ID: 901149746

View in Genome Browser
Species Human (GRCh38)
Location 1:7093316-7093338
Sequence GGCCACTGGCCTAGTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901149739_901149746 18 Left 901149739 1:7093275-7093297 CCAGGCAGTAGGATGTGGCTGGT 0: 1
1: 0
2: 1
3: 17
4: 307
Right 901149746 1:7093316-7093338 GGCCACTGGCCTAGTTTTCTGGG 0: 1
1: 0
2: 0
3: 21
4: 171
901149737_901149746 19 Left 901149737 1:7093274-7093296 CCCAGGCAGTAGGATGTGGCTGG 0: 1
1: 0
2: 3
3: 23
4: 251
Right 901149746 1:7093316-7093338 GGCCACTGGCCTAGTTTTCTGGG 0: 1
1: 0
2: 0
3: 21
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901149746 Original CRISPR GGCCACTGGCCTAGTTTTCT GGG Intronic
900742627 1:4339996-4340018 GACCACTGGATTAGGTTTCTGGG - Intergenic
901149746 1:7093316-7093338 GGCCACTGGCCTAGTTTTCTGGG + Intronic
901186898 1:7379676-7379698 GGCCACTGCCCTTGCCTTCTAGG - Intronic
907643967 1:56222283-56222305 CTTCACTTGCCTAGTTTTCTAGG + Intergenic
907823645 1:57994620-57994642 GGACACTGGCCTACTTATGTTGG + Intronic
909701957 1:78535047-78535069 GGGCAGTGCCCTAGTGTTCTGGG + Intronic
911518168 1:98894682-98894704 GGCCACTGGCCTAGGCCTCAGGG + Intronic
914381794 1:147123078-147123100 GGACCCTGGGCTAGTTTCCTGGG - Intergenic
914464537 1:147914578-147914600 CCCCACTCGCCTTGTTTTCTAGG - Intergenic
915723288 1:157999666-157999688 GGCCTCTGGACCAGTTTACTTGG + Intronic
916992875 1:170263841-170263863 GGCCACTGGAGTAGTTTTCATGG - Intergenic
920641388 1:207754681-207754703 TGCCACTGCCCTAGCTTTTTAGG - Intronic
922822958 1:228496986-228497008 TGACACTGGCCTAGGTTTCAGGG - Intergenic
923763503 1:236870275-236870297 GGCCTCTGGCTCAGTGTTCTTGG + Intronic
924362559 1:243256092-243256114 GGCCACAGGCCTGTTGTTCTCGG + Exonic
924622695 1:245675856-245675878 GGCCACTGGCTTTGTTCTCTAGG - Intronic
1068343981 10:55747245-55747267 AGCCACTGCCAGAGTTTTCTTGG - Intergenic
1070452294 10:76572984-76573006 GGCCACTTGCCTTGTATTTTTGG + Intergenic
1071516315 10:86300305-86300327 GCCCACTGTTTTAGTTTTCTAGG - Intronic
1074643581 10:115417695-115417717 GGGCACTGGGATAGTCTTCTGGG + Intronic
1075362331 10:121849619-121849641 GGCCTCTGACCTGCTTTTCTTGG - Intronic
1075464626 10:122642354-122642376 GGCCAGTGGGCCAGTTTTCCTGG + Intronic
1077509162 11:2946860-2946882 GGCCAGTGGCTCAGTGTTCTTGG - Intronic
1080558404 11:33438524-33438546 GACCACTGGCCCAGTATTCAGGG - Intergenic
1081700133 11:45147331-45147353 GGCCGCCGGCCTAGTTCTCGCGG + Exonic
1081767808 11:45624107-45624129 TTCCACTGGCCTGTTTTTCTAGG - Intergenic
1081800837 11:45858291-45858313 GACTTGTGGCCTAGTTTTCTTGG - Intronic
1083040471 11:59680581-59680603 GGCCACTGGGACAGTCTTCTGGG + Intergenic
1084871838 11:72103558-72103580 GGCCACTAGGCCACTTTTCTGGG + Intronic
1085707426 11:78799186-78799208 GGCCACTGACCTAGTTGTTTGGG + Intronic
1087643494 11:100781035-100781057 GCCCACTGGCCCTGTTTTTTTGG + Intronic
