ID: 901137922

View in Genome Browser
Species Human (GRCh38)
Location 1:7009659-7009681
Sequence TCTGGGGGACAGAAGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 351}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901137922_901137926 -10 Left 901137922 1:7009659-7009681 CCCTGCTGCTTCTGTCCCCCAGA 0: 1
1: 0
2: 1
3: 38
4: 351
Right 901137926 1:7009672-7009694 GTCCCCCAGAGCCCCGGTCCGGG 0: 1
1: 0
2: 0
3: 25
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901137922 Original CRISPR TCTGGGGGACAGAAGCAGCA GGG (reversed) Intronic
900393163 1:2442643-2442665 CCTTGGGTGCAGAAGCAGCATGG + Intronic
900398737 1:2464150-2464172 TCTGGGGCTCAGAAGCAGCTGGG + Intronic
900495287 1:2973371-2973393 TCTGGGGGACACATGTAGGAAGG - Intergenic
900542241 1:3208903-3208925 TCTTGGGGACAGAAGAAACCTGG + Intronic
900814929 1:4836491-4836513 TCTGTGGGACAGCAGCAGGTTGG + Intergenic
901069848 1:6511645-6511667 GATGGGGGACTGAGGCAGCAGGG + Intronic
901137922 1:7009659-7009681 TCTGGGGGACAGAAGCAGCAGGG - Intronic
901788956 1:11643287-11643309 GCTGGGGTACAGAATCAGAAGGG - Intergenic
901870593 1:12136571-12136593 CCTGGGGGACAGAGGTTGCAGGG + Intronic
902199367 1:14822335-14822357 TCAGGGAGACAAAAGCAGGAGGG + Intronic
902366007 1:15975010-15975032 TCTGGGGGACAGAAGCCTCCCGG + Intronic
902530260 1:17086297-17086319 CGTGGGGAGCAGAAGCAGCAAGG + Intronic
904295463 1:29517314-29517336 ACTGGGGAAGAGAAGCATCAGGG - Intergenic
904972858 1:34432631-34432653 TGTGGGGGACATAAGAAACATGG + Intergenic
904993118 1:34609937-34609959 GCAGGGGGACAGGAGCAGAAAGG + Intergenic
907978169 1:59453867-59453889 TGTGGGGGACAGGAGGAGGAGGG + Intronic
910682272 1:89879097-89879119 TCTAGCGGACAAATGCAGCAGGG - Intronic
913223594 1:116679388-116679410 TCTGGTGGCCAGAAGCAGGCTGG - Intergenic
914248360 1:145902021-145902043 CCTGTGGGACAGAAGCAGATGGG + Exonic
914846744 1:151287669-151287691 ACTGGGGGACAGAAGGTGAATGG + Exonic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916024322 1:160820704-160820726 TCTGGGGGAGAGAAGAGGTAGGG - Intronic
916094459 1:161336641-161336663 TTGGGGGGAAAAAAGCAGCAGGG + Intronic
916484763 1:165248987-165249009 TTTGGGGAACAGCAGCTGCAGGG - Intronic
916786468 1:168090597-168090619 CCTGGGGCACAGCAGCAGCACGG - Exonic
916844154 1:168631252-168631274 TCTTGGGGAGAGAAGCCTCAAGG + Intergenic
918160776 1:181897284-181897306 TCTGGTGGACAAAACCAACAGGG - Intergenic
919325113 1:196097730-196097752 TCTGGGGGGCAAAAGCCACAAGG - Intergenic
920669962 1:207995962-207995984 TCTGGGGAAGAGATGCGGCAGGG - Intergenic
920750514 1:208670381-208670403 TCTGGGGGTCAGATGCTCCATGG + Intergenic
920849340 1:209618048-209618070 CCTGGGTGAGAGAAGCAGCAGGG + Exonic
921022616 1:211249988-211250010 TCTTGGAGCCAGAAGCTGCATGG + Intergenic
922434215 1:225586962-225586984 GCTGGGGGACAGAAAAAGCAGGG + Intronic
922454617 1:225764672-225764694 CCTGGGGGACAGGAGGAACAGGG + Intergenic
922976229 1:229785655-229785677 CCTTGGGGACAGGAGCTGCAGGG + Intergenic
923029082 1:230232870-230232892 TCTGGGGGAAAAAAGCAGGCAGG - Intronic
924051044 1:240079853-240079875 TTTGGGGGACAGAAAAAGAATGG + Intronic
924210241 1:241757724-241757746 TCTGGGGGGCTGAGGCAGGAGGG - Intronic
924300358 1:242631850-242631872 CCTGGGGGACAGAGGTTGCAGGG - Intergenic
924642438 1:245847056-245847078 TCTGGGGAACTGAAGTAGCAAGG - Intronic
1062925287 10:1311708-1311730 AGTGGGAGACAGAAGAAGCAAGG - Intronic
1065077908 10:22099226-22099248 TTTGAGGGCCAGAAGCATCAAGG + Intergenic
1065822778 10:29541320-29541342 TCTGGTGGACAGAGGCACAAGGG + Intronic
