ID: 901126167

View in Genome Browser
Species Human (GRCh38)
Location 1:6930310-6930332
Sequence CGTCATATGCTGAAGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901126161_901126167 -1 Left 901126161 1:6930288-6930310 CCATGTTCCCACCATTGTACACC 0: 1
1: 0
2: 6
3: 130
4: 2259
Right 901126167 1:6930310-6930332 CGTCATATGCTGAAGGATGAAGG 0: 1
1: 0
2: 1
3: 5
4: 100
901126163_901126167 -9 Left 901126163 1:6930296-6930318 CCACCATTGTACACCGTCATATG 0: 1
1: 0
2: 0
3: 3
4: 38
Right 901126167 1:6930310-6930332 CGTCATATGCTGAAGGATGAAGG 0: 1
1: 0
2: 1
3: 5
4: 100
901126162_901126167 -8 Left 901126162 1:6930295-6930317 CCCACCATTGTACACCGTCATAT 0: 1
1: 0
2: 0
3: 1
4: 33
Right 901126167 1:6930310-6930332 CGTCATATGCTGAAGGATGAAGG 0: 1
1: 0
2: 1
3: 5
4: 100
901126160_901126167 15 Left 901126160 1:6930272-6930294 CCAGGGTGCTGGCGTACCATGTT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 901126167 1:6930310-6930332 CGTCATATGCTGAAGGATGAAGG 0: 1
1: 0
2: 1
3: 5
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901126167 Original CRISPR CGTCATATGCTGAAGGATGA AGG Intronic
901126167 1:6930310-6930332 CGTCATATGCTGAAGGATGAAGG + Intronic
902890811 1:19442073-19442095 CTCCAAATGCTGAAAGATGAAGG + Intronic
903347311 1:22695001-22695023 CGTGAAGTGCTGAGGGATGAGGG + Intergenic
904429117 1:30450684-30450706 AGTCAGATGATGGAGGATGAGGG - Intergenic
909250638 1:73350341-73350363 CTTCAAATCCTGAAGGGTGATGG + Intergenic
909429453 1:75570076-75570098 AGTCATTTGTTGAAGGCTGATGG + Intronic
917411741 1:174766302-174766324 AGCCATGTGCTAAAGGATGAAGG - Intronic
918484527 1:185015270-185015292 GGTCATAAGCTGAAAGGTGAAGG - Intergenic
919649114 1:200128084-200128106 CTGCATATACTGAGGGATGACGG - Intronic
919761643 1:201101928-201101950 CAACATATGCTGATGGAGGAGGG - Intronic
922898139 1:229116392-229116414 CGGCCTCTGCTGAGGGATGATGG - Intergenic
923803740 1:237235995-237236017 TGTCATATTCTGAAGGAATATGG + Intronic
1064035525 10:11910598-11910620 AGTCCTGTGTTGAAGGATGAGGG + Intergenic
1064163838 10:12970158-12970180 TGGCAAAGGCTGAAGGATGAGGG + Intronic
1070068604 10:73063316-73063338 CCTCACATGGTGAAGGCTGAAGG + Intronic
1075027714 10:118998614-118998636 TGTCATAGGCTGAAAGATCATGG + Intergenic
1075558692 10:123451932-123451954 CGTCAGATTCTGAAAGTTGATGG + Intergenic
1075928493 10:126272941-126272963 CCTCATATGCTCAAAGATGGTGG + Intronic
1076116049 10:127901603-127901625 TGTCAAATGCATAAGGATGAGGG - Intergenic
1077819241 11:5719774-5719796 GGGCATTTGCTGAAGGAGGATGG - Intronic
1078926559 11:15880627-15880649 TGTCAAATGCTCAAGGATAATGG - Intergenic
1080132808 11:28816314-28816336 GGTGATAGGCTGAAGGTTGAAGG + Intergenic
1083421118 11:62553821-62553843 CCTCAAATGCTGAGGGATAAGGG - Intronic
1083774161 11:64885076-64885098 TGTCAGATGCTGAAGGAAGGTGG - Intronic
1085067799 11:73513638-73513660 CGTCACATCCTGGAGGACGACGG + Intronic