1087861483 11:103163331-103163353 CACCACTGGCCTAGGTTGCTTGG - Intronic
1089409158 11:118224338-118224360 GGACAGTAGCCTAGCTTTCTTGG + Intronic
1091225084 11:133952183-133952205 GGCAGCTGACCTATTTTTCTTGG - Intronic
1093976724 12:25431111-25431133 GGCCACTGCCTTAGTTTCCTTGG + Intronic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1095957834 12:47816927-47816949 GGCCACTCGCCTAGATTCCCAGG + Intronic
1100862673 12:98823119-98823141 GGCTAGTGGCCTAGAGTTCTTGG + Intronic
1101308769 12:103557103-103557125 GGACACTGTACTAGTTTCCTAGG - Intergenic
1104080151 12:125422937-125422959 CGCCCCTGGTCTAGTTTCCTGGG - Intronic
1104426456 12:128682225-128682247 GGCCACAGCCCTAGTTTCTTTGG - Intronic
1104728292 12:131091179-131091201 TTCCAATGGCCTACTTTTCTAGG - Intronic
1105213296 13:18270608-18270630 GTCCACTTGCCCAGTTTTCAGGG + Intergenic
1107750953 13:43565775-43565797 AGCAACTGTCCTAGTTTTCCTGG - Intronic
1107961573 13:45563904-45563926 GGCCAATGGCTTTGCTTTCTAGG + Intronic
1108125750 13:47240605-47240627 GGCCTCTTACCTTGTTTTCTGGG + Intergenic
1108212955 13:48156839-48156861 GTCCACGTGCCTAATTTTCTTGG + Intergenic
1109825978 13:67722828-67722850 GGACACTGTACTAGTTTTCCAGG - Intergenic
1110320313 13:74153785-74153807 GCCCACTGTCCTGGGTTTCTAGG + Intergenic
1111912770 13:94330289-94330311 GGCCACTGGCCAAGTGACCTTGG + Intronic
1117356391 14:54927548-54927570 GGCCACTGGTCTGGTCTTATAGG - Intergenic
1118787078 14:69054882-69054904 GGGCACTGGGCTTGTCTTCTCGG + Exonic
1121783130 14:96635355-96635377 TTCCCCTGGCATAGTTTTCTAGG - Intergenic
1122065109 14:99167592-99167614 TGCTATTTGCCTAGTTTTCTGGG + Intergenic
1122764075 14:104053143-104053165 GGCCACTGTCCTGGCCTTCTGGG + Intergenic
1125059083 15:35397549-35397571 GGCCACAGGCTCAGTGTTCTTGG - Intronic
1126495923 15:49290546-49290568 CATCACTGGCCCAGTTTTCTTGG + Intronic
1126872494 15:53004652-53004674 AGCCACTGATCTAGTTTGCTGGG - Intergenic
1128144867 15:65327369-65327391 GGACACAGCTCTAGTTTTCTAGG + Exonic
1129520588 15:76183647-76183669 GCCCATTGGCCTTGTTTTATGGG - Intronic
1130220898 15:82018573-82018595 GGCCACTGGCTCAGCCTTCTGGG + Intergenic
1131602688 15:93865545-93865567 GGCCACTTCCCTCGTTTTGTTGG - Intergenic
1131771182 15:95739302-95739324 AGCCACTTGTCTAGTTGTCTCGG - Intergenic
1134140021 16:11710398-11710420 GGCCCTTGGCCTATTTTTGTAGG - Intronic
1135132640 16:19865342-19865364 GTCCACTGGTCTACCTTTCTGGG + Intronic
1135807299 16:25554569-25554591 GGCTCCTGGCCTGGTTCTCTGGG - Intergenic
1136333949 16:29599500-29599522 GGGCACTGGCCAACTTTTATGGG - Intergenic
1136384582 16:29915351-29915373 GGCCACTTGCAGAGATTTCTAGG - Intronic
1139583441 16:67886246-67886268 GGCCTCTGGCCTAGCTTGTTGGG + Exonic
1142150656 16:88511195-88511217 GGCCACTGCCTGTGTTTTCTGGG + Intronic
1145406866 17:22607377-22607399 AGCCCCTGCCCAAGTTTTCTTGG - Intergenic
