ID: 901133249

View in Genome Browser
Species Human (GRCh38)
Location 1:6976121-6976143
Sequence CAGGAAGATCAATCTGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901133246_901133249 -4 Left 901133246 1:6976102-6976124 CCTAATTGAGTTGGGGTTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 121
Right 901133249 1:6976121-6976143 CAGGAAGATCAATCTGATCATGG 0: 1
1: 0
2: 0
3: 13
4: 148
901133242_901133249 28 Left 901133242 1:6976070-6976092 CCTAAAGCAAAGCTGTTGGAGTC 0: 1
1: 0
2: 4
3: 16
4: 167
Right 901133249 1:6976121-6976143 CAGGAAGATCAATCTGATCATGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901133249 Original CRISPR CAGGAAGATCAATCTGATCA TGG Intronic
901133249 1:6976121-6976143 CAGGAAGATCAATCTGATCATGG + Intronic
902115649 1:14118765-14118787 CAGAAGGATCAATTGGATCATGG + Intergenic
907246718 1:53113663-53113685 CAGAAGGTTCAATCTGACCAGGG - Intronic
909666816 1:78143300-78143322 AAGGAAGTTCAATGTGACCAGGG - Intergenic
910354534 1:86340519-86340541 CAGGAAGAGAAAGGTGATCAGGG - Intergenic
918096060 1:181335137-181335159 TAGGAATAGCAATGTGATCAGGG - Intergenic
921164136 1:212494007-212494029 CAGGACCATCATTCTGGTCAAGG - Intergenic
921665458 1:217865342-217865364 GAGAAAGATTAATCTGATAAAGG - Intronic
922037656 1:221865334-221865356 CAGCAAGATCAATGTCACCAAGG + Intergenic
922869170 1:228886263-228886285 TAGGAAGATTAATCTGATAGTGG + Intergenic
923991395 1:239440891-239440913 CAGGAAGACCAAACTGTTTATGG - Intronic
924113912 1:240726989-240727011 CAGGAAGATCAGCCAAATCAAGG - Intergenic
1062962436 10:1582787-1582809 CAGGAAGATCAATGTCAGCCAGG + Intronic
1064186021 10:13162377-13162399 TAGGAACATAAATCAGATCATGG - Intronic
1065400380 10:25293673-25293695 CAAGATGATCCATATGATCAAGG - Intronic
1069274652 10:66574710-66574732 CAGGAAGCTCAAAGTAATCATGG - Intronic
1069523068 10:69141368-69141390 CAGGAACATCACACTCATCATGG + Intronic
1071183605 10:83015307-83015329 GAGGGAGATCAATCTGGTCTAGG - Intergenic
1071758467 10:88572957-88572979 CAATAAGATCAAACTGCTCAGGG + Exonic
1071976469 10:90960932-90960954 CCGGAATGTCAATATGATCAAGG + Intergenic
1073134517 10:101212931-101212953 CAGGAAGATCACTCAAATCTGGG - Intergenic
1074279491 10:112037473-112037495 CAGGAAGACCTCTCTGATGAGGG - Intergenic
1074326198 10:112454009-112454031 CAGAATGATCCATCTGATAATGG - Intronic
1075761392 10:124860043-124860065 TAGGAAGAGGAATGTGATCATGG - Intergenic
1077635296 11:3838006-3838028 CAGGAAAACCAGTCTGATCTGGG + Intronic
1078328953 11:10402975-10402997 CAGAAAGATCAATGTGATAGGGG + Intronic
1085034891 11:73293771-73293793 CAGGAGGATCAGTCTCACCAGGG + Intronic
1087519463 11:99212764-99212786 CAGCATGATCATTCTGCTCATGG - Intronic
1090079047 11:123598822-123598844 CAGAAAGTTCATTCTGATCTTGG + Intronic
1094064163 12:26345724-26345746 CAGAAGGCTCAATCTGAGCAGGG + Intronic
1095545481 12:43363157-43363179 CAAGATGATCATTCTAATCATGG + Intronic
1103294679 12:119876303-119876325 TAGGAAGCTCAGTCTAATCATGG + Intronic
1104356972 12:128095466-128095488 CAGGAAGTTCACTGTGGTCATGG - Intergenic
