ID: 901127862

View in Genome Browser
Species Human (GRCh38)
Location 1:6941841-6941863
Sequence GTCCACTATAGGCATGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901127855_901127862 11 Left 901127855 1:6941807-6941829 CCAGCAGTGCCTGGGATGGGCTA 0: 1
1: 0
2: 3
3: 28
4: 183
Right 901127862 1:6941841-6941863 GTCCACTATAGGCATGGCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 100
901127852_901127862 15 Left 901127852 1:6941803-6941825 CCAGCCAGCAGTGCCTGGGATGG 0: 1
1: 0
2: 6
3: 32
4: 324
Right 901127862 1:6941841-6941863 GTCCACTATAGGCATGGCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 100
901127856_901127862 2 Left 901127856 1:6941816-6941838 CCTGGGATGGGCTAGAAGCCCAT 0: 1
1: 0
2: 1
3: 8
4: 141
Right 901127862 1:6941841-6941863 GTCCACTATAGGCATGGCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 100
901127851_901127862 16 Left 901127851 1:6941802-6941824 CCCAGCCAGCAGTGCCTGGGATG 0: 1
1: 0
2: 0
3: 31
4: 283
Right 901127862 1:6941841-6941863 GTCCACTATAGGCATGGCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 100
901127848_901127862 22 Left 901127848 1:6941796-6941818 CCTGTGCCCAGCCAGCAGTGCCT 0: 1
1: 0
2: 6
3: 44
4: 389
Right 901127862 1:6941841-6941863 GTCCACTATAGGCATGGCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901127862 Original CRISPR GTCCACTATAGGCATGGCCA GGG Intronic
900697439 1:4021071-4021093 GGCCACTGTAGACATGGCCGGGG + Intergenic
901127862 1:6941841-6941863 GTCCACTATAGGCATGGCCAGGG + Intronic
901170316 1:7252369-7252391 GTCTACCATGGGCATGGACATGG + Intronic
902065622 1:13683401-13683423 GTCCCATAAAGGCAGGGCCAAGG + Intergenic
902247165 1:15128647-15128669 CTCCACTATAGGCAGCGCCTGGG + Intergenic
902369707 1:15998186-15998208 GCCCTCTAGACGCATGGCCAGGG - Intergenic
923117469 1:230956270-230956292 GTGCACTGGAGGGATGGCCAAGG + Intronic
1067156319 10:43783866-43783888 GTCCACTGTTGGCTTGGACAAGG + Intergenic
1067378542 10:45751314-45751336 GCCCACTGTGGGCAGGGCCAGGG + Intronic
1067764160 10:49072652-49072674 GTCCAGTCTAGGCATGTCCTTGG + Intronic
1067886237 10:50091994-50092016 GCCCACTGTGGGCAGGGCCAGGG + Intronic
1071942262 10:90602994-90603016 GTCCTCCATTGTCATGGCCATGG - Intergenic
1075711386 10:124532585-124532607 GTCCACCACAGGCAAGGTCAGGG - Intronic
1076108462 10:127843667-127843689 GTCCACTGTGTGCATGGCTAAGG + Intergenic
1076468964 10:130705448-130705470 GTCCACTCTTTCCATGGCCAGGG - Intergenic
1077444696 11:2585555-2585577 GTCCACTCCTGGCATGGCCACGG - Intronic
1077524026 11:3053600-3053622 GTCCACTCCAGGCATGGCCCTGG + Intronic
1087804967 11:102545571-102545593 GTCCACAAACTGCATGGCCATGG - Intergenic
1088640760 11:111871089-111871111 GCCCACTCTAGGCCTGGCCCAGG + Intronic
1089977759 11:122747111-122747133 GGCCAGCACAGGCATGGCCAAGG + Intronic
1091778318 12:3198964-3198986 TACCACAACAGGCATGGCCATGG - Intronic
1099097412 12:78391902-78391924 GCCTACTAAAGGCATGGCTAGGG + Intergenic
1105314910 13:19249190-19249212 GTCCACCTTAGACATGGCAAGGG + Intergenic
1106568322 13:30906000-30906022 GCCCACCATAGGCAGGGCCTGGG + Intergenic
