ID: 901125775

View in Genome Browser
Species Human (GRCh38)
Location 1:6927783-6927805
Sequence CTAACTCACAGGAGACCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901125775_901125781 13 Left 901125775 1:6927783-6927805 CCTGCAGGTCTCCTGTGAGTTAG 0: 1
1: 0
2: 1
3: 25
4: 198
Right 901125781 1:6927819-6927841 GGCAGCCTTGGTGCACAGTTTGG 0: 1
1: 0
2: 2
3: 23
4: 178
901125775_901125778 -8 Left 901125775 1:6927783-6927805 CCTGCAGGTCTCCTGTGAGTTAG 0: 1
1: 0
2: 1
3: 25
4: 198
Right 901125778 1:6927798-6927820 TGAGTTAGCAGAGGCTCCTCAGG 0: 1
1: 0
2: 1
3: 16
4: 151
901125775_901125782 14 Left 901125775 1:6927783-6927805 CCTGCAGGTCTCCTGTGAGTTAG 0: 1
1: 0
2: 1
3: 25
4: 198
Right 901125782 1:6927820-6927842 GCAGCCTTGGTGCACAGTTTGGG 0: 1
1: 0
2: 1
3: 12
4: 154
901125775_901125779 1 Left 901125775 1:6927783-6927805 CCTGCAGGTCTCCTGTGAGTTAG 0: 1
1: 0
2: 1
3: 25
4: 198
Right 901125779 1:6927807-6927829 AGAGGCTCCTCAGGCAGCCTTGG 0: 1
1: 0
2: 0
3: 31
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901125775 Original CRISPR CTAACTCACAGGAGACCTGC AGG (reversed) Intronic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
900502414 1:3012875-3012897 CAATCTCTCAGGAGCCCTGCCGG + Intergenic
901125775 1:6927783-6927805 CTAACTCACAGGAGACCTGCAGG - Intronic
901612183 1:10507712-10507734 GTGACTCCCTGGAGACCTGCAGG - Intronic
904402461 1:30265854-30265876 GGGACTCACAGGAGGCCTGCCGG + Intergenic
905466859 1:38161202-38161224 CTAAGTCCCAGGATACCTGTGGG - Intergenic
906082352 1:43101703-43101725 AGAGCTCACAGGACACCTGCAGG + Intergenic
907337907 1:53712495-53712517 TGTACACACAGGAGACCTGCAGG - Intronic
909112620 1:71498800-71498822 CTTAATCATAGGAGACCTGGAGG + Intronic
912707933 1:111928717-111928739 CTAGCTCACAGGAGACCTCAGGG + Intronic
915229417 1:154434573-154434595 CTAACTGGCAGGAGAACTTCTGG - Exonic
920243121 1:204568285-204568307 CGATCTCAGAGGAGAGCTGCTGG + Intergenic
920816579 1:209340045-209340067 CTATCTCACAGGGCAGCTGCAGG - Intergenic
923290176 1:232537762-232537784 CTAACTCACAGGACTGCTGTGGG + Intronic
1064942436 10:20749795-20749817 CTAACTAACTGGAGACCATCTGG + Intergenic
1065571107 10:27071939-27071961 CTACCTCACAGGCGTCCTGCCGG + Intronic
1067044410 10:42976232-42976254 CTAAAGCACAGGAGAACTCCAGG + Intergenic
1068405787 10:56586541-56586563 CTACCTCACAGGGGACCTCGCGG - Intergenic
1068882824 10:62067979-62068001 CTCACTCAGATGAGACCTGTGGG - Intronic
1070425674 10:76284799-76284821 ATAACTCTCATGAGATCTGCTGG + Intronic
1074467074 10:113692697-113692719 CTACCTCACAGGTGACCTTGTGG - Intronic
1075071118 10:119320571-119320593 CGAGCTCAGAGGAGACCTCCAGG + Intronic
1076539946 10:131207501-131207523 CTGACTCAAGGGAGAGCTGCAGG - Intronic
1077154837 11:1086618-1086640 CTCCCACACAGGACACCTGCAGG - Intergenic
1081622116 11:44624792-44624814 ATAAGTCACAGGAGATCTGATGG - Intergenic
