Intronic
1088627050 11:111737085-111737107 CTATATTATGTGAGGAAAGTGGG + Intronic
1089146402 11:116332412-116332434 ATTTATTATGAGATGGAATAAGG - Intergenic
1089820345 11:121220135-121220157 GATTCTTATAAGAGGGAAGCAGG + Intergenic
1090986482 11:131771184-131771206 CTTTATGGTGAGATGGAGGCAGG - Intronic
1091301638 11:134511534-134511556 CCTTATTAAGAAAAGGAAGCTGG - Intergenic
1093232241 12:16560404-16560426 CTTTGTAATCAGAGGTAAGCAGG - Exonic
1093238750 12:16642498-16642520 CTGTTTTATAAGGGGGAAGCTGG - Intergenic
1095732209 12:45518591-45518613 TTTTACTAGAAGAGGGAAGCCGG + Intergenic
1101407676 12:104443065-104443087 CATTCTTGTAAGAGGGAAGCAGG + Intergenic
1101766774 12:107708243-107708265 TTTTGAGATGAGAGGGAAGCAGG - Intronic
1102906135 12:116676503-116676525 CTTTTTTTTGGGAGGGAAGGGGG - Intergenic
1104364788 12:128167096-128167118 GCTTCTTATAAGAGGGAAGCAGG - Intergenic
1106030601 13:25998682-25998704 TTTTATTATTAGAGGAAAGTTGG + Intronic
1106256306 13:28025316-28025338 CTGTATTATGTGAGGGAAAGTGG - Intronic
1106407976 13:29490400-29490422 TGTTATAATGAGAGGGAAGAGGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107850087 13:44562649-44562671 GTTTAGTATGAAAAGGAAGCTGG + Intronic
1111249409 13:85583976-85583998 CTTTAATATGACAGGGAAGGTGG - Intergenic
1111654499 13:91135050-91135072 TTAAATAATGAGAGGGAAGCAGG + Intergenic
1112517341 13:100065940-100065962 CTTTTTTTTGAGATGGAGGCTGG + Intergenic
1114724519 14:24921537-24921559 CTTTACTATAAGAGGGTAGAAGG + Intronic
1117163413 14:53011097-53011119 CTTAAGTAAGACAGGGAAGCGGG - Intergenic
1117669530 14:58092725-58092747 GGTTCTTATGAGAGGGAAGTAGG - Intronic
1117729117 14:58703786-58703808 CTGAATTCTGAGTGGGAAGCTGG + Intergenic
1119302021 14:73579069-73579091 CTTTTTTTTGAGATGGAGGCTGG - Intergenic
1119515859 14:75247731-75247753 CTTTATTAAGAAAAGGAAACAGG - Intronic
1120202463 14:81552950-81552972 TGTTCTTATAAGAGGGAAGCAGG + Intergenic
1121806444 14:96829215-96829237 TTTTTTTTTGAGAGGGAAGTGGG + Intronic
1202829789 14_GL000009v2_random:15061-15083 CCTTTTTTTGAGGGGGAAGCTGG + Intergenic
1126683628 15:51227770-51227792 CTTCTTTATGAAAGGTAAGCAGG - Exonic
1126884411 15:53134266-53134288 CTTCATTCTTAGAGGGAAGAGGG + Intergenic
1127221433 15:56885224-56885246 CTTTATTGTGAGATGGAGGGAGG + Intronic
1127671737 15:61201267-61201289 CTTTATTTTGAGTGAGGAGCAGG - Intronic
1128810940 15:70572191-70572213 GTATCTTATAAGAGGGAAGCAGG + Intergenic
1129919414 15:79307319-79307341 CTCTGTGATGAGAGGGAGGCTGG + Intergenic
1130337440 15:82968791-82968813 CTTTATTTTGAGAGGGAGTGTGG + Intronic
1131881131 15:96863434-96863456 CTATATTATGATAGAAAAGCAGG + Intergenic
1132329557 15:101002743-101002765 TTTTATTTTGAGATGGAATCTGG + Intronic
1134786207 16:16946191-16946213 TTTTTTTATGAGATGGAATCTGG + Intergenic