1110529669 13:76581420-76581442 GTCCCATATAGGCATGGGCAAGG + Intergenic
1110983044 13:81927531-81927553 GGCCACCATAGGCATTGCAAGGG + Intergenic
1112210592 13:97373549-97373571 TTCCACTGTATGCATGGCTAAGG + Intronic
1117499633 14:56339092-56339114 GTCTACTATTGCTATGGCCAAGG - Intergenic
1202850331 14_GL000225v1_random:13089-13111 GTCCACTGTAGGCACAGCGAAGG + Intergenic
1202866790 14_GL000225v1_random:125321-125343 GTCCTCTATAGGCAAAGCCTAGG - Intergenic
1124260700 15:28187809-28187831 CTCCACTAAATGCATGGCAAAGG - Intronic
1127222129 15:56890975-56890997 GTCCATTACAGACATAGCCATGG - Intronic
1129898348 15:79125307-79125329 CTCAACTCTAGGCATGGCCTAGG + Intergenic
1132924296 16:2420365-2420387 GTCCAGAATAGGCAAAGCCATGG + Intergenic
1136016885 16:27406135-27406157 GTCCACTTTGGCCAGGGCCAGGG + Intronic
1137036053 16:35570917-35570939 GCCCACTGTAGGCAAGGCCCAGG + Intergenic
1139214344 16:65112649-65112671 GTCCTCTATAGGCTTGGCAGTGG + Intronic
1139911646 16:70400946-70400968 TCCCACTCTAGGCATGGCCTTGG + Intronic
1144658574 17:17053574-17053596 GTCCACCATGGGCCAGGCCATGG + Intronic
1144787641 17:17840713-17840735 GTCCACTCTAGCCATTGCCTAGG + Intergenic
1146642699 17:34553168-34553190 GTCCACTATGGGCCAGGCAATGG - Intergenic
1158404469 18:57148766-57148788 GTCCAGGATAGTCATGGGCATGG - Exonic
1164088659 19:21928222-21928244 GTCTACTATAGGCAAAGCCCAGG - Intergenic
1164118059 19:22241064-22241086 GTCCTCTATGGGCAGAGCCAAGG + Intergenic
1164127885 19:22335091-22335113 GTCCCCTATAGGAAGGGCCCAGG + Intergenic
1164207225 19:23069077-23069099 GTCCTCTGTAGGCAGGGCCTAGG + Intergenic
1164325849 19:24190790-24190812 GTCCCCTTTAGGCAGTGCCAAGG + Intergenic
925836527 2:7952015-7952037 GTCCACTATTTCCATGGCAATGG - Intergenic
925962211 2:9028160-9028182 GTCTACCAAAGGCATGGCCATGG - Intergenic
928031865 2:27786860-27786882 TTCCACTACAGCCAAGGCCAGGG + Intronic
928196556 2:29220573-29220595 GTCAACTTTAGGCTTGGACAGGG - Intronic
933814020 2:86051680-86051702 GTCCTCCATAAGCCTGGCCAGGG + Intronic
943875413 2:193061358-193061380 GTCCACTTGAGCCATGGCTAAGG - Intergenic
948055654 2:235007832-235007854 GTCCACCCTGGGCATGGCTAGGG - Intronic
948299355 2:236890466-236890488 CTCCACTGTTGGCAAGGCCAGGG - Intergenic
948301158 2:236908549-236908571 GTCCATCATAGCCATGGCTATGG + Intergenic
1168900966 20:1364581-1364603 GACCAGTATAAGCATTGCCAGGG - Intronic
1170843888 20:19946102-19946124 GTCTGCTTTAGGCATGACCAGGG - Intronic
1174141584 20:48417953-48417975 GTTCACTATAGGGATGGCACCGG - Intergenic
1183350671 22:37333016-37333038 GTCCACTAGAGGCAGGGTCCAGG + Intergenic
1183507545 22:38217997-38218019 GTTCACTAAAGGGATGCCCAGGG - Intergenic
1185128747 22:49025770-49025792 GGCCACTGGAGGCAGGGCCATGG + Intergenic
952834436 3:37591404-37591426 GTCCACTGCAGGAATGGCTAAGG - Intronic
953329342 3:42039134-42039156 GTCCAAAATAGGCATATCCAGGG - Intronic
953408682 3:42674981-42675003 GTCCAGTACAGGGATTGCCAAGG + Intergenic
953719355 3:45341821-45341843 GTCCACTTTAGGGGTGGTCAGGG - Intergenic
955615753 3:60804883-60804905 CTGCACTCTTGGCATGGCCATGG + Intronic