1082655957 11:55857280-55857302 CTGACTCCCAGGAGCCATGCGGG - Intergenic
1086909691 11:92457989-92458011 GTAACAGACAGGAGAGCTGCTGG - Intronic
1086909942 11:92460396-92460418 CTAACCCACAGGCGAACGGCAGG + Intronic
1087432682 11:98073775-98073797 TTAACACACAGGAGATCTTCGGG - Intergenic
1088135710 11:106553014-106553036 ACAGCTCAGAGGAGACCTGCAGG - Intergenic
1090758566 11:129815996-129816018 CCGACTCGCAGGGGACCTGCGGG + Intronic
1092183996 12:6465055-6465077 CCATCACCCAGGAGACCTGCAGG + Intronic
1092769635 12:11884923-11884945 CTGACTCACAGGGGACCTTTGGG + Intronic
1093671641 12:21883355-21883377 CTAAGTCTCAGGAGATCTGATGG + Intronic
1094626036 12:32125046-32125068 CTAATTCACAGGAGCCCAGAAGG - Intronic
1095300291 12:40576611-40576633 ATATCTCACAGTAGAACTGCTGG + Intergenic
1101776795 12:107802660-107802682 ATAACTCACAGGAGTTCTTCTGG + Intergenic
1101996827 12:109531691-109531713 CTAAATCCCCGGAGACCTGTGGG - Intronic
1102261419 12:111445650-111445672 GGAGCTCCCAGGAGACCTGCTGG + Intronic
1105800275 13:23896915-23896937 TAAACTCACAGGACACCTGCAGG - Exonic
1105848739 13:24316053-24316075 TAAACTCACAGGACACCTGCAGG + Exonic
1106017232 13:25881235-25881257 TTAATACACAGGAGATCTGCTGG + Intronic
1106859905 13:33894389-33894411 TTACCTCACAGGAGACCTCGTGG + Intronic
1106962262 13:35012536-35012558 CTATCTCACAGGATAGCTGCAGG - Intronic
1107011426 13:35674515-35674537 CAAACTCACAGAAGAGTTGCAGG - Intergenic
1107038132 13:35921583-35921605 CTATCTCACATGAGACCTTAAGG + Intronic
1108438975 13:50429568-50429590 ATAAGTCACAGGAGATCTGATGG - Intronic
1108616831 13:52141479-52141501 TTAACTCAGAAGAGACCAGCAGG + Intronic
1109319658 13:60794652-60794674 CTCACTCAGAGGACACCTGCTGG + Intergenic
1109547703 13:63848883-63848905 CTACCTCATAGGAGACCTCAGGG - Intergenic
1111614939 13:90651344-90651366 ATAACTCTCAGGAGATCTGGTGG + Intergenic
1116917080 14:50535925-50535947 ATAACTCTCACGAGACCTGATGG + Intronic
1118847666 14:69559893-69559915 CAAGCTCCCAGGAGTCCTGCAGG - Intergenic
1119484950 14:74981095-74981117 CAAACACACAGGAGACCAGCAGG - Intergenic
1120229100 14:81823360-81823382 ATAACTCTCATGAGACCTGACGG - Intergenic
1120325039 14:83013468-83013490 GTAAGTCTCAGGAGACCTGATGG + Intergenic
1121739504 14:96241512-96241534 CAAATTCACAGCAGCCCTGCTGG - Exonic
1122417925 14:101559306-101559328 CTAACTCAGAGGTGCCCTGATGG + Intergenic
1125592596 15:40864180-40864202 CTGGCTCCCAGCAGACCTGCAGG - Intergenic
1125881246 15:43197913-43197935 ATAAGTCTCAGGAGACCTGATGG + Intronic
1128241982 15:66107508-66107530 CTAACTCAGAGGTGGCCTCCTGG + Intronic
1129144514 15:73634408-73634430 CTGACTCACAGCAGACGTCCTGG + Intergenic
1129911209 15:79228020-79228042 CTGGCTCTCAGGGGACCTGCAGG + Intergenic
1131628826 15:94153841-94153863 GTAAGTCTCAGGAGACCTGATGG - Intergenic