1136054019 16:27674580-27674602 CGTCCTTATGAGAGAGAAGCAGG - Intronic
1137968554 16:52960686-52960708 CTTTTTTTTGAGATGGAATCTGG - Intergenic
1137994001 16:53188622-53188644 TTTTTTTTTGAGATGGAAGCTGG + Intronic
1138216799 16:55211623-55211645 CTTTCTTAACAGAGGGCAGCTGG - Intergenic
1138652693 16:58470603-58470625 TGTTTTTATAAGAGGGAAGCAGG + Intronic
1140018900 16:71217633-71217655 CCTTATTATGAGGGTGCAGCTGG - Intronic
1141581120 16:84999758-84999780 CTGTATCTTGAGAGGGAAGTGGG + Intronic
1143563095 17:7706561-7706583 CTCTTTTATGAGCGGGAAGTGGG - Intronic
1144079583 17:11750795-11750817 CTTTATTATAAAAGGTAGGCTGG + Intronic
1153382694 18:4455731-4455753 CTTTTTTAAGGGAGGAAAGCAGG + Intergenic
1155506475 18:26538403-26538425 GTTAATTGTGAGAGGGAAGAGGG + Intronic
1156471068 18:37377554-37377576 CTTAGAAATGAGAGGGAAGCTGG + Intronic
1157037798 18:43997165-43997187 ATTTATTTTGAATGGGAAGCTGG + Intergenic
1157123584 18:44934842-44934864 CTTTATTCTGAGAGGAAATGGGG - Intronic
1158158870 18:54457259-54457281 CTTTCTTCTGGGAGGGAAGTAGG - Intergenic
1158281233 18:55830703-55830725 CTTCGTGATGTGAGGGAAGCTGG + Intergenic
1158775042 18:60567935-60567957 CTTTATCATGAGAGGAAATTAGG - Intergenic
1158811205 18:61037924-61037946 CTTTAGTATTAGAGGGACACTGG - Intergenic
1159354306 18:67317344-67317366 CTTTATGACGTGAGGGAAGAGGG - Intergenic
1161186431 19:2924449-2924471 TTGTATGATGGGAGGGAAGCTGG - Intergenic
1163658069 19:18559373-18559395 AGTTATTATTAGAGGGAAGGGGG + Exonic
1166413838 19:42577352-42577374 CTTTATAATGACTGGGAACCTGG + Intergenic
1168072565 19:53961092-53961114 CTATATGATGAGAGAGAAGTTGG + Intergenic
1202642898 1_KI270706v1_random:112724-112746 CCTTTTTTTGAGGGGGAAGCTGG - Intergenic
927098866 2:19771438-19771460 CTTTATTCGAAGAGGAAAGCTGG - Intergenic
927314966 2:21671154-21671176 GTTTATTGTGAGCAGGAAGCAGG + Intergenic
929259021 2:39844264-39844286 TTTTATTCTGAGAGGGGAGCAGG + Intergenic
930978630 2:57494882-57494904 CTTCCTTATGAGAGGAAGGCAGG + Intergenic
933279005 2:80311731-80311753 ATTTCTTATGAGAGTGAAACAGG - Intronic
933842347 2:86297828-86297850 TTTTATTTTGAGAGGGACCCAGG - Intronic
935264044 2:101379746-101379768 ATTTATTCTGAGAGGGAGGCAGG + Intronic
937384146 2:121411210-121411232 TTCTGATATGAGAGGGAAGCGGG + Intronic
937618761 2:123960710-123960732 CTTTATTATCAGAGCCAAACAGG - Intergenic
938057467 2:128227195-128227217 GTTTATCATGGGAGGGAAACTGG + Intergenic
939305862 2:140410471-140410493 CATTATTATAGGAGGCAAGCAGG - Intronic
939846156 2:147248478-147248500 ATTTTTTATGAGTGGGAAGGGGG - Intergenic
940165068 2:150761844-150761866 AGTTCTTATCAGAGGGAAGCAGG - Intergenic
940904313 2:159155263-159155285 TTTTATTTTGATAGGAAAGCTGG - Intronic
942223864 2:173797903-173797925 CTTTTTTGTGAGCGGCAAGCTGG + Intergenic