1065971793 10:30811488-30811510 CCTGGGAGCCAAAAGCAGCAAGG - Intergenic
1067329717 10:45303799-45303821 GCTGCAGGAGAGAAGCAGCAGGG + Exonic
1067689336 10:48491299-48491321 TCTGGGCCACAGCAGGAGCAAGG - Intronic
1068647445 10:59483603-59483625 GCTGGAGGAAAGAATCAGCAAGG - Intergenic
1068650751 10:59519895-59519917 TCTGGGGTGGAGAAGCTGCAAGG + Intergenic
1069020800 10:63486277-63486299 ATTGGGAGACAGAAGAAGCATGG + Intergenic
1069443760 10:68454124-68454146 TGTGGGTGACAAAAGCAGCATGG - Intronic
1069875407 10:71559975-71559997 TATAGGGGAGAGAAGCAGGAGGG - Intronic
1072193895 10:93098300-93098322 TCTTGGGGACAAAAGGAGCAGGG - Intergenic
1072732966 10:97860426-97860448 GCTGGGAGACAGAGGCTGCAGGG - Intronic
1072740484 10:97906149-97906171 CCTGGGGGAGAGAAGGAGCTGGG + Intronic
1073207970 10:101778689-101778711 TCTGGGGGAGAGGAGCAGATGGG + Intronic
1076667944 10:132103435-132103457 CCTGGGGGAGAGGAGCAGCTGGG + Intergenic
1076785576 10:132748203-132748225 TCGGAGAGACAGAGGCAGCAAGG - Intronic
1076813576 10:132902199-132902221 TCAGGAGGACAGAGGCAGCAGGG - Intronic
1077115547 11:883031-883053 TCTGTGGGGCAGAAGCCCCAGGG + Intronic
1077367822 11:2168268-2168290 TCCGGGGGGCAGAGGCAGCCGGG + Intronic
1077879456 11:6337322-6337344 TTTGGGAGGCAGAAGCAGGAAGG - Intergenic
1077906485 11:6538646-6538668 GCTGGCTGACAGAGGCAGCACGG + Exonic
1078507315 11:11961834-11961856 TTTGGGAGAGAGCAGCAGCAAGG + Intergenic
1080641254 11:34159789-34159811 TCTGAGGGGCAGAGGCTGCAGGG + Intronic
1080943125 11:36941556-36941578 TTTGGGAACCAGAAGCAGCAAGG + Intergenic
1081674134 11:44958538-44958560 CCCAGGGGACAGAAGGAGCACGG - Intergenic
1083258859 11:61512489-61512511 TCTTAGACACAGAAGCAGCAGGG + Intergenic
1083475595 11:62913014-62913036 AGTGGGGGACAGAATGAGCAAGG + Intronic
1083945706 11:65921431-65921453 TCTGGGGGGCAGAAGGCGCTAGG - Exonic
1084341269 11:68503441-68503463 TCAGTGGGACAGAAGAAGGAAGG + Intronic
1084455952 11:69268267-69268289 TCAGGGCGGCAGAAACAGCATGG + Intergenic
1088239225 11:107756772-107756794 TCAGTGGGACAAAAGCAGCGTGG - Intergenic
1088367257 11:109052742-109052764 TCCAGGGAACAGAAGCAACAAGG + Intergenic
1088723731 11:112616804-112616826 CCTGAGGAATAGAAGCAGCATGG + Intergenic
1089595621 11:119577742-119577764 TCTGGTGGACAAAGGCAGCATGG - Intergenic
1090853096 11:130587733-130587755 TGTTGGGGAAAGATGCAGCATGG - Intergenic
1090949836 11:131463886-131463908 TCTGGGAGCCAGAAGCTGCCAGG - Intronic
1091451787 12:576599-576621 TTTGGGAGACTGAAGCAGGAGGG - Intronic
1092182304 12:6454082-6454104 TATGGGGCACAGAAGAAGAAAGG + Intronic
1092741063 12:11630091-11630113 GATGGGGCACAGAAGCAGGAAGG - Intergenic
1095045252 12:37496360-37496382 GATGGGGGACACAAACAGCAGGG - Intergenic
1095471075 12:42537405-42537427 TTTGGGAGACAGAGGCAGGATGG - Intronic
1096528750 12:52230552-52230574 TCTCTGGGAAAGGAGCAGCAGGG + Intergenic
1097070537 12:56351248-56351270 CCTGGGGGAAAGAAGGAACAAGG - Intronic
1098605060 12:72380398-72380420 TGTGGGGGACAGATGGGGCATGG + Intronic
1099009304 12:77272723-77272745 TCTGGGTTTCAGAAGGAGCAAGG + Intergenic
1100865428 12:98852317-98852339 TCTAGGCGGCAGAAACAGCAGGG + Intronic
1100865921 12:98856687-98856709 TATGGGGGACAGCAGCCTCAGGG + Intronic
1102955180 12:117054370-117054392 TCTGTGGACCAGCAGCAGCAGGG - Intronic
1103191408 12:119005117-119005139 TCTGGGGGAAAGGAGGAGAAGGG + Intronic
1104714353 12:131006549-131006571 TCTGGAGGACAGCAGAGGCAGGG - Intronic
1104900697 12:132188259-132188281 TCTGGGGGCCTGCAGCGGCAGGG - Intergenic