1131694999 15:94867486-94867508 ATAACTCTCAGGAGATCTGATGG - Intergenic
1132561276 16:595368-595390 CTGCTTCACAGGAGGCCTGCAGG - Intronic
1132810922 16:1796631-1796653 GTAACTCTCATGAGACCTGATGG + Intronic
1133187822 16:4113231-4113253 CTAATTCTCCAGAGACCTGCAGG + Intronic
1135551749 16:23403909-23403931 AAAACTCACAGGAGAACTGGGGG + Intronic
1137256467 16:46778896-46778918 GTAGCTCAGAGGAGACCTGCAGG - Intronic
1143542136 17:7575371-7575393 CTAACACTCTCGAGACCTGCTGG + Intronic
1143860660 17:9888295-9888317 CTAACTCACAGAACTCCTGAGGG - Intronic
1146561325 17:33872698-33872720 CAAACTGACAGGTGAACTGCTGG - Intronic
1146894024 17:36528139-36528161 GTACCTCAGAGAAGACCTGCAGG - Exonic
1147624822 17:41893211-41893233 CATACCCCCAGGAGACCTGCAGG + Intronic
1149278375 17:55071511-55071533 ATAACTGACCAGAGACCTGCAGG - Intronic
1151491450 17:74434068-74434090 CTGACTCACAGGAGAGCTGGGGG + Intronic
1151555909 17:74846643-74846665 CCACCCCACAGGAGTCCTGCAGG + Intronic
1152741114 17:82018870-82018892 CAAACACACAGGCTACCTGCTGG + Exonic
1154167084 18:12023743-12023765 CTAACACACAGGGCACTTGCTGG - Intronic
1154268641 18:12900332-12900354 CTAACTAAATGGAGCCCTGCTGG + Intronic
1154317365 18:13315282-13315304 CAAACTAACAGGAGAACTGGAGG - Intronic
1155262148 18:24053747-24053769 CAATTTCACAGGAGACCTGATGG - Intronic
1158181933 18:54726018-54726040 CTAACTTTCAGGACATCTGCAGG - Intronic
1158635246 18:59150519-59150541 CTAGCTCACAGCAGAGCTGTGGG + Intronic
1159447573 18:68559304-68559326 ATAACTGACAAGAGAACTGCTGG + Intergenic
1159528020 18:69618657-69618679 ATAACTCTCATGAGACCTGATGG - Intronic
1160596897 18:79982082-79982104 CTAACCCACAGGAGACGGGGCGG + Intronic
1161085862 19:2334595-2334617 CGTACTCACAGGCCACCTGCAGG - Exonic
1161275383 19:3413451-3413473 CAAACTCACAGAACACCAGCTGG - Intronic
1162585421 19:11555293-11555315 CTATCTCAGAGGAGACTTGTGGG + Intronic
1162795790 19:13086983-13087005 CTATCCCACAGGAGAGGTGCTGG + Intronic
1162971060 19:14181820-14181842 CTAAGGCACAGGATCCCTGCAGG - Intronic
1163194012 19:15701911-15701933 CTACCTCACAGGGGACCTCATGG + Intergenic
1167235118 19:48309516-48309538 ACAGCTCAGAGGAGACCTGCAGG - Intronic
925220451 2:2135264-2135286 ATAAGTCTCAGGAGACCTGATGG + Intronic
925911683 2:8577849-8577871 CGATCTCACAGCAGCCCTGCCGG - Intergenic
926056156 2:9775353-9775375 CTCACTCACAGGCGGCCTGCAGG - Intergenic
926196294 2:10765533-10765555 CTACTTTCCAGGAGACCTGCAGG - Intronic
927385007 2:22522667-22522689 CTAACTTACAAGGGACCTGAAGG + Intergenic
929875407 2:45792539-45792561 CTAACACGCAGGAGAGATGCTGG + Intronic
932864518 2:75327587-75327609 CTGACTCACAGGAGCCCAGCAGG + Intergenic
935595489 2:104874159-104874181 CTTCCTCCCAGGAGACCCGCAGG - Intergenic
936044365 2:109174768-109174790 CTCACTCGCTGGAGCCCTGCTGG + Intronic
941085208 2:161109579-161109601 CAAACTCTAAGGAAACCTGCTGG + Intergenic