1086388011 11:86329415-86329437 CTTTGTATCCTGAAGGATGAAGG + Intronic
1089340583 11:117754695-117754717 AGTCATATGGGGAAGGAGGAGGG + Intronic
1091894547 12:4090609-4090631 TGGCATATTCTGCAGGATGATGG - Intergenic
1106020482 13:25910031-25910053 CGTCATCTGCTGCGGGATGGTGG + Intronic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1108954103 13:56129604-56129626 CCTTAAATGATGAAGGATGATGG - Intergenic
1113608557 13:111627362-111627384 AGGCAGATGGTGAAGGATGAAGG - Intronic
1113668874 13:112161701-112161723 TGCCATATGCTGAAGGACTAAGG - Intergenic
1113684118 13:112268730-112268752 CTTAAAATGCTGAAAGATGATGG - Intergenic
1120829662 14:88986757-88986779 GGTCAGATACTGAAGGATCAAGG - Intergenic
1124672534 15:31654724-31654746 CGTGAAAAGCTGGAGGATGAAGG + Intronic
1127869902 15:63063107-63063129 CTTTATATCCTGAAGGAGGAGGG + Intronic
1130417482 15:83707058-83707080 TGTCATATGCTGAAGGATCAGGG - Intronic
1130943770 15:88534904-88534926 CTTCATATGCTGAATGATTTTGG - Intronic
1139244593 16:65429130-65429152 AGTGAGATGCTGAAGGAAGAAGG + Intergenic
1139437257 16:66943463-66943485 CATCATGTGATGAAGGATGCGGG - Intronic
1140893116 16:79301964-79301986 CGTCCTATGCCGAAGCCTGATGG + Intergenic
1142050934 16:87957773-87957795 CGTCATCTGGTGAAAGGTGAAGG - Intronic
1146455823 17:33009031-33009053 AGGCAGGTGCTGAAGGATGAAGG - Intergenic
1149643236 17:58218875-58218897 CGTCCTATGGGGAAGAATGAAGG + Intronic
1150324823 17:64248496-64248518 TGTCATCTGCTGAATGCTGAAGG + Intronic
1150556594 17:66260404-66260426 CATCTTGTGCTGAAGGATGCTGG - Intergenic
1151996992 17:77616062-77616084 TGGCATATGCTGAGTGATGAGGG - Intergenic
1160303439 18:77707048-77707070 CTTACTATGCTGAAGGATGAAGG - Intergenic
1160837347 19:1131178-1131200 GGTCATGTGGTGAAGGATGCAGG - Intronic
1163800015 19:19358979-19359001 CCTCATATGCTGATGGAGCATGG - Intergenic
1166252986 19:41584333-41584355 TGTCATCTGCTGAAAGAAGAAGG - Exonic
1168234034 19:55050710-55050732 AGTCACATGCTGAGGGATGGGGG + Intronic
1168269086 19:55239992-55240014 CGGCAGCTGCTGAAGGGTGAGGG - Exonic
925700967 2:6637644-6637666 CTTCATATGTTGAAGGAAGTTGG - Intergenic
926907746 2:17821749-17821771 CTTCAGATGGTGAAAGATGAGGG - Intergenic
930710784 2:54549361-54549383 TGTCATATGCTGCAGCATGGAGG - Intronic
932889070 2:75574821-75574843 GGTCATGTCCTGAAGGGTGATGG + Intergenic
937476582 2:122220496-122220518 TATCATCTGCTGAAGGAGGAGGG - Intergenic
939702832 2:145415384-145415406 CATTACATCCTGAAGGATGAAGG - Intergenic
946699814 2:222401198-222401220 CCTCACATCCTGAAGGATGTTGG - Intergenic
948552088 2:238779392-238779414 CCTCATGTGCTGGAGGATGATGG + Intergenic
1169763197 20:9119884-9119906 TGTCATATGCTAAAAGATTAAGG - Intronic
1170562581 20:17569933-17569955 CCTCATCTGCTGAAGGCTGCGGG - Exonic
1175658563 20:60792836-60792858 CATCAGATGCTGAAGGCTGGAGG - Intergenic
949586100 3:5439319-5439341 CGTGACATCCTGAAGGAGGATGG + Intergenic