1105203327 13:18197413-18197435 TCTGGGAGACAGAAGGGGAATGG - Intergenic
1107440371 13:40421607-40421629 TCTGGGGGATGGAAGTAGGAAGG + Intergenic
1107851869 13:44578242-44578264 ACTGGAGGACAGAAGCAGGCCGG + Intergenic
1108002246 13:45915135-45915157 TGTGGGGGCCAGAAGCAGGCAGG + Intergenic
1108914273 13:55588607-55588629 GCTGGGGGAGAGAAGGAGGATGG + Intergenic
1112539342 13:100292023-100292045 TCTGGGGGAGATAGACAGCATGG + Intronic
1113840576 13:113357800-113357822 TGAGAGGGACAGAAGCAGAAAGG + Intronic
1114478210 14:23012789-23012811 TTTGGGAGACCGAAGCGGCACGG + Intergenic
1115509533 14:34126138-34126160 TGAGGGGGAGTGAAGCAGCAAGG + Intronic
1115510887 14:34137012-34137034 GGTGGGGGACAGGAGCAGGAGGG - Intronic
1117324779 14:54658904-54658926 TGTGGGGGGCAGAAGAATCAGGG + Intronic
1118087248 14:62431900-62431922 GCTGGGGTAGAGAAGCAGCTTGG - Intergenic
1118332200 14:64823484-64823506 CCTGGGAGCCAGAGGCAGCAGGG + Intronic
1118762838 14:68890941-68890963 TCTGGGGGACAGATGTAGCTTGG - Intronic
1119556360 14:75556330-75556352 GCTGGGGGACAGAGGGTGCAAGG - Intergenic
1119691255 14:76674413-76674435 ACTGTGGGATAGAAGCAGCTTGG + Intergenic
1121511583 14:94516712-94516734 TCTTGGGGACAGAAACTGTAAGG - Intronic
1121802688 14:96788059-96788081 TCTGAGTGACAGAAGAAGAAAGG + Intergenic
1121845955 14:97172487-97172509 TGTGGGGGATGGAAGGAGCAGGG - Intergenic
1122789160 14:104177117-104177139 CCTGGCGCACAGCAGCAGCAAGG + Exonic
1123449735 15:20352212-20352234 TCTGGGGGTCAGAAGTCCCACGG + Intergenic
1124005884 15:25795197-25795219 TCTGAGGGACTGAATCAGCCAGG + Intronic
1124071245 15:26394892-26394914 TCTGGGGCCCAGAAGCAGGCAGG - Intergenic
1125174563 15:36805868-36805890 TTTGGGTGACAAAAGCAGTAAGG - Intronic
1127235226 15:57042654-57042676 TTTGGGAGACAGAGGCAGGAGGG - Intronic
1127332285 15:57950907-57950929 GCAGGGCCACAGAAGCAGCATGG + Intergenic
1127968062 15:63938673-63938695 TCTGGGGTACAGAATGGGCAGGG + Intronic
1130105813 15:80927766-80927788 ACTGGGGGACAGAAGCAATGAGG + Intronic
1130554155 15:84911101-84911123 TCTGGCGGACAGCAGCTGCGTGG - Intronic
1131455199 15:92578306-92578328 TTTGGGGGACAGGAGAAGCGGGG - Intergenic
1132085005 15:98901265-98901287 ACTGGGGAGCAGCAGCAGCAGGG - Intronic
1132427734 15:101733431-101733453 GCTGGGGGAGAGAGGCAGCAGGG + Intergenic
1132547168 16:538655-538677 CCTTGGGGACAGAAGCTTCAAGG - Intronic
1133021680 16:2969631-2969653 GCTCGGGGACAGCAGGAGCACGG + Exonic
1133122822 16:3621459-3621481 TCAGGGGGCCAGAAGTAGGAGGG - Intronic
1134066266 16:11230369-11230391 AGTGGGGGACAGACGCAGGAGGG + Intergenic
1136181693 16:28557185-28557207 TCTGAGGGACAAAGGCTGCAGGG - Intronic
1136229306 16:28877490-28877512 CCTCGTGGACAGATGCAGCAGGG + Intergenic
1136376407 16:29868067-29868089 TCTGGGGTAGAGAAGCAGGACGG + Intergenic
1136408950 16:30065505-30065527 GCTGGGGGAAAGGAGCAGAAGGG + Intronic
1137407053 16:48197527-48197549 TCTGGGGCAGAGTAGCAGAAGGG - Intronic
1137582723 16:49643623-49643645 TCTGGGGGGCAGGGGAAGCATGG - Intronic
1137767239 16:50987371-50987393 TCATGGGGACAGGAGCACCAGGG + Intergenic
1138297514 16:55899657-55899679 CCTGGGGGACAAAAGCACCTTGG - Intronic
1139922128 16:70467161-70467183 CCTGTGGGACAGAAGGGGCAGGG - Intronic
1141057646 16:80833426-80833448 AGTGGGGTTCAGAAGCAGCAGGG - Intergenic
1141399322 16:83733338-83733360 CCTGGGAGACAGAAGCATCTGGG - Intronic
1141867962 16:86763672-86763694 TGTGGGGATCAGAAGAAGCAAGG - Intergenic
1143091763 17:4453063-4453085 TCTTGGGGGCAGAAGCTGCGAGG + Exonic