943734541 2:191339936-191339958 CTGTCTCACAGGAGACCTGCAGG - Intronic
945079202 2:206071870-206071892 CTAACTCACAGGAGCCCACATGG + Intronic
945166516 2:206952956-206952978 ATAAGTCTCAGGAGACCTGATGG - Intronic
946312437 2:218890219-218890241 CCCACTCCCAGGAGTCCTGCAGG - Exonic
946891833 2:224284629-224284651 GGAACTGACAGAAGACCTGCTGG - Intergenic
947058529 2:226135594-226135616 CTAACTCACAGAAGACCAAAAGG - Intergenic
948616583 2:239203071-239203093 CTATGGCACAGGAGCCCTGCAGG - Intronic
1169205624 20:3738820-3738842 CTCACTCACAGAAGAGCTGTTGG - Intronic
1169590024 20:7130486-7130508 CCAACTTGCAGGATACCTGCTGG + Intergenic
1170501081 20:16975452-16975474 ACAACTCAGAGGAGACCCGCAGG - Intergenic
1170700486 20:18699039-18699061 CAAACTCCCTGGTGACCTGCTGG - Intronic
1174117147 20:48234319-48234341 CGAATTCACAGGAGACCTGAGGG - Intergenic
1177598931 21:23285734-23285756 CTAAGTCTCATGAGACCTGATGG - Intergenic
1179380448 21:40894437-40894459 CTAAATCACAGCTGAACTGCAGG - Intergenic
1179486564 21:41714225-41714247 CCCACTCACAGGAGAGCTGCTGG + Intergenic
1179818702 21:43923930-43923952 CTGAGTGACAGGAGACTTGCGGG - Intronic
1179821915 21:43942050-43942072 CTAACTTACTGAAGACCTGAGGG - Intronic
1180178866 21:46108952-46108974 GGAGCTCACAGGAGACCCGCAGG + Intronic
1181378750 22:22482339-22482361 ATAACTCACTGCAGACCTCCTGG + Intergenic
1181793906 22:25289836-25289858 GTAACTCAGAGGAGAAATGCTGG + Intergenic
1181833902 22:25586379-25586401 GTAACTCAGAGGAGAAATGCTGG + Intronic
1183221085 22:36513690-36513712 CAAACTCACAGGAGTGCTGCAGG - Intronic
1184386409 22:44178216-44178238 CAAACTCACAGAAAAGCTGCAGG - Intronic
1184788770 22:46686258-46686280 CTGCCTCAGAGGAGTCCTGCGGG + Exonic
950687769 3:14630898-14630920 CTCACCCACAGGATCCCTGCTGG - Intergenic
951622911 3:24625759-24625781 ATAAGTCTCAGGAGACCTGATGG + Intergenic
952321644 3:32283466-32283488 CTAACTCCCGGGGGACGTGCTGG - Intronic
953386969 3:42512252-42512274 CTGTCTCACAGGTCACCTGCAGG - Intronic
953766612 3:45747755-45747777 ACAGCTCAGAGGAGACCTGCAGG - Intergenic
954517594 3:51192601-51192623 CTACATCACAGGAGACCTCACGG + Intronic
955066431 3:55537155-55537177 GTAACTCACTGCAGACCAGCGGG + Intronic
957095298 3:75772206-75772228 ACAGCTCAGAGGAGACCTGCAGG - Intronic
958171673 3:89947165-89947187 ATAACTCACAGGGGACCTCGTGG + Intergenic
958790481 3:98645458-98645480 GTATCTCACAGGGGACCTGTGGG - Intergenic
959863616 3:111242558-111242580 ACAGCTCACAGGAGACCTGCAGG + Intronic
959880270 3:111437102-111437124 CTAATTGAAAGGACACCTGCAGG + Intronic
960379185 3:116939079-116939101 CTATCTCACAGGAAACCTCATGG + Intronic
961427571 3:126860072-126860094 CTCACTCACAGAAGTACTGCTGG - Intronic
963057890 3:141202132-141202154 CTAGCACCCAGGAGAGCTGCTGG + Intergenic
964585338 3:158292431-158292453 CTAACACACAGGAGTACAGCAGG - Intronic
