ID: 901128652

View in Genome Browser
Species Human (GRCh38)
Location 1:6948252-6948274
Sequence CCATATATGAAGATGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901128652_901128658 -10 Left 901128652 1:6948252-6948274 CCAGCTGCCATCTTCATATATGG 0: 1
1: 0
2: 0
3: 9
4: 171
Right 901128658 1:6948265-6948287 TCATATATGGTAGGCATTTGGGG 0: 1
1: 0
2: 2
3: 21
4: 148
901128652_901128660 -6 Left 901128652 1:6948252-6948274 CCAGCTGCCATCTTCATATATGG 0: 1
1: 0
2: 0
3: 9
4: 171
Right 901128660 1:6948269-6948291 ATATGGTAGGCATTTGGGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 169
901128652_901128662 12 Left 901128652 1:6948252-6948274 CCAGCTGCCATCTTCATATATGG 0: 1
1: 0
2: 0
3: 9
4: 171
Right 901128662 1:6948287-6948309 GGAGGTACCAGCCAACCTGGTGG 0: 1
1: 0
2: 1
3: 11
4: 139
901128652_901128659 -9 Left 901128652 1:6948252-6948274 CCAGCTGCCATCTTCATATATGG 0: 1
1: 0
2: 0
3: 9
4: 171
Right 901128659 1:6948266-6948288 CATATATGGTAGGCATTTGGGGG 0: 1
1: 0
2: 2
3: 8
4: 137
901128652_901128661 9 Left 901128652 1:6948252-6948274 CCAGCTGCCATCTTCATATATGG 0: 1
1: 0
2: 0
3: 9
4: 171
Right 901128661 1:6948284-6948306 GGGGGAGGTACCAGCCAACCTGG 0: 1
1: 0
2: 1
3: 18
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901128652 Original CRISPR CCATATATGAAGATGGCAGC TGG (reversed) Intronic
900688487 1:3964938-3964960 CCTTGTTTAAAGATGGCAGCAGG - Intergenic
901128652 1:6948252-6948274 CCATATATGAAGATGGCAGCTGG - Intronic
904166737 1:28561455-28561477 CCATATAGGAGGAGGGGAGCCGG + Intronic
904976300 1:34459549-34459571 CCAGATATTATGATGACAGCTGG - Intergenic
907271021 1:53291207-53291229 CCAGAAATGAAGACGGCAGGGGG + Intronic
907811434 1:57874520-57874542 CCAAACATGAAGGTGCCAGCAGG + Intronic
913403831 1:118465630-118465652 GCATATCTTAACATGGCAGCAGG - Intergenic
913417447 1:118626549-118626571 GCATATATCAAGATGGTAGAAGG + Intergenic
914389007 1:147201378-147201400 CCATATTTGAGGATGGCTCCAGG - Exonic
914739488 1:150451838-150451860 CCATATAAGAAGAGGGAAACTGG + Intronic
916866451 1:168864652-168864674 CCATACCTTGAGATGGCAGCAGG + Intergenic
918087974 1:181261560-181261582 CCATATGTCAAGGTGCCAGCTGG - Intergenic
918127566 1:181597776-181597798 CATTTTATGCAGATGGCAGCAGG + Intronic
919271254 1:195349524-195349546 GAATATGTGAAGTTGGCAGCAGG + Intergenic
919388564 1:196953200-196953222 CCTTATATGAATAAAGCAGCTGG + Intronic
919391038 1:196986313-196986335 CCATATATGAATAAAGCAGCTGG + Intronic
919929548 1:202212486-202212508 CCCAATATCAAGATGTCAGCAGG + Intronic
920334433 1:205235141-205235163 CCTTATATGAAGCAGGCAGAGGG + Intronic
920725123 1:208427763-208427785 TCAGAAATCAAGATGGCAGCAGG - Intergenic
921189026 1:212693580-212693602 CCATTTCTGAAAAGGGCAGCTGG + Intronic
921781388 1:219169584-219169606 ACAAATATGAAGATTGCAGGAGG + Intergenic
