ID: 901123555

View in Genome Browser
Species Human (GRCh38)
Location 1:6913522-6913544
Sequence GCAGGAGGAAGCTGGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1345
Summary {0: 1, 1: 1, 2: 19, 3: 171, 4: 1153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901123555_901123566 23 Left 901123555 1:6913522-6913544 CCCTGCCCCCAGCTTCCTCCTGC 0: 1
1: 1
2: 19
3: 171
4: 1153
Right 901123566 1:6913568-6913590 CAGAAGTTTCTTCCTGCCCTGGG 0: 1
1: 0
2: 1
3: 33
4: 271
901123555_901123565 22 Left 901123555 1:6913522-6913544 CCCTGCCCCCAGCTTCCTCCTGC 0: 1
1: 1
2: 19
3: 171
4: 1153
Right 901123565 1:6913567-6913589 CCAGAAGTTTCTTCCTGCCCTGG 0: 1
1: 1
2: 3
3: 28
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901123555 Original CRISPR GCAGGAGGAAGCTGGGGGCA GGG (reversed) Intronic