ID: 901142468

View in Genome Browser
Species Human (GRCh38)
Location 1:7044029-7044051
Sequence CAGCCCTAATGGCCCTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901142468_901142476 8 Left 901142468 1:7044029-7044051 CCTCCAGAGGGCCATTAGGGCTG 0: 1
1: 0
2: 2
3: 8
4: 83
Right 901142476 1:7044060-7044082 GGTCAGGAGCAGTGATCTACGGG 0: 1
1: 0
2: 0
3: 9
4: 84
901142468_901142473 -8 Left 901142468 1:7044029-7044051 CCTCCAGAGGGCCATTAGGGCTG 0: 1
1: 0
2: 2
3: 8
4: 83
Right 901142473 1:7044044-7044066 TAGGGCTGCCAGCGGAGGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 127
901142468_901142475 7 Left 901142468 1:7044029-7044051 CCTCCAGAGGGCCATTAGGGCTG 0: 1
1: 0
2: 2
3: 8
4: 83
Right 901142475 1:7044059-7044081 AGGTCAGGAGCAGTGATCTACGG 0: 1
1: 0
2: 2
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901142468 Original CRISPR CAGCCCTAATGGCCCTCTGG AGG (reversed) Intronic
901142468 1:7044029-7044051 CAGCCCTAATGGCCCTCTGGAGG - Intronic
902489118 1:16767950-16767972 CGGCCCCACTGGCTCTCTGGGGG + Intronic
905110396 1:35590447-35590469 CAACCCTAATGGCCCCAAGGTGG + Intronic
905432027 1:37931535-37931557 AAGTCCTGGTGGCCCTCTGGAGG - Intronic
911498019 1:98654246-98654268 CTGCAGTAGTGGCCCTCTGGTGG + Intergenic
912510116 1:110183938-110183960 CAGCACGAAGGGCCCCCTGGAGG + Intronic
917132998 1:171761587-171761609 CACCCCTGATGGCCTTCTGCTGG - Intergenic
919071523 1:192762027-192762049 CAGCTCTAAAGGCCCTCTCCAGG - Intergenic
920052893 1:203174237-203174259 CAGCAGTAAGGGGCCTCTGGAGG - Intronic
923531319 1:234814575-234814597 CGGCCCCACTGGCTCTCTGGGGG - Intergenic
1063386764 10:5620703-5620725 CAGCCCTAAGGGCCAGCTGGTGG - Intergenic
1065319929 10:24499838-24499860 CCCCTCTAATGGCCCTCTTGGGG - Intronic
1068292187 10:55017791-55017813 CAGCTCTAATAGGCCTTTGGAGG - Intronic
1074165766 10:110872353-110872375 CAGCCCTCCTCCCCCTCTGGCGG + Intronic
1077080887 11:724288-724310 CAGCCCAAATGGTCCAGTGGAGG - Intronic
1083517758 11:63276402-63276424 CAGCTCTAATAGCCTTTTGGTGG + Intronic
1084643512 11:70440416-70440438 CAGGCCCAATCTCCCTCTGGTGG + Intergenic
1086855601 11:91861427-91861449 CAGCCCTCTTGGTGCTCTGGGGG + Intergenic
1096148543 12:49295054-49295076 CTGGCCTGATGGCCCGCTGGAGG - Exonic
1102748279 12:115269174-115269196 CAGCCCTGAAGCCCCTCTGTTGG - Intergenic
1102876157 12:116450645-116450667 CAGCCCAAATGTCCCTCAGCTGG - Intergenic
1111754660 13:92378091-92378113 GAGCTCTAGTGGCCATCTGGTGG - Intronic
1114347148 14:21808140-21808162 CAGCCCTCAGCGCCTTCTGGCGG + Intergenic
1127018987 15:54724069-54724091 CAGCTCTAATAGCTTTCTGGTGG + Intergenic
1128697635 15:69780515-69780537 CAGGCCTAAGGGCTCGCTGGAGG + Intergenic
1132510812 16:340471-340493 CAGCCCTGAAGGCCACCTGGTGG + Intronic
1136542447 16:30935690-30935712 CAGCCCTTACTGCCCTCTGAAGG - Intronic
1141704077 16:85655149-85655171 CAGCCCTGATGGCCCATTAGGGG + Intronic
1143868176 17:9939252-9939274 CAGCCCTTATGCACCCCTGGGGG - Intronic
1146238557 17:31191374-31191396 CAGCCCAAATGTCCCTCAGCTGG + Intronic
1148076816 17:44941888-44941910 CAGCCACACTGGCCCTCAGGAGG - Intronic
1149210643 17:54296333-54296355 AAGCCATAATGCCCTTCTGGAGG - Intergenic
1150003926 17:61457911-61457933 CAGCACTTTTGGCCCCCTGGGGG + Intronic
1153799524 18:8657233-8657255 CACCCCCACTGGCCCTCTGAAGG + Intergenic
1165150443 19:33757034-33757056 CAGCCCACATGGCCCTGTGGGGG + Intronic
1167692876 19:50997697-50997719 CATCCCTCATTGCCCTCTCGAGG - Intronic
925254122 2:2467830-2467852 CAGCCCACAGGCCCCTCTGGTGG + Intergenic
932457198 2:71857408-71857430 CAGCCCTAATGGCCCTCAGTGGG + Intergenic
932732670 2:74232102-74232124 CTGCCCTGATGGCCCTCCTGCGG - Intronic
932844805 2:75124132-75124154 CAGTCCTGATGGCCCTCAGTGGG - Intronic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