958883593 3:99700833-99700855 GTCCAGCATACACATGGCCAGGG - Intronic
961061815 3:123834977-123834999 GTGCACTATAAGCATGCCCATGG + Intronic
964881726 3:161430774-161430796 GTCCACAAAAGGCATTGCCTTGG + Intergenic
967901784 3:194462181-194462203 ATCCACTGTAGGTATGGACAGGG - Exonic
970448384 4:16142796-16142818 GCCCTCTATGGGCATGGCGATGG - Intergenic
970821990 4:20228041-20228063 GTGGACTAGAAGCATGGCCACGG + Intergenic
985927015 5:3026752-3026774 TCCCACTCTATGCATGGCCAGGG + Intergenic
986614400 5:9601697-9601719 GTCCACCTAAGGTATGGCCATGG - Intergenic
986759867 5:10870117-10870139 GTCCACTTTGGACATTGCCAAGG - Intergenic
988162310 5:27534983-27535005 GACCACTATAGAAATGGTCATGG + Intergenic
988964074 5:36398408-36398430 GTCCACTATTGAGAAGGCCAGGG + Intergenic
1000100641 5:158013113-158013135 GTCCTCTATAGAAATGGACAGGG - Intergenic
1000749661 5:165078247-165078269 TTCCACTACAGGCATTGCCAGGG - Intergenic
1001131690 5:169069550-169069572 GTCCCCTAGAGGCATGCCCAGGG + Intronic
1005379566 6:25219122-25219144 GGCCACACTAGGCATGGCCCAGG + Intergenic
1014227857 6:118868343-118868365 GTCATCCATAGGCATGGGCAAGG + Intronic
1015973219 6:138763316-138763338 GTCCACTATTGCCATGGCTGTGG + Intronic
1024158307 7:46648470-46648492 AACCACTCTAGCCATGGCCACGG - Intergenic
1024528715 7:50372562-50372584 GATCACTATGGGCAAGGCCAAGG - Intronic
1025745780 7:64241484-64241506 GTCCCCTATGGGCAGGGCCAAGG + Intronic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1033740587 7:144272467-144272489 CTCCTCTCTTGGCATGGCCAAGG + Intergenic
1033753320 7:144377146-144377168 CTCCTCTCTTGGCATGGCCAAGG - Exonic
1035157478 7:156925928-156925950 GTCCACCACAGGCCTTGCCAGGG - Intergenic
1035157491 7:156925967-156925989 GTCCACCACAGGCCTTGCCAGGG - Intergenic
1035157504 7:156926006-156926028 GTCCACCACAGGCCTTGCCAGGG - Intergenic
1036413691 8:8527155-8527177 GTCCATTCTAGGCGAGGCCAGGG + Intergenic
1037656440 8:20888075-20888097 GCCCACTAGATGCATGGCCGAGG - Intergenic
1046330022 8:112701992-112702014 GACCAATATAGGTATGTCCAAGG - Intronic
1052079090 9:24180684-24180706 GTCCATTTTAGTCATGGCTAGGG + Intergenic
1061782353 9:133003633-133003655 GTCCACTCTGGGCAGGGCCTTGG + Intergenic
1062053316 9:134458277-134458299 GTCCACCAGAGGCTTGACCAAGG - Intergenic
1062673604 9:137726051-137726073 ATCAACTATAGTCAAGGCCAGGG - Intronic
1203737521 Un_GL000216v2:150836-150858 GTCCTCTATAGGCAAAGCCTAGG + Intergenic
1203737747 Un_GL000216v2:152886-152908 GTCCCCTGTAGGCAAGGCCTAGG + Intergenic
1203739438 Un_GL000216v2:166102-166124 GTCCCCTATAGGCAAAGCCTAGG - Intergenic
1187281033 X:17858956-17858978 GCCCACTAGAGGCATCCCCAGGG - Intronic
1187790038 X:22940788-22940810 GTCTTCTCTAGGCATTGCCAAGG + Intergenic
1188981132 X:36728280-36728302 CTCCTTAATAGGCATGGCCAAGG - Intergenic
1189947728 X:46196231-46196253 GTCCACTGTGAGCATGCCCAGGG - Intergenic
1197749369 X:129954083-129954105 GTGCACTTTAGGCATAGCCCTGG + Intergenic
1197759578 X:130018252-130018274 GTCCACAATAGGCAAATCCATGG + Intronic
1200890904 Y:8323003-8323025 GTCCTCTCTAGGCAAGGCCTAGG - Intergenic