922112066 1:222569344-222569366 ACATACATGGAGATGGCAGCTGG + Intronic
1063369363 10:5511272-5511294 CCTCCTATGAAGATGGCACCAGG + Intergenic
1063756968 10:9022273-9022295 GCATATATAGAGATGACAGCTGG + Intergenic
1064079920 10:12300104-12300126 CCATCCATGAACATGACAGCGGG + Intergenic
1064725426 10:18274421-18274443 TCAAATCTGAATATGGCAGCAGG + Intronic
1065022827 10:21515152-21515174 TCCTATATGGAAATGGCAGCTGG - Exonic
1067841347 10:49681888-49681910 CCATATATGAAGTTGGGGGAAGG + Intronic
1071012389 10:80953680-80953702 CCATCTAGAAAGATGGGAGCAGG + Intergenic
1073885660 10:108036880-108036902 CCTTATATGAATAAGGCAGAGGG - Intergenic
1074512075 10:114122650-114122672 CCATATATTCAGAGGGCAGAAGG + Exonic
1076834024 10:133011997-133012019 CCATTTGTGAAGATGGCGGCTGG - Intergenic
1078619659 11:12895358-12895380 CCACATATTAAGATGGCATCAGG + Intronic
1081638600 11:44737499-44737521 CGATCTATGAAAATGCCAGCTGG + Intronic
1089564359 11:119363285-119363307 CCATTTATGCAGCGGGCAGCGGG - Intronic
1091222276 11:133936542-133936564 CCAGAAATCAAGAGGGCAGCTGG + Intronic
1094074515 12:26458182-26458204 CACAAAATGAAGATGGCAGCAGG + Intronic
1098319035 12:69222169-69222191 CCATTTATGAGGATGGGGGCAGG - Intergenic
1099534638 12:83828622-83828644 CCATCTATAAAGAGGGGAGCAGG + Intergenic
1106818501 13:33436953-33436975 CCATATACAAAGATGGAAGGCGG - Intergenic
1106956025 13:34940571-34940593 GCATATATCTATATGGCAGCAGG - Intergenic
1107363716 13:39647372-39647394 CCATTTATGAACAAGGAAGCGGG + Intergenic
1110202056 13:72863229-72863251 CCATAAATTAAGATGGAAGAAGG + Intronic
1111495391 13:89042339-89042361 CCATATATGAAGATAAGAGAAGG - Intergenic
1113374444 13:109751071-109751093 CCATCTATGAAGCAGGCAGCAGG + Intergenic
1113961122 13:114126725-114126747 CCATCTATGAAGATCTGAGCGGG + Intronic
1116781636 14:49243627-49243649 CCATCTATGAACAAGGAAGCAGG + Intergenic
1117368028 14:55050865-55050887 TCAGAAATGAAGATGGCGGCTGG + Intergenic
1117405591 14:55399937-55399959 ACAAATATACAGATGGCAGCAGG + Intronic
1119640833 14:76313659-76313681 CCATCAATTAAAATGGCAGCTGG + Intronic
1120639562 14:86993973-86993995 CCATATCAGAAGATTGAAGCTGG + Intergenic
1202905762 14_GL000194v1_random:71741-71763 CAACATATTCAGATGGCAGCGGG - Intergenic
1125059333 15:35400352-35400374 CAATATAGGAAGATGGAAGGAGG + Intronic
1125404133 15:39335289-39335311 GAATATATAAAGATGCCAGCAGG - Intergenic
1128084219 15:64874831-64874853 CCATGTCTGGAGTTGGCAGCAGG + Intronic
1130096893 15:80862674-80862696 CCATGCACGAAGATAGCAGCAGG + Intronic
1130193854 15:81760952-81760974 GCCCATTTGAAGATGGCAGCAGG - Intergenic
1131672091 15:94630944-94630966 TCACAAATGAAGAAGGCAGCAGG + Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133651009 16:7814647-7814669 ACATATAAGAAGAGGGCACCAGG + Intergenic
1133912634 16:10079639-10079661 CCATCTATGAAAAAGGAAGCAGG + Intronic