965215286 3:165855713-165855735 ATGACTCACAGGCAACCTGCAGG + Intergenic
965691169 3:171358422-171358444 ATAACTCTCAAGAGACCTGATGG - Intronic
969405096 4:6986536-6986558 CTGAATCCCAGGAGATCTGCGGG + Intronic
969938968 4:10711356-10711378 CAATCTCACAGAAGACCTTCTGG + Intergenic
970217909 4:13778857-13778879 CTAAGTCTCATGAGACCTGATGG - Intergenic
971961681 4:33496038-33496060 CAAACTCACAGGAAATCAGCTGG + Intergenic
972018837 4:34281951-34281973 CTACCTCACAGAAGACCTCCTGG - Intergenic
972913025 4:43842038-43842060 ATAAGTCTCAGGAGACCTGATGG - Intergenic
976461320 4:85315617-85315639 ATAAGTCTCATGAGACCTGCTGG - Intergenic
980202647 4:129676246-129676268 ATAAGTCACAGGAGATCTGATGG + Intergenic
981388670 4:144161780-144161802 CTAAATCACAGCAGAACTGAAGG - Intergenic
983280115 4:165670033-165670055 CAAACTCACAGGAGGGCTGTGGG + Intergenic
985623461 5:969166-969188 ACAAGTCACAGGAGAACTGCTGG + Intergenic
986492727 5:8308581-8308603 CTAACCCCCTGGAGCCCTGCTGG - Intergenic
986832327 5:11593599-11593621 ATAAGTCTCAGGAGATCTGCTGG + Intronic
988014530 5:25536658-25536680 ATAAATCTCAGGAGACCTGATGG - Intergenic
988924910 5:35979937-35979959 ATAAGTCACATGAGACCTGATGG - Intronic
992706651 5:79401976-79401998 CAAACTCACTGCAGCCCTGCTGG - Exonic
994547743 5:101187904-101187926 CTAATTCACAGGAGACCTCAGGG + Intergenic
994831023 5:104784344-104784366 CTAAGTCTCACGAGATCTGCTGG - Intergenic
996983297 5:129527061-129527083 CTAAATCACAGGTGGCCTACTGG + Intronic
997372743 5:133372353-133372375 CTGACACACAGGTGACCTCCAGG - Intronic
999440310 5:151595609-151595631 CAAACACTCAGCAGACCTGCTGG + Intergenic
1000778094 5:165443882-165443904 ATAAGTCACAGGAGATCTGATGG - Intergenic
1001667004 5:173441537-173441559 CCACATCACAGGATACCTGCTGG + Intergenic
1002072369 5:176687899-176687921 ACAACTCACAGGAGACCTACAGG + Intergenic
1003452143 6:6244890-6244912 CTAACTCACTCAAAACCTGCTGG - Intronic
1004723588 6:18290300-18290322 CTAAAGAACAAGAGACCTGCTGG + Intergenic
1005395562 6:25378509-25378531 CTACCTCACAGGGGACCTTGTGG - Intronic
1006517724 6:34553938-34553960 CCAACGCCCAGGAGACCGGCTGG + Intronic
1006901723 6:37507141-37507163 CTAATTCACAGTAGACCTTAGGG - Intergenic
1007818337 6:44541029-44541051 GTAAGTCCCAGGAGACCTTCCGG - Intergenic
1008464388 6:51814578-51814600 CTGAGCCACAGGAGGCCTGCAGG + Intronic
1008725755 6:54416641-54416663 CTAAGCCACAGATGACCTGCTGG - Intergenic
1009614631 6:65989588-65989610 CTTTCTCACAGGAGACCTCACGG + Intergenic
1010003511 6:70971481-70971503 CTAACTCTCAGGAGACCCACAGG + Intergenic
1010859371 6:80888008-80888030 CAAACTCACAGGAGCACTGTGGG - Intergenic
1011197404 6:84795679-84795701 CAAACTTACAGAAGACCTGGAGG - Intergenic
1013494891 6:110688772-110688794 CTACCTCACAGGGGACCTCGTGG + Intronic
1014081051 6:117286367-117286389 GTAAGTCTCAGGAGATCTGCTGG + Intergenic