1145997408 17:29112612-29112634 GGCCACAGGCCTAGTTTGTTTGG - Intronic
1147564330 17:41527462-41527484 GGCCCCTGGCCTAGACCTCTGGG + Intronic
1149214354 17:54336602-54336624 GGCAACTGGCCTAGATTCTTGGG + Intergenic
1150143954 17:62752491-62752513 CTCCACTGACCTAGTTTCCTGGG + Intronic
1151331313 17:73410874-73410896 GGCCACTGCCCTAATTGTCCTGG + Intronic
1152153517 17:78617730-78617752 GGACAGTGTCCTAATTTTCTAGG + Intergenic
1157554781 18:48606372-48606394 GGCCACTGGCATACTGTTCCAGG + Intronic
1160265725 18:77339651-77339673 GGCCACTGGCCACGTGCTCTAGG + Intergenic
1164535744 19:29085312-29085334 GGCCTCTGGCCTAGGTTTCAGGG + Intergenic
1166308399 19:41948497-41948519 GTCCAGTTGCCTAGTTTTGTGGG - Intergenic
1167341349 19:48918371-48918393 CGGCACTGGCCTGGTTGTCTGGG + Intronic
925928568 2:8687846-8687868 GGCCAATGCCCTAGTTTACTGGG - Intergenic
926605676 2:14896175-14896197 GTCCACTGGCCCAGTTTCCAGGG + Intergenic
927293932 2:21431671-21431693 GGCCATTGTTCTAGTTTTCAAGG - Intergenic
927480707 2:23451752-23451774 GGCCTGTGGGCCAGTTTTCTGGG - Intronic
928016021 2:27657758-27657780 AGCCACTGGCCTAGCTTTCCAGG + Intronic
930772486 2:55141764-55141786 GGCCACTGGGAGAGTTTCCTGGG - Intergenic
933746900 2:85578199-85578221 TGCCACTGGCCTATTTTTGGAGG + Intronic
933915126 2:86983139-86983161 GGACACTGTCCTAGTTTTGTAGG + Intronic
934007868 2:87786761-87786783 GGACACTGTCCTAGTTTTGTAGG - Intronic
934301027 2:91776136-91776158 GTCCACTTGCCCAGTTTTCAGGG - Intergenic
935030678 2:99318546-99318568 GGACAGTGGCCTGCTTTTCTAGG + Intronic
935771507 2:106427679-106427701 GGACACTGTCCTAGTTTTGTAGG - Intronic
935908566 2:107868268-107868290 GGACACTGTCCTAGTTTTGTAGG + Intronic
935994964 2:108760486-108760508 GGACACTGTCCTAGTTTTATAGG + Intronic
936130353 2:109833392-109833414 GGACACTGTCCTAGTTTTGTAGG + Intronic
936214344 2:110538093-110538115 GGACACTGTCCTAGTTTTGTAGG - Intronic
936423480 2:112392656-112392678 GGACACTGTCCTAGTTTTGTAGG - Intronic
938244387 2:129765765-129765787 GGCCACTGACATCGTTTCCTGGG - Intergenic
941950913 2:171156300-171156322 TGCCACTGGTCTAGTTTCTTTGG + Intronic
945550124 2:211211219-211211241 GGTCACTGGCCTACTTGCCTAGG - Intergenic
947534868 2:230934116-230934138 GGGCACTGGCCTAGGTATATGGG + Intronic
948316955 2:237035245-237035267 GGCCACTGGGGTAGTGTACTAGG - Intergenic
948795750 2:240401356-240401378 GGCCACTGTTCGAGTTTCCTAGG - Intergenic
1169243609 20:4006834-4006856 GGCCACTGGCCAGCTATTCTTGG + Intronic
1169665685 20:8033179-8033201 GGCCATAGGCTTTGTTTTCTAGG - Intergenic
1172047565 20:32091376-32091398 GGCCACTTACCTATTTCTCTGGG + Intronic
1172599686 20:36175255-36175277 GGCCACTGGCTTTGGTTTCATGG + Intronic
1178626011 21:34219467-34219489 GGCCACTTGCCTAGTGATTTGGG + Intergenic
1180115525 21:45701360-45701382 GCCCACTGGCCTAGTGTCATAGG - Intronic
1180216250 21:46325094-46325116 GGCCACTGTCCTAGGTTTCGTGG + Intronic