1143419665 17:6778936-6778958 CCTGGGGGACAGAGGAAGGATGG - Intronic
1143460870 17:7102652-7102674 TCTGGGGGGCAGTAAGAGCAGGG - Intronic
1145281642 17:21472269-21472291 CTTGGGGTCCAGAAGCAGCAAGG - Intergenic
1145296096 17:21593573-21593595 CCTGCGGGGCAGAAGCAGCCGGG + Intergenic
1145395794 17:22493354-22493376 CTTGGGGTCCAGAAGCAGCAAGG + Intergenic
1145397680 17:22507925-22507947 GCTGGAGGTCAGAAGCAGAAGGG + Intergenic
1146050091 17:29542936-29542958 TCTGGGGGACGGACGGAGCAGGG + Exonic
1146396588 17:32472777-32472799 TTTGGGAGGCAGAAGCAGGAGGG - Intronic
1146429267 17:32775056-32775078 TTTGGGAGACTGAAGCAGGAGGG + Intronic
1146968610 17:37054213-37054235 CCTGGGGCCCAGGAGCAGCATGG - Intronic
1147263964 17:39224282-39224304 TCTGGAGAACAGGAGCAGGATGG + Intronic
1147925201 17:43941607-43941629 GCAGGTGGACAGGAGCAGCAGGG + Exonic
1147968701 17:44207913-44207935 TGGGGGAGACAGAAGCGGCAAGG + Intronic
1148352690 17:46951878-46951900 TCTGGGGGGGAGAAGCAGCGAGG - Intronic
1148785193 17:50142772-50142794 TCTGTGGGACAGAAGGTTCAGGG - Intronic
1149367504 17:55960581-55960603 GCTGGGAGACAGAAGCAGGAGGG + Intergenic
1150388957 17:64780129-64780151 GCTGAGGGACCGAAGGAGCAGGG + Intergenic
1150790489 17:68197791-68197813 GCTGAGGGACTGAAGGAGCAGGG - Intergenic
1150858553 17:68776909-68776931 TCTGTGGGAAAGAAGAGGCAAGG - Intergenic
1151158159 17:72142009-72142031 CCTGGGGGACTGAGGCAGGAGGG - Intergenic
1151437097 17:74104661-74104683 TCTGGTGGGAGGAAGCAGCATGG - Intergenic
1151548481 17:74807634-74807656 TTTGGGGGGCAGAAGTAGAAGGG + Intronic
1152236334 17:79140963-79140985 GCTGGGTGACAGAGGCAGCCCGG + Intronic
1152338906 17:79713678-79713700 TCTGGGGGTCAGAAGTCCCATGG - Intergenic
1152568614 17:81111489-81111511 CTTGGGGGACAGAAGAGGCAAGG - Intronic
1152588166 17:81198308-81198330 GCAGGGAGACAGATGCAGCAAGG + Intronic
1152635363 17:81428595-81428617 CCTGGGGGACCCCAGCAGCAAGG + Intronic
1152762120 17:82114303-82114325 GGTGGGGGCCAGAGGCAGCATGG + Intronic
1152876656 17:82790294-82790316 TCAAGGGCACAGAGGCAGCATGG - Intronic
1152886599 17:82855006-82855028 TCTGGGGAACAGAAGCATTGGGG + Intronic
1153227491 18:2909638-2909660 CCTGGAGGACAGAAGCACCCGGG + Intronic
1153502495 18:5763269-5763291 ACTGGGAGACAGAAGTAACAAGG - Intergenic
1154000320 18:10477095-10477117 TCTGGGGTATAGAAGGAGCCAGG + Intronic
1158668207 18:59451781-59451803 TCTGGGGTACATATGCAGGATGG - Intronic
1158775920 18:60579235-60579257 TCTGGTTTACAGCAGCAGCAAGG + Intergenic
1159767501 18:72508205-72508227 TCTGAAGGACAGAAGCCGCTTGG + Intergenic
1159927072 18:74279024-74279046 TCTGAGGGACAAGAGCAGGAGGG + Intronic
1160430540 18:78808829-78808851 TGCTGGGGACTGAAGCAGCACGG - Intergenic
1161585781 19:5104779-5104801 TCTGGGGAAGAGAAGAGGCACGG - Intronic
1163380968 19:16968329-16968351 CCTGGGGGACTGAAGCATCCAGG + Intronic
1163816022 19:19465060-19465082 GTTGGGGGCCAGAGGCAGCAGGG - Intronic
1165740607 19:38203213-38203235 GCTGAGGGGCAGGAGCAGCATGG + Intronic
1165777138 19:38411249-38411271 TCTGGGGGAAGGCAGCGGCAGGG + Exonic
1165886946 19:39085130-39085152 TCTGGGGGACAACAGAGGCAGGG - Exonic
1166257195 19:41615037-41615059 TCTGGGGTACAAGAACAGCAAGG + Intronic
1166716689 19:44973066-44973088 TCCTGAGGAGAGAAGCAGCAAGG - Exonic
1166752395 19:45170502-45170524 GCTGGGGGAGAGAGTCAGCAGGG + Intronic
1168280349 19:55302334-55302356 TCTAGGGGTCAGAGGCAGGAGGG + Intronic
925179388 2:1807117-1807139 CCTGGGAGACAGGAGCAGCCTGG + Intronic
925552556 2:5092198-5092220 TGTGAGGAACAAAAGCAGCATGG - Intergenic