1106995109 13:35471872-35471894 CAGGAAGATTAATCTAATATCGG - Intronic
1110476484 13:75920425-75920447 CAGGAAGGTTAATCTTAGCATGG + Intergenic
1111901359 13:94203001-94203023 CAAAAAGAATAATCTGATCAAGG - Intronic
1113375200 13:109758977-109758999 CAGGAAGATGAACCTGTTAATGG + Intronic
1113667556 13:112151346-112151368 CAGGATGATCTATCTGGTCAAGG + Intergenic
1117632236 14:57705926-57705948 CAGAAAGAACAATGTGTTCAGGG + Intronic
1118453185 14:65922789-65922811 AAGGAAGGTCAAGCTCATCAGGG - Intergenic
1120968572 14:90189191-90189213 CAAGAACTTCAATCTAATCACGG + Intergenic
1121243763 14:92448402-92448424 GAGGAAGATGAACCTGAACATGG - Intronic
1121953638 14:98194740-98194762 TAGGAAGATAAATCTAACCATGG + Intergenic
1122598876 14:102911471-102911493 GAGGAAAATAAATCTGATTATGG + Exonic
1123475455 15:20588695-20588717 AAGGAATATCAACCTGAACACGG + Intergenic
1123642556 15:22411668-22411690 AAGGAATATCAACCTGAACACGG - Intergenic
1134264788 16:12683720-12683742 CAGGAAGATCACACTGAGGATGG - Intronic
1137892651 16:52178778-52178800 CATGAAGAGAAATTTGATCATGG - Intergenic
1141104984 16:81226164-81226186 CAGGAGAATCATTATGATCATGG + Intergenic
1142914568 17:3125719-3125741 TATGAAGATTAATCTGATTATGG + Intergenic
1143475810 17:7203433-7203455 CATGGAGATCAAGCTCATCAAGG - Exonic
1149349612 17:55773765-55773787 GAGGAAGATCCATGTGATCCTGG + Exonic
1150661124 17:67080481-67080503 CAGGAAGAGCAGACTGAGCATGG - Intronic
1151434826 17:74088684-74088706 GAGGCAGCTCAATCTGCTCAGGG - Intergenic
1151776886 17:76210678-76210700 TAGGAAGATTGATCTGATGATGG - Intronic
1159050303 18:63415606-63415628 CAAGAAGATCAAGGTTATCATGG - Intronic
1159777043 18:72614835-72614857 CAGGAAGATCTATCTTTTCTGGG + Intronic
1160147127 18:76374900-76374922 CAAAAAGATCAATTTGACCAAGG + Intronic
1160548288 18:79676625-79676647 CAGGAATATCAGTTTGATGAGGG + Intergenic
1160565186 18:79782701-79782723 CAGGCAGGTCAACCTGACCACGG - Intergenic
1161115922 19:2496265-2496287 GAGGAAGATCAGTGTGATGAGGG + Intergenic
1163068905 19:14821296-14821318 CAGGAATAACAATTAGATCAGGG + Intronic
1163709143 19:18835288-18835310 CAGGAAAATGAACCTGATCGAGG + Intronic
927019223 2:18999809-18999831 CAAGAACATCAATCTATTCATGG + Intergenic
927798430 2:26073492-26073514 AAGGAAAATCCATCTGATCCTGG - Intronic
927829284 2:26334593-26334615 CAGGAAGATAAATCTTATATGGG + Intronic
928901353 2:36321550-36321572 CAGAGAGACCAATTTGATCAGGG - Intergenic
929508395 2:42546850-42546872 CAGGAGGATGAATGTGATCAGGG + Intronic
931669392 2:64633174-64633196 CAGAAAGATCAAAATGATCTAGG - Exonic
933181707 2:79234970-79234992 AAGGAAGCTCAATGGGATCAAGG - Intronic
939450812 2:142371883-142371905 CATAAAGATCAATCTCATAATGG + Intergenic
941359347 2:164532592-164532614 GAGGAAAAGCAATGTGATCAGGG + Intronic
941405500 2:165082855-165082877 AAGGAAAAGCAATCTGAGCAGGG - Intergenic
947990096 2:234480067-234480089 CTGGAAGATCAACTTGGTCAAGG + Intergenic
948698985 2:239748903-239748925 CGGGAAGATCATCCTGAGCAGGG - Intergenic
1172395417 20:34600520-34600542 GAGGAAGATCAAGATGATCAAGG - Intronic