1180816123 22:18791008-18791030 GTCCACTTGCCCAGTTTTCAGGG + Intergenic
1181202310 22:21225340-21225362 GTCCACTTGCCCAGTTTTCAGGG + Intronic
1181539303 22:23564873-23564895 GGCCCCTGTCCCAGTTCTCTCGG - Intergenic
1181699390 22:24611274-24611296 GTCCACTTGCCCAGTTTTCAGGG - Intronic
1181865033 22:25848090-25848112 AGACACAGCCCTAGTTTTCTAGG - Intronic
1182100315 22:27652997-27653019 GGCCACGGGCAAAGTTCTCTAGG + Intergenic
1183960692 22:41410286-41410308 GGTCACTGGCCAAGTGATCTTGG - Intergenic
1184518911 22:44980754-44980776 GGACCCTGGCCTTGTTTTCAAGG - Intronic
1203224600 22_KI270731v1_random:70073-70095 GTCCACTTGCCCAGTTTTCAGGG - Intergenic
1203266226 22_KI270734v1_random:16719-16741 GTCCACTTGCCCAGTTTTCAGGG + Intergenic
952171639 3:30813590-30813612 GGCCTGTGGCCTACATTTCTTGG + Intronic
959248944 3:103914845-103914867 GTACAGTGGCCAAGTTTTCTTGG + Intergenic
960126677 3:114006148-114006170 GGCCACTCTCCCAGTTTTCATGG - Intronic
963297744 3:143565092-143565114 GGCAACTGGCCTGGACTTCTGGG - Intronic
965787003 3:172345966-172345988 GGCATCTGACTTAGTTTTCTTGG + Intronic
966219406 3:177535667-177535689 GGCCACTGGCCTAACTTCCAAGG + Intergenic
969292935 4:6252289-6252311 GCCCACGGACCTAGTGTTCTCGG + Intergenic
969577613 4:8045871-8045893 GTCCACTGGCCCAGGTTCCTGGG + Intronic
971441499 4:26692490-26692512 GGACAGTGGCCTACTTCTCTTGG - Intronic
972923724 4:43976550-43976572 TCCCACTGTACTAGTTTTCTTGG + Intergenic
975825630 4:78316815-78316837 CTCTCCTGGCCTAGTTTTCTTGG - Intronic
979442156 4:120763524-120763546 AGACACTGGCCAAGTTTTCAAGG + Intronic
983849997 4:172569088-172569110 GGGCCCTGGCATAGTTCTCTGGG + Intronic
983877705 4:172896505-172896527 GGCCACTGGGACAGTCTTCTAGG - Intronic
988196155 5:28008714-28008736 GACAACTGGCCAAGTTTTCAGGG + Intergenic
990766508 5:59189660-59189682 GGCAACTGACCTTTTTTTCTTGG - Intronic
992573278 5:78082342-78082364 GGCCATTGGACTAGATTTCAGGG + Intronic
997289711 5:132719982-132720004 GACTACTGGCCTAGGTTTTTTGG + Intronic
999082786 5:148859960-148859982 TGTCACTGACCTAGTTTTCTTGG + Intergenic
999389423 5:151179546-151179568 TGCCACTGGCCTCCTTTTCAGGG - Intergenic
999577883 5:153000500-153000522 GGGCACTGGACTAGTAGTCTGGG - Intergenic
1000729105 5:164808952-164808974 GGCTATTTGCCTAGTTTACTTGG + Intergenic
1004235743 6:13873284-13873306 GGCCACTGTATTAGTTTGCTAGG - Intergenic
1005855631 6:29860856-29860878 GGCCCCTAGTCCAGTTTTCTGGG + Intergenic
1007505605 6:42332917-42332939 GGAAACTGGCCTACTTTTATGGG + Intronic
1008230374 6:48979402-48979424 GGCCACTGGGGTAGTGTTCCAGG - Intergenic
1010808261 6:80264919-80264941 GGCCACTGGCATATCTTTCTTGG - Intronic
1013234698 6:108187263-108187285 GGCCTCTGACCTTGTTTTCATGG + Intronic
1013355518 6:109342743-109342765 GGCCACCGCCCTTGGTTTCTGGG - Intergenic
1015187605 6:130436010-130436032 GTCCACAGGCCTAGTTTTAAAGG + Intronic
1015784594 6:136908979-136909001 GGCCCCTTGCCTACTTTTATGGG + Intronic