937973302 2:127566174-127566196 CAGCCCCACTGCCCCTCAGGGGG - Intronic
944665290 2:201954351-201954373 TAGCCCTATTGGCCCTCAGACGG + Intergenic
947954768 2:234179202-234179224 CAGCCCTGCTGACCCACTGGAGG - Intergenic
1169446981 20:5680489-5680511 AAGCACTAATGGCACTGTGGAGG - Intergenic
1170714986 20:18823731-18823753 CACCCCTAACCGCACTCTGGAGG - Intronic
1171433572 20:25102767-25102789 CGCCCCTATGGGCCCTCTGGAGG + Intergenic
1174258906 20:49278815-49278837 CAGCCCTAATCTCCTTCTCGTGG + Intergenic
1175938577 20:62526623-62526645 CAGGCCGAATGGCCCGCTTGGGG - Intergenic
1176018865 20:62952666-62952688 CCGCCCTGGTGGCCGTCTGGGGG + Exonic
1178511908 21:33212366-33212388 CAGCTGTGATGGCGCTCTGGTGG + Intergenic
1179124252 21:38577460-38577482 CAGGCCTAAAGTCCCTCTGGGGG + Intronic
1182356038 22:29722609-29722631 GTGCCCTAAAAGCCCTCTGGCGG + Intronic
1183101010 22:35584063-35584085 CAGAGCCTATGGCCCTCTGGGGG - Intergenic
1184668703 22:46001800-46001822 CAGCCCTCTTGGCTCCCTGGGGG - Intergenic
953413875 3:42704551-42704573 CAGCCTTTCTGGGCCTCTGGGGG - Intronic
953838523 3:46368786-46368808 TAGCCCACATTGCCCTCTGGGGG + Intergenic
954618870 3:51984469-51984491 CAGCCCCAGTGGGCTTCTGGAGG - Intronic
954621966 3:52001598-52001620 CAGGCCTGATCTCCCTCTGGGGG + Intergenic
961512560 3:127412033-127412055 CAGCCCTAACAGCCCTAAGGCGG + Intergenic
964570651 3:158105353-158105375 CAGCCCGGATGGCCCGCAGGCGG - Intronic
973318874 4:48789756-48789778 CAACTCTAAAAGCCCTCTGGAGG + Intergenic
975498841 4:75062714-75062736 CAGCCCTAGTGGCCCCCTTAGGG - Intergenic
979006043 4:115298521-115298543 CAGCCTTAATGGCTCACTTGAGG - Intergenic
983508297 4:168579285-168579307 TATCCCCAATGTCCCTCTGGAGG - Intronic
988615296 5:32769362-32769384 CAGCCCTCCTGGACCACTGGAGG - Intronic
998132299 5:139657561-139657583 GAGACCTACTGGCCCTGTGGAGG + Intronic
998303715 5:141052232-141052254 CAGCCCCAATGGCTCTTTGGTGG + Exonic
998714909 5:144872190-144872212 CAGCCCTTATTGCCACCTGGAGG - Intergenic
1002085801 5:176774685-176774707 CAGCCCTAAAGCCACTGTGGGGG - Intergenic
1002704260 5:181149450-181149472 CAGCCCCACTGGCCATCTGGGGG + Intergenic
1004811798 6:19270809-19270831 CAGCCCTCATGGGCCGGTGGGGG + Intergenic
1005967972 6:30741204-30741226 GGGCCATGATGGCCCTCTGGTGG + Exonic
1007547952 6:42708498-42708520 CCCCTCTACTGGCCCTCTGGAGG + Intronic
1007725498 6:43913444-43913466 CAGCCCCTCTGACCCTCTGGGGG - Intergenic
1009930719 6:70174214-70174236 CAGCCCTAGGGACCCTCTTGAGG + Intronic
1012998401 6:105995282-105995304 CAGCCCTCTGGGCACTCTGGGGG + Intergenic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1026931574 7:74225715-74225737 CAGCCTTCAAGGCCCTCTGGGGG - Intronic
1032937743 7:136753137-136753159 CAGCCCAAATGGCCTTCTATGGG - Intergenic
1034742016 7:153483869-153483891 CAGATCTAAGGGCCTTCTGGTGG - Intergenic
1035068790 7:156126101-156126123 CAGCCCTAATGCCACACTGGTGG + Intergenic
1038993910 8:32900538-32900560 CCTCCCTGATGGCCCTCAGGAGG - Intergenic
1040481514 8:47831630-47831652 CAGCCCTCATGGCGCTCTGGTGG - Intronic
1044358525 8:91255013-91255035 CAGCCTGAATGACCATCTGGGGG + Intronic
1045549809 8:103161535-103161557 CAGCCCTAATGGCCATCAGTAGG - Intronic
1052840575 9:33288932-33288954 CAGCCCCGCTGGCCCACTGGGGG + Intergenic
1059525915 9:114990833-114990855 CAGCTCAAATGGCCCTATGCAGG - Intergenic
1060971319 9:127739792-127739814 CAGGGCTCAGGGCCCTCTGGTGG + Exonic
1061035833 9:128113998-128114020 CCCACCTACTGGCCCTCTGGTGG + Intergenic
1187124834 X:16445355-16445377 CAGCCCTGCTCGCCCTCTAGTGG + Intergenic
1187955263 X:24511483-24511505 CAGCCCAAATGACCCTGTGTGGG + Intronic
1199665419 X:150092785-150092807 CAGTCATAATGGCCCTCAAGAGG + Intergenic
1200067158 X:153509430-153509452 CACCCCCACTGGCCCACTGGTGG + Exonic