1134899818 16:17927382-17927404 CCATAAATGAAGTTTGTAGCAGG + Intergenic
1138731887 16:59204782-59204804 CCAGGCATGAAGATGCCAGCAGG + Intergenic
1139391279 16:66607353-66607375 CCCTGTATGAATAAGGCAGCAGG + Intronic
1140362490 16:74356389-74356411 CCATATGTGAAGAAAGCAGGTGG + Intergenic
1142664253 17:1453350-1453372 CCAAAGTTGAAAATGGCAGCAGG - Intronic
1148049975 17:44765152-44765174 CCATTTATCAAGAGGGCAGCGGG - Intronic
1148140002 17:45321572-45321594 CCACATAGGGAGATGGCAGGGGG + Intergenic
1149094099 17:52819707-52819729 CCACTTATGAAGGTGTCAGCTGG + Intergenic
1157932137 18:51834761-51834783 CCCTATATGAAGAGGGCAAAAGG - Intergenic
1158556116 18:58475965-58475987 CTATAGATGAAGGTGCCAGCAGG - Intergenic
1161997080 19:7719812-7719834 TCATAAATGCAGATGGCAGGTGG + Intergenic
1166499741 19:43331665-43331687 CCATATCTGAAGAAGGCAAATGG - Intergenic
926228755 2:10986925-10986947 CCATGTAGGAAGAAGGCAGAGGG + Intergenic
929395618 2:41518818-41518840 CCTTCTATGAAGATTGCATCAGG - Intergenic
930312866 2:49763862-49763884 CCATATATGAACCAGGAAGCAGG + Intergenic
931621172 2:64211174-64211196 TGATATATGAAGCAGGCAGCTGG - Intergenic
933316964 2:80727116-80727138 CAATATACTAAGATGCCAGCTGG + Intergenic
936949218 2:117960646-117960668 CCACATATCAAGATGGCTGCTGG - Intronic
937080901 2:119139008-119139030 CCTTATAAGAAGGAGGCAGCGGG - Intergenic
939591382 2:144067658-144067680 CCAGAGAAGAAGGTGGCAGCTGG + Intronic
939787734 2:146537758-146537780 TCTTAGATGAAGATGCCAGCTGG - Intergenic
941087098 2:161130685-161130707 GCATAATTGAAGATGGCAGGAGG - Intergenic
943070604 2:183136535-183136557 CTATATCTGAAGATGGAAGATGG - Intronic
944077910 2:195752741-195752763 ACAAATATGAAGATGGCAACTGG + Intronic
945198563 2:207259619-207259641 CCCAAGATGAAGATGTCAGCAGG + Intergenic
946528960 2:220550902-220550924 CCATCTATGAACAAGGAAGCTGG - Intergenic
948290628 2:236821694-236821716 CCATATAAAAGGCTGGCAGCTGG - Intergenic
948385114 2:237576141-237576163 CCAGACATGGAGCTGGCAGCAGG + Intronic
1170354533 20:15477833-15477855 CCTTATATGAGGAAGGCAGGAGG + Intronic
1170388955 20:15851389-15851411 GCAAATATGAAGGTGTCAGCAGG + Intronic
1171281667 20:23904995-23905017 CCATATCTGAAGATTTAAGCTGG - Intergenic
1172367780 20:34363297-34363319 CCCTAGACTAAGATGGCAGCCGG - Intronic
1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG + Intergenic
1178374073 21:32051919-32051941 CCATCTATGAACAAGGAAGCAGG - Intergenic
1179227458 21:39467721-39467743 CCATGCCTGATGATGGCAGCAGG + Intronic
1179928991 21:44554770-44554792 CCACATTTAAAGATGGCAGAAGG - Intronic
950629034 3:14268986-14269008 CCATCTATGAATAAGACAGCAGG + Intergenic
951090768 3:18571353-18571375 CGATATACAAAGATGGCATCTGG - Intergenic
954887293 3:53886850-53886872 CCAGATATGATGATGGAAGAGGG - Exonic
955938716 3:64127896-64127918 CCCTACAGGAAGAGGGCAGCAGG + Intronic