944963987 2:204908074-204908096 CATTATTATGATAGAGAGGCTGG - Intronic
945933022 2:215874960-215874982 CTGGATTATGAGGGGCAAGCTGG - Intergenic
946373212 2:219293190-219293212 ATTTATTTTGAGAGGGAGTCTGG + Intronic
1171890017 20:30702927-30702949 CCTTTTTTTGAGGGGGAAGCTGG - Intergenic
1172817919 20:37704121-37704143 CTTTACTCTGAGAGAGAGGCAGG - Intronic
1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG + Intergenic
1174629070 20:51940609-51940631 ATTTATTTTGAGACGGAGGCTGG - Intergenic
1176608978 21:8859901-8859923 CCTTTTTTTGAGGGGGAAGCTGG + Intergenic
1178031544 21:28532773-28532795 CTTTGGTATTAGAGTGAAGCTGG + Intergenic
1178140112 21:29673078-29673100 CTTTATTCCCAGAGGGCAGCTGG + Exonic
1179056712 21:37943249-37943271 CTTTAGTATCAGTGGGATGCTGG + Intergenic
1179949543 21:44702077-44702099 CGTTCCTATGAGAGGGAGGCAGG + Intronic
1180359068 22:11869733-11869755 CCTTTTTTTGAGGGGGAAGCTGG + Intergenic
1182003245 22:26938508-26938530 TTTTATTGAGAGAGGGAAGGAGG - Intergenic
1182016080 22:27040846-27040868 GGTTATTGTGAGAGGTAAGCAGG + Intergenic
1183988010 22:41579920-41579942 CTTTTCCATGAGAGGGAAGCAGG - Intronic
950477547 3:13223512-13223534 CCTTCTCATCAGAGGGAAGCTGG + Intergenic
951650099 3:24941788-24941810 CTTTATGAGGAGATGGAATCTGG - Intergenic
953030392 3:39176101-39176123 TTTCATCAGGAGAGGGAAGCTGG - Intergenic
953341290 3:42136080-42136102 CTTTATGATGATAGAGAAACAGG - Intronic
959443052 3:106403611-106403633 CTTTAATATGAATGAGAAGCTGG + Intergenic
961053816 3:123769432-123769454 CTTACTCATGAGAGGGAAACAGG + Intronic
961496851 3:127299404-127299426 ATTTATTATGAAGAGGAAGCTGG + Intergenic
963937325 3:151067721-151067743 CTTTTTTTTGAGATGGAATCCGG + Intergenic
964593128 3:158389129-158389151 GTTAATTATAAGAGGGAAGGGGG - Intronic
966875731 3:184320593-184320615 CTATAAGATGAGTGGGAAGCAGG - Intronic
967343741 3:188429660-188429682 CTCTATTATGAAAGGGAAGACGG - Intronic
969889905 4:10250133-10250155 CTCTTCTATGAGATGGAAGCAGG + Intergenic
970980274 4:22087958-22087980 CTTAATACTGAGAGCGAAGCTGG + Intergenic
971072240 4:23107984-23108006 ATTTATTTTGAGAGGGACCCAGG + Intergenic
972591924 4:40496076-40496098 CTTTTTTCTCAGAGGAAAGCAGG - Intronic
974604224 4:64129296-64129318 ATTGATTTTGAGAGGGAAGTGGG - Intergenic
975394107 4:73854959-73854981 CCTCCTTATGAGAGGTAAGCCGG - Intergenic
976387208 4:84474828-84474850 CTTTTTCCTAAGAGGGAAGCTGG - Intergenic
976447456 4:85147961-85147983 CTTTCTTATGAGATATAAGCTGG + Intergenic
976928120 4:90527432-90527454 CTTTTTTATGAGAGATAAGTGGG + Intronic
978609862 4:110525855-110525877 ATTAATTGGGAGAGGGAAGCAGG + Intronic
978770400 4:112450439-112450461 CTTGGTTATGAGAGGGGAGGAGG + Intergenic
982297815 4:153847913-153847935 CTTTCTTCTGAGAGGTAGGCAGG + Intergenic
1202770266 4_GL000008v2_random:198619-198641 CCTTTTTTTGAGGGGGAAGCTGG - Intergenic