1016025213 6:139279929-139279951 GGTCACTGGCACAGTTTTATTGG + Intronic
1017788060 6:157772691-157772713 GGTCCCTGGACTAGTTTCCTGGG - Intronic
1018235396 6:161718610-161718632 GGCCACTGGGCTGTTTCTCTCGG - Intronic
1018487873 6:164260560-164260582 GGACTCTGGCGCAGTTTTCTTGG - Intergenic
1029267074 7:99350980-99351002 AACCACTAGCCTGGTTTTCTGGG - Intronic
1031143970 7:117977219-117977241 GGGCACTGGTCAAGTATTCTAGG - Intergenic
1032706603 7:134425356-134425378 GGGTACTGGTCTAGTCTTCTGGG - Intergenic
1033187674 7:139243724-139243746 GGCCATTAGAGTAGTTTTCTAGG - Intronic
1035397693 7:158546075-158546097 GGCCGTTGGCCCAGTTTTTTTGG - Intronic
1036508494 8:9378823-9378845 GACCACTGTGTTAGTTTTCTAGG + Intergenic
1037618477 8:20542767-20542789 GGCCATTGGACAAGTGTTCTAGG - Intergenic
1037728577 8:21504741-21504763 TGTCACTGGCCAAGTTTTCGGGG + Intergenic
1037832918 8:22199603-22199625 AGGCACTGGACTAGGTTTCTAGG + Intronic
1039574699 8:38613789-38613811 GGCCACTGTACCTGTTTTCTGGG + Intergenic
1039703570 8:39985246-39985268 GGCCACAGGCCAAATATTCTGGG + Intronic
1044260809 8:90118099-90118121 AGCCACTGGCATAGCTTGCTTGG - Intergenic
1044726253 8:95196471-95196493 TGCCACTGAACTTGTTTTCTTGG + Intergenic
1045900446 8:107273052-107273074 GGCCATTGGCCTGGTCTTTTAGG - Intronic
1046066411 8:109202264-109202286 GGCCTCTGGCCTGGGTATCTGGG - Intergenic
1047599624 8:126413178-126413200 GACCACTGCATTAGTTTTCTAGG + Intergenic
1048869356 8:138784354-138784376 GGCCACTGGTTTACTTTTGTGGG + Intronic
1049121816 8:140746443-140746465 GATCACTGGGCTAGTTTTTTAGG + Intronic
1050521525 9:6505734-6505756 TGCCACTAGCCTAATCTTCTGGG - Intronic
1052836705 9:33255441-33255463 GGCCACTGGCCTGGGTTCCAAGG + Intronic
1057867982 9:98696453-98696475 GGCCGCTGGACTGGTTTGCTGGG + Intronic
1058402775 9:104636830-104636852 GGCCATAGCTCTAGTTTTCTGGG - Intergenic
1059982126 9:119784643-119784665 TGCCACTGAGCTAGTTTTCTGGG + Intergenic
1186123135 X:6384388-6384410 GGCCCCTTCCCTTGTTTTCTGGG + Intergenic
1193037710 X:76971592-76971614 GCACATTGGCCTAGTTGTCTTGG - Intergenic
1194077390 X:89413726-89413748 GGCAACTGGACAAGTTTTCAGGG + Intergenic
1194337453 X:92665659-92665681 GGCCACTGGAGTACTTTTTTAGG - Intergenic
1194978340 X:100414996-100415018 GGCCTCTGTCCTAGTCTTCTTGG - Intergenic
1196473946 X:116061089-116061111 GGCCACTGGGACAGTCTTCTAGG - Intergenic
1197861344 X:130974256-130974278 GGACAGTGGCCCACTTTTCTTGG + Intergenic
1199380765 X:147169597-147169619 GGGGCCTGGCCTAGTTTTGTGGG + Intergenic
1199491476 X:148405055-148405077 GGCCACTTGCCTCCTTATCTGGG - Intergenic
1200430038 Y:3069265-3069287 GGCAACTGGACAAGTTTTCAGGG + Intergenic
1200645874 Y:5782393-5782415 GGCCACTGGAGTACTTTTTTAGG - Intergenic
1200880718 Y:8209126-8209148 GGACACTGGCTTGGCTTTCTTGG - Intergenic
1201322216 Y:12712091-12712113 GGCCACTGGGCGGGTTATCTTGG + Intronic