958658589 3:97036044-97036066 CCATTTATGAACAAGGAAGCAGG + Intronic
959534665 3:107470963-107470985 CCAGCTCTGAAGAAGGCAGCGGG + Intergenic
959950072 3:112170915-112170937 CCATGTATGAAAATTTCAGCTGG + Intronic
963085006 3:141428233-141428255 CCATGGAAGAAGCTGGCAGCTGG - Intronic
966212843 3:177470705-177470727 CCAGATATGAAGAAGCCAGAGGG + Intergenic
967884076 3:194321633-194321655 CCTTCTAGGAGGATGGCAGCAGG - Intergenic
968813302 4:2809575-2809597 CCAGAGATGCAGATGGCAACAGG + Intronic
969360961 4:6663680-6663702 CAATCTCTGAAGATGGCTGCTGG + Intergenic
969363885 4:6682772-6682794 CCATGTAACATGATGGCAGCAGG + Intergenic
969485157 4:7468025-7468047 CGAGGTATGAGGATGGCAGCGGG + Intronic
970260446 4:14218814-14218836 CCAGACTTGAAGCTGGCAGCTGG - Intergenic
974318821 4:60317185-60317207 CCATATATGAATGAGGAAGCAGG + Intergenic
976224897 4:82788129-82788151 CCATATATGAATAAGGAAGTGGG + Intronic
977292843 4:95181948-95181970 TCATATGTGAAAATGACAGCGGG - Intronic
978283274 4:107042670-107042692 CAACATATGAACTTGGCAGCAGG + Intronic
978289125 4:107116709-107116731 ACATCTATGTGGATGGCAGCAGG - Intronic
978881614 4:113710175-113710197 ACATATATGTAGATGATAGCAGG + Intronic
979556290 4:122051278-122051300 CCAATTATTAAGATGGCAGAAGG - Intergenic
980317654 4:131223366-131223388 CCACATATGAAAATGCCATCCGG - Intergenic
980797601 4:137704614-137704636 CCATCTATGAAGCAGGAAGCAGG + Intergenic
985289571 4:188374075-188374097 CGATATGTGACAATGGCAGCTGG + Intergenic
989728770 5:44622630-44622652 CCATGTTTGGAGATGACAGCTGG - Intergenic
989990912 5:50764749-50764771 GCATATATGAAGAAGGCAATTGG + Intronic
993482325 5:88439044-88439066 CCATCTATGAAGCAGGAAGCAGG - Intergenic
994436408 5:99739769-99739791 CCATATCTAAACATGGCAGATGG + Intergenic
997984078 5:138489896-138489918 GCCTAGATGAAGCTGGCAGCTGG + Intergenic
998468164 5:142362631-142362653 CCATACACCAAGAAGGCAGCAGG + Intergenic
1000094173 5:157956325-157956347 GGATATATAAAGATGGGAGCTGG - Intergenic
1000242133 5:159418382-159418404 GCTTATATGTAGATGGCAGTGGG + Intergenic
1001794429 5:174490286-174490308 CCATAAATGCAGAAGGCAGCTGG + Intergenic
1002084795 5:176767318-176767340 CTATATTTGAAAATGTCAGCCGG - Intergenic
1002307661 5:178293326-178293348 CCATCTGTGGAGATGGCAGGAGG + Intronic
1005084340 6:21989125-21989147 CCATATATGTATGTGGTAGCAGG + Intergenic
1008397897 6:51030399-51030421 CCAAATAAGAACATGTCAGCAGG + Intergenic
1010009954 6:71038041-71038063 TCAGATATCAAGATGTCAGCAGG - Intergenic
1012971523 6:105736493-105736515 CCATATGGGAACATGGCAGGTGG + Intergenic
1015316221 6:131819893-131819915 CCAGATATGATGATGGAAGAGGG - Intronic
1017481074 6:154856240-154856262 ACATAGATGTAAATGGCAGCTGG - Intronic
1017546919 6:155462188-155462210 TCAGATATGAAAATAGCAGCTGG + Intergenic
1018643876 6:165930032-165930054 CCAGAAATGAGGGTGGCAGCTGG + Intronic