925901586 2:8512992-8513014 TCAGGGGCACAGCAGCAGCAGGG - Intergenic
926274615 2:11394071-11394093 TCTGGGTGGTAGAAGCAGCAGGG + Intergenic
926595015 2:14780654-14780676 TCTGGGAGACAAAAACAGAATGG - Intergenic
927003583 2:18824935-18824957 TGTGGGAGACAGCAGCAGAAAGG - Intergenic
927807826 2:26163426-26163448 TCTAGGTGTCAGAAACAGCAGGG - Intergenic
927866971 2:26595319-26595341 TGTGGGCGACAGGAGGAGCAGGG + Intronic
928572410 2:32622640-32622662 GCTGGGGGAAAGCAACAGCAAGG - Intergenic
929474119 2:42228008-42228030 TCAGGAGTACAGAAGCAGCCTGG + Intronic
930191407 2:48463753-48463775 TGAGGGGGTCAGAAGCAGAAGGG + Intronic
930483729 2:51985278-51985300 TCTGAAGGAAATAAGCAGCATGG - Intergenic
930659150 2:54036598-54036620 TCTTGGGGACAGAAACTTCAAGG - Intronic
932132600 2:69201347-69201369 TCAGGGAGACACAAGGAGCAGGG + Intronic
932724003 2:74161711-74161733 TTTGGGAGACTGAAGCAGAAAGG + Intronic
933158578 2:79000209-79000231 TCCAGGGGACAGAAGCAGGGCGG + Intergenic
933828761 2:86189170-86189192 TCTGCGGGTTAGAAGCAGCAAGG - Intronic
934580498 2:95434137-95434159 TGTGGGGGCCATAAGCAGCAAGG + Intergenic
934598949 2:95642580-95642602 TGTGGGGGCCACAAGCAGCAAGG - Intergenic
934601779 2:95663544-95663566 GCAGCGGGACAGAAGCAGCTGGG - Intergenic
935693786 2:105753334-105753356 GCTGGGGGAGAGGAGCAGCCAGG - Intronic
936022800 2:109007629-109007651 TGTGGGGGACAGGAGAGGCAGGG + Intergenic
936232920 2:110720019-110720041 TCTAGGGGACAGAAGTAACCTGG + Intergenic
936535130 2:113305699-113305721 GCAGCGGGACAGAAGCAGCTGGG - Intergenic
937377451 2:121347360-121347382 TCTGGGGTGCAGAAGCAGGAGGG + Intronic
937468742 2:122157315-122157337 CCTCAGGGACAGAAGGAGCAAGG + Intergenic
937942586 2:127297461-127297483 TATGGGTGTCAGAAGGAGCATGG + Intergenic
938090406 2:128427579-128427601 TCTGGGGGGCAGCAGCAGCTGGG + Intergenic
938310019 2:130283790-130283812 TCTGTGGGACAGATCCGGCAAGG + Intergenic
938444900 2:131368579-131368601 TCTGTGGGACAGATCCGGCAAGG - Intergenic
939087813 2:137742826-137742848 TCTGGCAGGCAGGAGCAGCAGGG - Intergenic
941407257 2:165105754-165105776 TTTGGGAGACTGAAGCAGGAGGG + Intronic
941844813 2:170122091-170122113 TTGGGGGAACAGGAGCAGCAGGG + Intergenic
944674787 2:202026218-202026240 TCTGAGGGAAGGAAGCAGCCAGG + Intergenic
945063211 2:205926093-205926115 TCTCTCGGACAGAAGCACCACGG - Intergenic
946015782 2:216602896-216602918 GCTGGGGAAGAGAAGCAGCCTGG - Intergenic
946673431 2:222131134-222131156 TCTGGGGCACAAAATCAGCCCGG - Intergenic
947335634 2:229079983-229080005 TCTGCCGGTCAGAGGCAGCAAGG + Intronic
948692428 2:239715169-239715191 CCTGGGGGAGACCAGCAGCAGGG - Intergenic
949059765 2:241949923-241949945 TCCGGGGGATAGGAGGAGCACGG - Intergenic
1168863951 20:1068255-1068277 TCTGGAGGACAACAGCATCAAGG - Intergenic
1169273301 20:4216955-4216977 TCTGGGGGCTAGAGGCTGCAAGG - Intergenic
1169929155 20:10813363-10813385 TTTGGGGGAAAGAAGGAGCTCGG - Intergenic
1170215377 20:13885613-13885635 TCTGGGGTACAGAAACACCCAGG + Intronic
1170310710 20:14988422-14988444 TATGGGGAACAGTAGCAACATGG + Intronic
1170500120 20:16966890-16966912 TCTGAGGCCCAGAAGAAGCAAGG - Intergenic
1170901182 20:20465207-20465229 ACTAGGGGACAGCAGCAGAATGG + Intronic
1171031488 20:21681027-21681049 TCTGCGGGAGAGAGGCAGCCAGG - Intergenic
1171048108 20:21830007-21830029 GCTGGGGGACAGAATCACCAGGG + Intergenic
1171539804 20:25939956-25939978 GATGGGGGACACAAACAGCAGGG - Intergenic
1171801244 20:29620321-29620343 GATGGGGGACACAAACAGCAGGG + Intergenic
1171842724 20:30235175-30235197 GATGGGGGACACAAACAGCAGGG - Intergenic