955886062 3:63600167-63600189 CGTCATAAGATGAATGATGTTGG + Intronic
958027079 3:88060225-88060247 CATTATATATTGAAGGATGAGGG - Intronic
963971049 3:151429798-151429820 CCCCATATGATGGAGGATGAAGG - Intronic
967278109 3:187796081-187796103 CCTCATCTGTTGAATGATGAGGG - Intergenic
970551961 4:17190606-17190628 TATCATATACTGATGGATGATGG + Intergenic
971810325 4:31416917-31416939 CTTCACATTCTCAAGGATGAAGG - Intergenic
976119782 4:81767207-81767229 AGTCACATTCTGAATGATGAAGG - Intronic
983556446 4:169063336-169063358 CCTCATATGCTGGAGTTTGATGG - Intergenic
985349990 4:189049847-189049869 AGTCACATGCTGAGGGTTGAGGG - Intergenic
986576246 5:9215658-9215680 CTTAAAATGCTGAAGGCTGAAGG - Intronic
986979029 5:13425234-13425256 CAGCATATGCTGATTGATGATGG + Intergenic
990729003 5:58787803-58787825 CGTCAGAACCTGAAGAATGAGGG - Intronic
992075469 5:73188886-73188908 AGCCACATGCTGAAGGAAGATGG - Intergenic
992951803 5:81865806-81865828 AGACACATGCTTAAGGATGAAGG - Intergenic
995981001 5:118104183-118104205 CTTTATATGCTGAAGGAAAAAGG + Intergenic
1001945017 5:175771626-175771648 TGTCAGATTCTGCAGGATGAGGG + Intergenic
1004884035 6:20034991-20035013 GGTCACATTCTGAAGTATGAGGG - Intergenic
1005204200 6:23382004-23382026 CATCATTTGCTGGACGATGATGG + Intergenic
1014508786 6:122294442-122294464 TGTCATGTGATGAAGGATTAAGG + Intergenic
1020536734 7:9407629-9407651 TGTCCTTTGCTGAAGGATGATGG + Intergenic
1022644055 7:32214800-32214822 CCACATATGCTGAAGGATAGAGG - Intronic
1030530359 7:110704882-110704904 TGGCATATGCTGTGGGATGAGGG - Intronic
1031025968 7:116680542-116680564 CGGGATATGCTGAAGGGTCATGG + Intronic
1031811230 7:126371745-126371767 AGTCATATGCAGAAGATTGAAGG + Intergenic
1032253008 7:130273715-130273737 GGTCGTATGCAGAAGGATGATGG + Intronic
1039861028 8:41457823-41457845 CAGCATACACTGAAGGATGAAGG - Intergenic
1041623110 8:59996479-59996501 CTTCATAAAGTGAAGGATGATGG - Intergenic
1043126739 8:76405853-76405875 CATCATATAATGAAAGATGAAGG - Intergenic
1044937341 8:97305848-97305870 CTTCACATCATGAAGGATGAGGG + Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057925017 9:99138670-99138692 GGTCAGATGCTGAAGAAGGAAGG + Intronic
1059001017 9:110349070-110349092 CGGCATGTGCTGCAGGATGTGGG + Intergenic
1061910250 9:133718624-133718646 TGTCATTTGCTGAAGGACGTAGG + Intronic
1188928396 X:36074790-36074812 CATCAGAGGCTGAAGGTTGAGGG - Intronic
1191943964 X:66510091-66510113 AGTCATATGCAGAAGATTGAAGG - Intergenic
1194019081 X:88665460-88665482 CATCATATACTCAATGATGATGG - Intergenic
1195325602 X:103755858-103755880 CGTCAGATCCTGCAGGTTGAGGG + Intergenic
1195473027 X:105254753-105254775 AGTCATATGCAGAAGATTGAAGG - Intronic
1195916645 X:109942675-109942697 AGCCGTATGTTGAAGGATGAAGG - Intergenic
1197342516 X:125289738-125289760 CATGAGATGATGAAGGATGAAGG + Intergenic
1199843330 X:151672823-151672845 CCACACATGCAGAAGGATGATGG - Intronic