1018643886 6:165930092-165930114 CCAGAAATGAGGGTGGCAGCTGG + Intronic
1019317190 7:392179-392201 CCATATCTGAACACTGCAGCTGG - Intergenic
1019373538 7:676571-676593 CCCTATTTGAGGAAGGCAGCCGG + Intronic
1020103310 7:5407571-5407593 CCATATTTGAGGATGGGAGAGGG - Intronic
1020192826 7:6013583-6013605 CCATCCTTTAAGATGGCAGCTGG - Intronic
1020939043 7:14507782-14507804 CCAAACATGCAGATGGCAGGAGG + Intronic
1021007990 7:15423850-15423872 CCTGACATCAAGATGGCAGCAGG - Intronic
1023411806 7:39895245-39895267 CCATACTAGAAGTTGGCAGCAGG - Intergenic
1024949677 7:54846729-54846751 CCATAAATGCAGCTTGCAGCGGG + Intergenic
1026803149 7:73412420-73412442 TCTTTGATGAAGATGGCAGCAGG - Intergenic
1028607616 7:92672241-92672263 ACATATATGAAGATGGTGCCAGG + Intronic
1029847763 7:103430443-103430465 CCTTATCTGTAAATGGCAGCTGG + Intronic
1030838595 7:114319522-114319544 CATTGTATGAGGATGGCAGCAGG + Intronic
1033062995 7:138125786-138125808 CCATTAATGAAGAAGGCAGGAGG - Intergenic
1034919502 7:155068400-155068422 CCATATATAAATCTGGCAGGGGG + Exonic
1038258339 8:25971384-25971406 CCCCGTATGAAGGTGGCAGCGGG + Intronic
1039863225 8:41477474-41477496 TCAAATGTGAACATGGCAGCGGG + Intergenic
1041870731 8:62631816-62631838 ACAGATATTAAGATGGCAGTAGG - Intronic
1042164139 8:65929450-65929472 CCAAATATGAAGGCAGCAGCAGG + Intergenic
1044872454 8:96632659-96632681 ACAGATATGAAGAAGGCTGCAGG + Intergenic
1046393089 8:113602486-113602508 CCATATATGCAGAGAGCAGAAGG - Intronic
1046610925 8:116424794-116424816 CAAAATATAAAGATGGCAGTTGG - Intergenic
1047307641 8:123665994-123666016 CCATGGATGAAGATGGAACCTGG + Intergenic
1047599607 8:126413054-126413076 GCATAGAGGAAGATGGCAGAGGG - Intergenic
1050446788 9:5731651-5731673 CTATATATGGAGATGGCATATGG + Intronic
1050707806 9:8423370-8423392 CCGTATTTCAAGATGGCAGGAGG - Intronic
1051861217 9:21627269-21627291 CCATCTATGAACCTGGAAGCAGG + Intergenic
1062197379 9:135281746-135281768 CCAGAAGTGAAGGTGGCAGCAGG + Intergenic
1186530649 X:10291667-10291689 CAACATATGAATTTGGCAGCGGG + Intergenic
1189647560 X:43150376-43150398 CCACGTATGGAGATGGTAGCAGG - Intergenic
1189945169 X:46170589-46170611 ACATCTATGTAGATGGTAGCAGG + Intergenic
1195054398 X:101129254-101129276 CCATATATGCTGATAGCAGAGGG - Intronic
1197788433 X:130224262-130224284 CCATCTATGAACAAGGAAGCAGG + Intronic
1198856970 X:141028886-141028908 CAATCTATTAAGATGTCAGCAGG - Intergenic
1198905724 X:141558481-141558503 CAATCTATTAAGATGTCAGCAGG + Intergenic
1199407981 X:147485296-147485318 TCATATGTGCTGATGGCAGCAGG + Intergenic
1201531014 Y:14989778-14989800 CCATAGATGGAGATGGTAGAGGG - Intergenic
1202263574 Y:22994915-22994937 TCATAAATGAATATGGCCGCAGG + Intronic
1202416564 Y:24628656-24628678 TCATAAATGAATATGGCCGCAGG + Intronic
1202454223 Y:25041430-25041452 TCATAAATGAATATGGCCGCAGG - Intronic