1173604876 20:44324757-44324779 TCTGGGGCACAGGGTCAGCAGGG + Intergenic
1173728710 20:45314013-45314035 GCTGGGGGACAAAAAAAGCAAGG - Exonic
1174056636 20:47802732-47802754 TCGGGGAGACAGAAGCTGCCTGG - Intergenic
1174146417 20:48455538-48455560 TCTGGGGGCAGGAAGCAGCAGGG + Intergenic
1176140794 20:63544190-63544212 GGTGGGGGACAGAGGCAGGAGGG + Intronic
1176960049 21:15149265-15149287 GTTGGGGGACAGAGGCAGAAGGG - Intergenic
1177287106 21:19065410-19065432 TCTGGGGGGCCGAGTCAGCAAGG + Intergenic
1178454078 21:32730518-32730540 TCTGGAGGCCAGAACCAACAGGG - Intergenic
1178814940 21:35920663-35920685 TCCAGAGGACAGAACCAGCATGG + Intronic
1179091780 21:38272467-38272489 TCTGGGGAACTGACTCAGCAGGG - Intronic
1179559908 21:42208978-42209000 TCTGGGGGAGGGAGGCAGGAGGG + Intronic
1180013704 21:45069216-45069238 TCTGGGGAGGAGAAGCATCAGGG - Intergenic
1180077180 21:45468807-45468829 GCTGGGGGACTGGAGCAGCTGGG + Intronic
1181129828 22:20724530-20724552 TCTGGGAGGCAGAGGCTGCAAGG + Intronic
1181581481 22:23831334-23831356 TCTGAGGGACAGAGGGAGCCAGG - Intronic
1181721225 22:24776060-24776082 TCTTGCGGCCAGAAGCTGCATGG + Intergenic
1182550034 22:31095949-31095971 TCAGGGAGAGAGGAGCAGCAGGG - Intronic
1182689200 22:32144744-32144766 TCTCGGGGGCTGAAGCAGGAGGG + Intergenic
1182777965 22:32845033-32845055 TCTGGTGGTCAAAAGAAGCAAGG - Intronic
1183276427 22:36900952-36900974 TCTGGGGGTCAGGAGCACCAGGG - Intergenic
1183726459 22:39592668-39592690 TCTGGGTGACAGAGGGGGCAGGG - Intronic
1183933663 22:41249817-41249839 TCTGTAGGGCAGAAGCAGCAGGG + Exonic
1184328919 22:43813183-43813205 ACTGTGGGAGAGAAGCAGCCAGG + Intergenic
949090801 3:26515-26537 TTTGGGAGACTGAGGCAGCAGGG + Intergenic
950120489 3:10479280-10479302 TCTTGGGGGCTGAAGGAGCAAGG - Intronic
950660103 3:14461879-14461901 TCTGGGCAGCAGCAGCAGCAGGG - Intronic
952817273 3:37456534-37456556 TCTGGGGCAGAGAAGGAGGAGGG - Intronic
953295456 3:41711065-41711087 TCTTGGGGAGAGAAGCAGCCAGG + Intronic
953507202 3:43497725-43497747 CATGGGGGAGGGAAGCAGCATGG + Intronic
954876095 3:53804062-53804084 TCTGTAGGACAGAAGCAAGATGG - Intronic
956934960 3:74090025-74090047 TCTGGGAAACAGAAGCAGTTTGG - Intergenic
960162207 3:114362669-114362691 TCAGGGAGACAGAGACAGCATGG - Intronic
961016121 3:123469747-123469769 TCTCGGGGACAGCAGCAGAGGGG - Intergenic
961073266 3:123957718-123957740 TCTGGGGGACAGAGCGAGAAGGG + Intronic
961310418 3:125995364-125995386 TCTGGGGGACAGAGCAAGAAGGG - Intergenic
962316862 3:134364478-134364500 TCTGGGGAGGAGAAGCTGCAAGG - Intronic
962991569 3:140582187-140582209 TCTGGGAGACAGATGGTGCAGGG + Intergenic
963401196 3:144802016-144802038 TCTTTGTGACAGAGGCAGCAGGG + Intergenic
964691669 3:159456598-159456620 TTTGGGGGACAGAAGGAAGAGGG + Intronic
966883093 3:184360856-184360878 TCTGGGGGACAGGAGCTTTAGGG - Intronic
968558242 4:1261336-1261358 TCAGGGGGATTGAAGGAGCAAGG + Intergenic
969163910 4:5287922-5287944 TCTGGGGGCTAGGAGGAGCAGGG - Intronic
969455297 4:7296854-7296876 TCTCGGGGACAGAAGAGGCATGG + Intronic
970624724 4:17864097-17864119 TCAGGGGTACATATGCAGCATGG - Intronic
970730030 4:19091751-19091773 TCTGGTGGGTAGAAACAGCAGGG + Intergenic
971147732 4:23997035-23997057 TCTGGGTGTCAGAAGAATCATGG + Intergenic
972205568 4:36768194-36768216 GCAGGAGGACAGAAGCAGCCAGG + Intergenic
975859194 4:78658240-78658262 TCTGAGTGACAGAAACAGGAAGG - Intergenic
976455043 4:85236670-85236692 CCTAGGAAACAGAAGCAGCAAGG - Intergenic
980817433 4:137966573-137966595 ACTGGGGGAAAGAAGAAGAAAGG + Intergenic