1174237360 20:49104886-49104908 CAGGAAGATCAGCCTGAGCCTGG + Intergenic
1174872888 20:54199904-54199926 ATGGAAGAGGAATCTGATCAAGG + Intergenic
1175189894 20:57204398-57204420 CAGGCACATCAATGTGAACAAGG + Intronic
1175336811 20:58201653-58201675 CAGGAGCATCAATTTAATCAAGG + Intergenic
1176175972 20:63724764-63724786 CAGGAAAATCACTCTAACCAGGG - Intronic
1180892702 22:19301785-19301807 CAGCAAGATTAATCAAATCATGG - Intergenic
1184161903 22:42702012-42702034 CAGGAAGAAGACACTGATCAGGG - Intronic
950425725 3:12923861-12923883 CAGGAAGAGCACTCAGAGCAGGG - Intronic
950709168 3:14802793-14802815 CCGGAAGATCCTTCAGATCAGGG + Intergenic
952747265 3:36792918-36792940 GAGGAAGATTAATATGGTCAGGG - Intergenic
953511224 3:43541777-43541799 CAGGAAGCTCGATCTGGTAATGG + Intronic
953747674 3:45587462-45587484 CAGTAACATCAGTCAGATCATGG - Intronic
955623473 3:60891347-60891369 CAGGGTGATCAACCTGATCTGGG - Intronic
962929930 3:140026832-140026854 CAGCAATGTCAATCTGACCAGGG - Intronic
963081478 3:141399107-141399129 AAGGAATATAAATCTGATCAAGG - Intronic
963146730 3:142002085-142002107 CAGGAAGATCACTCGAATCTGGG - Intronic
970088628 4:12376906-12376928 CAGCAACATCTATCTGTTCAGGG - Intergenic
971128516 4:23780181-23780203 CAGGAGGAGCAAGCTCATCATGG + Intronic
974280949 4:59792300-59792322 CAGCAAGATCAATTTGGCCATGG + Intergenic
975616963 4:76256370-76256392 GAGGCAGATCAAGCTGCTCAAGG + Exonic
976656487 4:87494009-87494031 CAGGAGGATGAATTTGATCAGGG - Exonic
977406926 4:96611286-96611308 TAGGAAGATAGATCTGATGATGG + Intergenic
978462663 4:108974374-108974396 CAGGGAGAACAAGGTGATCAGGG - Exonic
978593964 4:110356610-110356632 CAGAAAGATCAATTTGAACCAGG - Intergenic
980658346 4:135820301-135820323 CAGGAAAATCAATCTATTCTGGG - Intergenic
982228481 4:153187054-153187076 CAGGAAGATAACCCTGATGAAGG + Intronic
983344979 4:166517056-166517078 CAGGAAGCTCAAGTTGCTCAAGG + Intergenic
986579405 5:9249281-9249303 CAGGAAGAGAAATATGATCCTGG + Intronic
986772157 5:10984082-10984104 TAGGAAGAAGAAACTGATCAGGG - Intronic
987942470 5:24558622-24558644 CAAGGAGATGAATCTAATCAAGG + Intronic
993672599 5:90779354-90779376 CAGGAAGTTGAATATGATAACGG + Intronic
994820556 5:104645426-104645448 CAGGAAGATTAACCTGCTCCAGG + Intergenic
996196036 5:120608339-120608361 CAGGGGCATCAATCTGCTCAGGG - Intronic
1000125170 5:158236909-158236931 CTAGAAGGTGAATCTGATCATGG + Intergenic
1004008408 6:11657940-11657962 AAGGAACATCACTTTGATCAGGG - Intergenic
1008748954 6:54708942-54708964 CAGGGAGATCAATGAGACCAGGG - Intergenic
1011485064 6:87832700-87832722 CAGGCAGATCAATCTGCTAAAGG + Intergenic
1013013141 6:106137636-106137658 AAGAAAGATTAATCTGACCATGG - Intergenic
1013918930 6:115376536-115376558 CAGGAGCCTGAATCTGATCAAGG - Intergenic
1013937298 6:115613098-115613120 CAGGAGGACCAGTCTGTTCAAGG + Intergenic
1014522327 6:122459937-122459959 CAGGAGGATAAGTCTGGTCATGG - Intronic
1015261805 6:131246578-131246600 CTGGAAGATGAATGTGTTCAGGG + Intronic
1018665221 6:166129316-166129338 CATGAAGATCAATCATATGATGG + Intergenic