986480472 5:8181643-8181665 CTTTATAATGAGTGGGAATTTGG - Intergenic
987295284 5:16545017-16545039 CCTTATTTTGAGAGGAAAGCAGG + Intronic
991257742 5:64633844-64633866 CTTTATCCTGAAAGGCAAGCTGG + Intergenic
991277411 5:64865626-64865648 CCTTATTTTTAGAGGGAAGATGG + Intronic
991991419 5:72343715-72343737 CTTTATTATTAGCGTGAATCTGG - Intronic
992060350 5:73038510-73038532 TTTGATTATGCTAGGGAAGCTGG - Intronic
994367840 5:98935564-98935586 CTTTCTTATGAGAGGAGAGGGGG - Intergenic
994410333 5:99400231-99400253 CTTTTCTATGTGAGAGAAGCTGG + Intergenic
994483488 5:100365046-100365068 CTTTTCTATGTGAGAGAAGCTGG - Intergenic
995550940 5:113280682-113280704 CTTTGTTTTGAGAGGGCAGGAGG + Intronic
995640305 5:114249293-114249315 TTTTTTAATGAGAGGGAATCTGG + Intergenic
996570265 5:124926459-124926481 TTTTCTTTTGAGAGGGAATCTGG + Intergenic
997601355 5:135140891-135140913 CCTTGTTTTGAGAAGGAAGCTGG + Intronic
997602326 5:135149237-135149259 CTCTATTAAGAGAGAGAAGAAGG + Intronic
999996560 5:157097908-157097930 TTTTATTCTGAGAAGGTAGCAGG + Intronic
1001438412 5:171719113-171719135 CTTTTTTTTGAGATGGAGGCTGG + Intergenic
1001809851 5:174619304-174619326 ATGAATTATGAGAGGAAAGCAGG - Intergenic
1002028510 5:176411864-176411886 CATTCTTTAGAGAGGGAAGCAGG - Intronic
1003469372 6:6414916-6414938 CTTTAATGTGAGAGGAAGGCAGG + Intergenic
1004125245 6:12866692-12866714 TTTTATTTGCAGAGGGAAGCTGG - Intronic
1008554720 6:52663833-52663855 CTTTCCTATGAAAGGGCAGCAGG - Intergenic
1010114664 6:72288727-72288749 CTGAATTATGAAGGGGAAGCTGG - Intronic
1011045220 6:83074313-83074335 ATTTATTATGAGATGAAAGGAGG + Intronic
1011411634 6:87072532-87072554 CATTTTTATGTGAGGGAAGCTGG - Intergenic
1013350427 6:109300929-109300951 GTTTTGTATGAGAGGGAAGGAGG + Intergenic
1014510335 6:122313133-122313155 TTTTATTATGAAAGGGAAATAGG - Intergenic
1015532920 6:134239257-134239279 GTGTATTATCAGAGGGAAGTGGG - Intronic
1015868086 6:137747970-137747992 TTTTCTTAGAAGAGGGAAGCAGG + Intergenic
1017275366 6:152560592-152560614 CTTTAGTATGAGAGTAATGCTGG - Intronic
1018343396 6:162876319-162876341 CTGTATTATTAGAGGACAGCAGG - Intronic
1018902842 6:168059960-168059982 CTTTCTGATGGGAGGGAAGCTGG + Intronic
1022220133 7:28306394-28306416 CTATAGTTTCAGAGGGAAGCTGG - Intronic
1022416226 7:30179401-30179423 CTGGACTATGAGAGGGAAACAGG - Intergenic
1022984915 7:35643100-35643122 CTCTATTATTAGAGGACAGCAGG - Intronic
1025187489 7:56872197-56872219 ATTTATTTTGAGATGGAATCTGG - Intergenic
1025684436 7:63704723-63704745 ATTTATTTTGAGATGGAATCTGG + Intergenic
1026116306 7:67498607-67498629 TTTTATTGAGAGAGGGCAGCAGG + Intergenic
1026393222 7:69924416-69924438 TTTTATTATCAGAGTGATGCTGG + Intronic
1027614283 7:80402250-80402272 CTTTATTTTGGGAGGGTAGGAGG - Intronic
1029205207 7:98865726-98865748 CTCTATTATGAGGGGGGAGGGGG + Intronic