980974617 4:139598832-139598854 GCCGGGGGAGAGAGGCAGCAGGG - Intronic
982361118 4:154520062-154520084 ACAGGGTGACAGCAGCAGCAAGG - Intergenic
985658917 5:1146044-1146066 TCTGGGAGACGGAGGCAGAACGG - Intergenic
986136290 5:4982247-4982269 TCTGTTGGAGAGAATCAGCATGG + Intergenic
987257679 5:16173269-16173291 TCTGGGGGACAGTCACAGAAGGG - Intronic
987639176 5:20589495-20589517 TTTGGGGGAAAGCAGAAGCAGGG + Intergenic
989400076 5:40999388-40999410 TCTGGGGAAAAGAAGGAGCAAGG + Intronic
990488312 5:56280292-56280314 TCTGGAGCACAGAAGGAGAAGGG + Intergenic
990997404 5:61746178-61746200 TCTTGGGCACAGAGGGAGCATGG + Intronic
991509275 5:67358975-67358997 TCTGGGAGAAAGCAACAGCATGG - Intergenic
992505122 5:77379305-77379327 TCTGGGGGAAAAAAACAGCTTGG + Intronic
992734791 5:79708203-79708225 TCCGTGGGATAGAAACAGCATGG - Intronic
993003790 5:82409515-82409537 TTTGGGGGCCACAAGCAACATGG - Intergenic
994212016 5:97097556-97097578 CCTGGGGGACAGGAGTAGGAGGG + Intronic
998114774 5:139528071-139528093 GTTGGGAGACAGAAGCTGCATGG - Intronic
999426422 5:151491106-151491128 TTTGGAGGACAGAACCACCAAGG - Exonic
999837389 5:155389132-155389154 TCTCGTGGACAGAAGAATCAGGG + Intergenic
1001207763 5:169779981-169780003 TCTGGGTCACCGAAGCAGTAAGG + Intronic
1001565524 5:172697050-172697072 TCAGAGGGACAGAGGCAGAAGGG - Intergenic
1002043952 5:176531937-176531959 TCTGAGAGGCAGAGGCAGCAAGG - Intronic
1002714661 5:181219487-181219509 TCGGGGTCACAGAGGCAGCAAGG - Intergenic
1003048389 6:2757262-2757284 TCTGGGGTACAAAAGGACCATGG + Intergenic
1004012000 6:11698269-11698291 TCTGGGGGACACCAGTAGCCAGG - Intergenic
1004684967 6:17934542-17934564 TCTGGGAGACAGAGGCAGAGAGG + Intronic
1011275145 6:85623486-85623508 TCTGGGAGGCAGAGGCTGCAGGG + Intronic
1011555310 6:88566798-88566820 TCTGGGGGGCTCTAGCAGCATGG - Intergenic
1013082039 6:106821580-106821602 ACTGGGGGGCCGAAGCAGGAGGG - Intergenic
1014104421 6:117546769-117546791 TCTGGGTGTGAGAAGCAGCATGG - Intronic
1014587544 6:123218608-123218630 TCTCCAGGACAGAAGCAACAAGG - Intronic
1017539470 6:155385451-155385473 TCTGGGGTGCAAAAGCAGCCGGG - Intergenic
1018692104 6:166354796-166354818 ACTGGGGGACAGCAGCAGTGAGG - Intergenic
1018848605 6:167572196-167572218 TCAGGGGCACACAAGCAGCAGGG - Intergenic
1019560900 7:1656584-1656606 TCTGGGGGCCAGAGGTAGGAAGG + Intergenic
1019811895 7:3171042-3171064 TCAGAGGGACAGAAGGAGCAAGG + Intronic
1022968712 7:35497691-35497713 TATGAGGGACAGAGGCAGCCAGG + Intergenic
1023871007 7:44263064-44263086 TCTGGGGGACAGGAAAAACAAGG + Exonic
1025291184 7:57725891-57725913 GATGGGGGACACAAACAGCAGGG - Intergenic
1025796543 7:64742982-64743004 TTTGGGAGACAGAAGCAGGCGGG + Intergenic
1027364962 7:77447780-77447802 TCTTAGGGACAGAAACAGGATGG + Intergenic
1027812064 7:82915922-82915944 TTTGGAGGAAAGAAGTAGCATGG - Exonic
1029115829 7:98236591-98236613 TCTGTGGGACCGAGGCAGGAGGG + Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1030152459 7:106420886-106420908 TCTGTGAGACAGAAGCAGCACGG + Intergenic
1030343060 7:108402529-108402551 TTTGGGAGACAGAAGGAGCCTGG + Intronic
1030565195 7:111145301-111145323 GCTGGAGGACAGAAGCAGGAAGG + Intronic
1031881101 7:127199467-127199489 TCTGTGTGACAAAAGAAGCAAGG + Intronic
1032080701 7:128857096-128857118 CCTGGGGGCCAGAGGTAGCAAGG - Exonic
1032091551 7:128914063-128914085 CCTGGGGGCCAGAGGTAGCAAGG + Intergenic
1033605576 7:142925801-142925823 ACTGGGGGCCAGAAGAGGCAGGG + Intronic
1035183061 7:157104915-157104937 ACAGGGGGATTGAAGCAGCATGG - Intergenic