1018917353 6:168143660-168143682 CAGGAAGATCTATCCAATGATGG + Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1024845353 7:53635732-53635754 AAAGAAGATCAATCAGCTCATGG - Intergenic
1029393720 7:100292575-100292597 CAGGAAGATCACTTTAATCCTGG - Intergenic
1031564276 7:123275959-123275981 CAGAAAGAATAATCTGCTCAAGG + Intergenic
1033755392 7:144395156-144395178 CAGGAAGATGAATATGAAAAGGG - Intergenic
1035675589 8:1453333-1453355 CAAGAAGATAAATATGATGAAGG - Intergenic
1035823062 8:2615892-2615914 CAGGAAGATAACTCTCATCCTGG + Intergenic
1039069413 8:33636043-33636065 CAGGAAAATAATACTGATCATGG + Intergenic
1040385013 8:46909204-46909226 CAGGAAGATGAAATTGAACAGGG + Intergenic
1040806165 8:51398439-51398461 CAGGAAGTTGAATCAGAACACGG + Intronic
1041178832 8:55226930-55226952 TAGGAAGGGCAAGCTGATCAAGG - Intronic
1041328996 8:56702491-56702513 AAGGAAGAACAATAAGATCAAGG + Intergenic
1042737558 8:72005561-72005583 CAGGCAGAGCAGTCTGACCAGGG - Intronic
1046829132 8:118724844-118724866 CAGAAATATCAATCTTTTCATGG + Intergenic
1050562799 9:6851779-6851801 CAGGAAGAATATTCTGGTCAGGG + Intronic
1050615046 9:7393039-7393061 CAGGAAGCCCAATGGGATCAAGG - Intergenic
1052034361 9:23663056-23663078 CAGGTAGAACAATCTGATCTTGG + Intergenic
1052125114 9:24765157-24765179 CAGGAAGTTCAAACTGGGCAGGG - Intergenic
1055555744 9:77471571-77471593 GAGGAAGAGCAATCTGAGCAGGG + Intronic
1056789079 9:89613858-89613880 CAGGCAGATCAATGAGATCCAGG + Intergenic
1058171350 9:101684649-101684671 CAGAAAGATCAGTCTGATCTTGG + Intronic
1058372515 9:104286069-104286091 GAGGAAGATCATTGTGATAACGG + Intergenic
1058405651 9:104670429-104670451 CCAAAAAATCAATCTGATCATGG + Intergenic
1059563006 9:115353338-115353360 CAGCAAGATCAATCAGCACAGGG - Intronic
1060025869 9:120170951-120170973 CAGGAAGATCAAGCTGGACAAGG - Intergenic
1060629807 9:125145526-125145548 CAGAAAATTCAATCTGTTCAGGG + Intergenic
1186452693 X:9686603-9686625 CAGGAAGATCAGTTTGGTCCAGG + Intronic
1186978683 X:14935940-14935962 CAGGAATATCATTCTGACTAGGG - Intergenic
1189093643 X:38114173-38114195 CAGGAAGTCAAATGTGATCAGGG - Intronic
1189113428 X:38318339-38318361 CAGTAAGATCAAGCTGATCTTGG + Intronic
1189343891 X:40225758-40225780 CAGGAATATGATTTTGATCAGGG - Intergenic
1189909869 X:45799683-45799705 CAGGAAGAGCATTCTGAGAAAGG + Intergenic
1191604725 X:63048705-63048727 CAGGAAAATTTATCTGATCTTGG - Intergenic
1194409553 X:93541170-93541192 CAAAAACATAAATCTGATCATGG - Intergenic
1195503136 X:105626460-105626482 GAGGAAGATAAATCTGATGGTGG + Intronic
1195836397 X:109119421-109119443 CAGGAAAATAATTATGATCAGGG + Intergenic
1195928868 X:110053366-110053388 CAGGAAGAACAAACTGATGTAGG + Intronic
1196106374 X:111900445-111900467 CAGGAAAAACAATCTGGTGAAGG + Intronic
1196551713 X:117035240-117035262 AAGGAAAATTAATCTGATCATGG + Intergenic
1196680455 X:118464710-118464732 CAGGGAGATCTTTCTTATCAAGG - Intergenic
1198529013 X:137531233-137531255 AAAGGAGATCAATGTGATCATGG + Intergenic
1199025729 X:142935295-142935317 CAGGAAGAACGACATGATCAGGG - Intergenic