1031052275 7:116956019-116956041 TGTTTTTATGAGAGGGTAGCAGG + Intronic
1032056190 7:128686199-128686221 TTTTATTTTGAGACGGAATCTGG - Intronic
1034883447 7:154779415-154779437 CTTGTTTATGATAGGGAAGGAGG - Intronic
1035429349 7:158806312-158806334 CTTTGTTATGAAAGGTATGCTGG - Intronic
1036142500 8:6221185-6221207 TTTTATTATGAGAAGGCAGTAGG - Intergenic
1036686774 8:10917046-10917068 CTTTGCTAAGACAGGGAAGCAGG - Intronic
1037335483 8:17787471-17787493 CGTTATTGTGAGAAGGAAGGTGG - Intronic
1037371915 8:18189270-18189292 CGTTATTATGAGAGGAAGGGAGG - Intronic
1037680635 8:21094632-21094654 CTGTATTATGTGAGAGAAGTAGG - Intergenic
1039928165 8:41958050-41958072 CTTTATTATCAGTGTGAGGCTGG + Intronic
1040711759 8:50196968-50196990 CTTTATTTTGAGACAGAATCTGG - Intronic
1042677958 8:71343472-71343494 GTTTATCAGGAGAGGGAAACTGG + Intronic
1044216123 8:89612900-89612922 CTTTTCTATGAGAGGAAAGTTGG - Intergenic
1046279622 8:112008664-112008686 CTTTATTTTGAGACAGAGGCTGG - Intergenic
1047705664 8:127497064-127497086 CTTTATTATTAGAGGAGAGTAGG + Intergenic
1050511319 9:6399002-6399024 CATGATTCAGAGAGGGAAGCTGG - Intergenic
1054359083 9:64095289-64095311 CCTTTTTTTGAGGGGGAAGCTGG + Intergenic
1056194341 9:84214873-84214895 AGTTATTATAAGAGGGAGGCAGG - Intergenic
1058283834 9:103151188-103151210 CTGTGTTGTGAGAGGGATGCAGG + Intergenic
1058479800 9:105380358-105380380 CTTTTTTTTGAGATGGAATCTGG + Intronic
1059345007 9:113622047-113622069 CTTCGTTATGAGGGGGAAGGAGG - Intergenic
1203704378 Un_KI270742v1:25126-25148 CCTTTTTTTGAGGGGGAAGCTGG + Intergenic
1203559622 Un_KI270744v1:40696-40718 CCTTTTTTTGAGGGGGAAGCTGG - Intergenic
1186251290 X:7669646-7669668 GGTTATTATGGGAGGGAAACTGG + Intergenic
1186371165 X:8948930-8948952 CTTTCTTCTCAGAGAGAAGCAGG + Intergenic
1186591888 X:10939318-10939340 CTCTATTATCAGACGGAAACTGG - Intergenic
1186751769 X:12628820-12628842 CTTTATTAGGAGTGTGAAGACGG - Intronic
1187052719 X:15710387-15710409 CATTAATAAGAGAGGGAAGAAGG + Intronic
1188141910 X:26561092-26561114 CGTGATTATGAGAGGGTACCAGG - Intergenic
1188699016 X:33235925-33235947 TTTTTTTATGAGACGGAATCTGG + Intronic
1189136507 X:38556112-38556134 AGTTATAATGAGAGGGGAGCTGG - Intronic
1192560030 X:72122139-72122161 CATTATTCTGAGAAGGAATCCGG + Intergenic
1193502824 X:82301010-82301032 CTTTAGTATCAGAATGAAGCTGG - Intergenic
1194053253 X:89099731-89099753 TTTTATTTTGAGAGGGAGTCTGG + Intergenic
1194707939 X:97198886-97198908 CTTTGTTAAGAAAGGAAAGCAGG + Intronic
1194845355 X:98800661-98800683 CATTATTATAAGAGGAATGCAGG - Intergenic
1195409513 X:104554689-104554711 CTTTATGAAAAGAGTGAAGCAGG - Intergenic
1197548154 X:127853774-127853796 CCTTATTATGAGATGGAGGGTGG + Intergenic
1201224469 Y:11804742-11804764 CTTTAGTATGAGAGTAAAGCTGG - Intergenic