1036040162 8:5069174-5069196 TCTGGGGGGTAGAAGCAGGAGGG - Intergenic
1036163057 8:6406797-6406819 TCTGGGGGAGACAGGCAGCGAGG - Intronic
1036197549 8:6733512-6733534 GTTGGGTGACAGAAGCAGAATGG + Intronic
1036469319 8:9037294-9037316 TCCTGGGGACAGAAGTAGGATGG - Intronic
1036970245 8:13347409-13347431 GCTGGAGGACGGGAGCAGCAGGG + Intronic
1037238194 8:16746123-16746145 TGGTGGGGACAGAAGCACCAGGG - Intergenic
1037517459 8:19647111-19647133 TCTGAAGGACTGAAGCAGCTAGG + Intronic
1038818748 8:30932754-30932776 TCTGGGTGACATCAGCAACATGG - Intergenic
1039209589 8:35197710-35197732 TATGTGGAACAGAAGTAGCATGG - Intergenic
1039697975 8:39932421-39932443 AGTGGTGGGCAGAAGCAGCAGGG - Intergenic
1042077448 8:65011956-65011978 TCTATGAGACAGAAGCAGAAAGG + Intergenic
1042712829 8:71737249-71737271 TCTGGGGGAAAAAAGCAGAGGGG - Intergenic
1044954758 8:97468407-97468429 TTTGAGGAACAGAAGAAGCAGGG - Intergenic
1045522391 8:102914600-102914622 CCTGGGGAAGAGAAGGAGCATGG - Intronic
1046790592 8:118317606-118317628 TTTGGGGGACAGTAGCTGGAAGG + Intronic
1048292605 8:133192063-133192085 TCTGGGGCTCAGAAGCTGCCAGG - Intronic
1048733530 8:137471471-137471493 ACTGGGGGACAGTAGAATCAAGG + Intergenic
1049673854 8:143881082-143881104 CGTGGGGGACAGAGGCAGCAGGG - Intergenic
1049989761 9:979472-979494 TTTGGGGGACCGAGGCATCAGGG + Intronic
1052430196 9:28356465-28356487 TCTGTTGGTCAGTAGCAGCAAGG + Intronic
1052822149 9:33145953-33145975 TCTGTGGGGCAGTAGAAGCAAGG + Intronic
1053098294 9:35348131-35348153 TCTGAGGGGCAGAAGCAGATAGG + Intronic
1053128120 9:35599297-35599319 TGTAGGGGACCAAAGCAGCAGGG - Intergenic
1054165255 9:61719491-61719513 GATGGGGGACACAAACAGCAGGG + Intergenic
1055442866 9:76353908-76353930 TGTGGGGGACAGCAGAAGGATGG - Intronic
1055804531 9:80077626-80077648 TGTGGGGGAGTGAGGCAGCAGGG + Intergenic
1056186721 9:84142215-84142237 TCTGGAGGCCAGAAGCCCCACGG - Intergenic
1056266534 9:84902118-84902140 CCTGGGAGTCAGAAGCTGCAGGG + Intronic
1056655084 9:88502622-88502644 CCTGGGGGACACAAGGAGGATGG - Intergenic
1057128521 9:92637832-92637854 TCTGGGGGTGAGAGGCAGCGAGG + Intronic
1057799437 9:98181158-98181180 GCTGGGGGACACAAGCAACATGG - Intronic
1058306346 9:103446045-103446067 TCTTGGGGGCAGTAGCACCATGG - Intergenic
1059528696 9:115016360-115016382 TCTGGGGCACAGAGGCTGCATGG + Intergenic
1060158097 9:121334308-121334330 TGTGGGAAACAGAGGCAGCAGGG - Intergenic
1060739875 9:126091127-126091149 TCAGTGGGACAGACACAGCAGGG + Intergenic
1061669917 9:132182884-132182906 TCTGGGGGGCAGCTGCGGCAGGG - Intronic
1061916895 9:133760066-133760088 CCAGGGGGCCAGGAGCAGCAGGG + Intergenic
1062385080 9:136306090-136306112 TGGGGTGGACAGGAGCAGCAAGG + Intronic
1062416536 9:136454066-136454088 TCTCGAGAGCAGAAGCAGCATGG - Intronic
1187256484 X:17647787-17647809 TTTGGGGGAAAGAATCACCAAGG - Intronic
1188475402 X:30586606-30586628 TTTGGGGGCTAGAAGCAGAATGG - Intergenic
1189350197 X:40270176-40270198 GCTGTGGGACAGGAGAAGCAGGG + Intergenic
1190152656 X:47960755-47960777 TCTGAGGGGCAGCAGCAGCTTGG + Intronic
1190993080 X:55572636-55572658 TCTGGGGTACAGGTGCAGGATGG - Intergenic
1193730485 X:85096746-85096768 TCTGGGGGGCAGGGGGAGCAGGG + Intronic
1196950910 X:120875149-120875171 CCTCTGGGACAGCAGCAGCAGGG + Exonic
1198624195 X:138550730-138550752 GCTGGGGGACAGCCACAGCAAGG + Intergenic
1199902580 X:152191413-152191435 CCTGGGGGACAGAGACAGTAGGG - Intronic
1199977594 X:152903612-152903634 TGAGGGGTACAGAAGCAGCCAGG + Intergenic
1201460190 Y:14213904-14213926 TCTGGGGGTCTGAAGGATCAAGG - Intergenic