1015333981 6:132014044-132014066 TTAACTCACAGTAGAATTGCTGG + Intergenic
1016498470 6:144690632-144690654 CTGTCTCACAGGAGACCTTGTGG - Intronic
1017183171 6:151573763-151573785 ATAACTCTCAGGAGATCTGATGG - Intronic
1019288807 7:237036-237058 CTGCCTCACAGGCCACCTGCGGG - Intronic
1020430444 7:8112193-8112215 GTTCCTCACAGGAGACCTGGGGG + Intergenic
1024004085 7:45212560-45212582 CCACCCTACAGGAGACCTGCTGG + Intergenic
1029205139 7:98865284-98865306 GGACCTCACAGGAGACCTGCTGG + Intronic
1030294692 7:107910695-107910717 CTAACTTACAGGAGTATTGCTGG + Intronic
1030428957 7:109417467-109417489 CTAACTTACAGGGGACGTGAAGG - Intergenic
1031242023 7:119257961-119257983 AAAGCTCAGAGGAGACCTGCAGG + Intergenic
1031447715 7:121874208-121874230 CAAAGTCAGAGGAGAGCTGCAGG + Intronic
1033684628 7:143627093-143627115 CTAACTACCAGGAGATCTGAAGG + Intronic
1033687804 7:143706312-143706334 CTAACTACCAGGAGATCTGAAGG + Intronic
1033699983 7:143830530-143830552 CTAACTACCAGGAGATCTGAAGG - Intergenic
1034461412 7:151199831-151199853 CTAAGTCAGTGGAGACCAGCTGG + Intronic
1035032614 7:155871331-155871353 CTCATTCACCGGAGACCTGTTGG - Intergenic
1035841626 8:2818006-2818028 ATAAGTCTCAGGAGACCTGGTGG + Intergenic
1036570256 8:9974124-9974146 GTACCTCACAGGGCACCTGCGGG - Intergenic
1039473463 8:37827395-37827417 CCCACCCACAGGCGACCTGCTGG - Intronic
1041737983 8:61131952-61131974 CTAACACTCAGGAGACCTGTGGG + Intronic
1042004960 8:64169677-64169699 ACAGCTCAGAGGAGACCTGCAGG - Intergenic
1047384442 8:124396116-124396138 CTACCTCACAGGGGACCTCCTGG - Intergenic
1049162663 8:141107332-141107354 CTCACACCCAGAAGACCTGCAGG - Intergenic
1049208890 8:141376287-141376309 CTTTCTCACAGTAGAGCTGCTGG + Intergenic
1061201236 9:129139664-129139686 CTAGCTCACTGGGGACCTGGAGG + Intronic
1061411106 9:130422225-130422247 CAAACTCACAGAAGACCTGTGGG - Intronic
1186805899 X:13139782-13139804 GTAGCTCACAGAAGACCTGCAGG - Intergenic
1188061197 X:25603999-25604021 ATAACTCAGAGGAGGCTTGCAGG - Intergenic
1192216425 X:69162519-69162541 AATACTCACAGGAGCCCTGCTGG + Exonic
1193664700 X:84300805-84300827 CTGACTCACAGAAGACCTGGGGG + Intergenic
1194262619 X:91716236-91716258 TTATCTCACAGGAGACCTTGGGG + Intergenic
1195820105 X:108935414-108935436 CTAACTTACAAGGGACCTGAAGG - Intergenic
1197092691 X:122557099-122557121 ATAAGTCTCACGAGACCTGCTGG + Intergenic
1198863204 X:141092524-141092546 ATAAGTCTCAGGAGATCTGCTGG - Intergenic
1198899486 X:141494863-141494885 ATAAGTCTCAGGAGATCTGCTGG + Intergenic
1199270329 X:145874669-145874691 ATAAGTCTCAGGAGACCTGATGG - Intergenic
1201596201 Y:15672307-15672329 CTAAATCAGAGAAGACCTGAAGG - Intergenic
1202250945 Y:22872201-22872223 CTAACTAACAGCAGACCTCTTGG + Intergenic
1202403934 Y:24505950-24505972 CTAACTAACAGCAGACCTCTTGG + Intergenic
1202466845 Y:25164132-25164154 CTAACTAACAGCAGACCTCTTGG - Intergenic