ID: 901149757

View in Genome Browser
Species Human (GRCh38)
Location 1:7093373-7093395
Sequence CACCCTTGGAAGTCAGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901149757 Original CRISPR CACCCTTGGAAGTCAGGAAA TGG (reversed) Intronic
901149757 1:7093373-7093395 CACCCTTGGAAGTCAGGAAATGG - Intronic
901440420 1:9274678-9274700 CAGAGTTGGAAGCCAGGAAATGG - Intergenic
902412798 1:16221218-16221240 CTCCCTCTGCAGTCAGGAAAAGG - Intergenic
903816827 1:26070005-26070027 AAACCTTGGAAGAGAGGAAATGG + Intergenic
906610419 1:47198051-47198073 TAGTCTAGGAAGTCAGGAAAAGG + Intergenic
907087319 1:51687639-51687661 CAAGCTTGGAAGTGTGGAAAAGG + Intronic
907180348 1:52564114-52564136 CATCCTTGGAAATCATGAAAGGG + Intergenic
908644516 1:66262989-66263011 CTTCTTTGGAACTCAGGAAAAGG + Intronic
909438258 1:75669275-75669297 CAGGCTTGGAATTCAGGAATGGG - Intergenic
910967248 1:92819924-92819946 CAGTCTGTGAAGTCAGGAAAGGG - Intergenic
913446305 1:118954294-118954316 TATCATTGGAAGCCAGGAAAAGG - Intronic
916607549 1:166358223-166358245 CTGCCTGGGAAGTGAGGAAATGG + Intergenic
917941680 1:179928335-179928357 CACCCATGGAAAGGAGGAAAAGG - Intergenic
919271928 1:195359754-195359776 CACCCTTGGAAGCCATGGCATGG + Intergenic
919413358 1:197275023-197275045 CACCACTAGAAGCCAGGAAAAGG - Intronic
920177887 1:204114501-204114523 CACCACTGGAAGACAGCAAAGGG - Exonic
920424129 1:205859922-205859944 CTCCCCAGGAAGTAAGGAAATGG - Intergenic
921838608 1:219804298-219804320 CACCCTAGGAACTGAGCAAAAGG - Intronic
923989425 1:239419050-239419072 CACATTTGGGAGTAAGGAAAGGG + Intronic
924172692 1:241357752-241357774 CACCCTAGGAATGAAGGAAATGG + Intergenic
1063328756 10:5133717-5133739 CACCCTTATTAGTTAGGAAATGG + Intronic
1064046123 10:12017426-12017448 CACACGTGAAAGTGAGGAAAAGG - Intronic
1065693730 10:28360196-28360218 TGCCCTTGAAAGTCAGGAAGGGG + Intergenic
1065786357 10:29219579-29219601 CACCTTTGGAAGGAAGAAAATGG + Intergenic
1068183331 10:53551106-53551128 TACCCTTAGAACTCAGAAAAAGG + Intergenic
1068196216 10:53720308-53720330 TACTCTTGGATGACAGGAAAAGG + Intergenic
1069862689 10:71481370-71481392 CACCCTTGGGAGTCAGGAAATGG + Intronic
1072195665 10:93115689-93115711 TGCCCTTAGAAGTCAGGAAGTGG + Intergenic
1074434893 10:113425617-113425639 GACCCATGGAAGGCAGGAGAAGG + Intergenic
1074536626 10:114332580-114332602 CAGGCTTGGAAGTTAGGAATTGG + Intronic
1077968779 11:7165727-7165749 CACCCATGGAAGAGAGGCAAAGG + Intergenic
1079604298 11:22345171-22345193 AACACTAGGAAGTCAGTAAACGG + Intronic
1080569103 11:33540223-33540245 TAGCCTTGTAACTCAGGAAAAGG - Intergenic
1080888826 11:36390828-36390850 CACAGTTGGCAGTCAGTAAATGG + Intronic
1086834597 11:91605012-91605034 TACTATTTGAAGTCAGGAAAAGG + Intergenic
1088020815 11:105116485-105116507 TACAGTTTGAAGTCAGGAAAGGG - Intergenic
1090274408 11:125409491-125409513 CACCCTTAGAAGACAGGTTATGG + Intronic
1090893557 11:130949298-130949320 CTCCCTTGGTAGGGAGGAAATGG + Intergenic
1090896351 11:130979272-130979294 CTTCCTAGGAAGTCAGGGAATGG + Intergenic
1091619680 12:2076928-2076950 CACCCCTGGAATCCAGGAGAGGG + Intronic
1091691605 12:2601198-2601220 CACCCTTTGAGGCCAGGAAGGGG + Intronic
1096696620 12:53353215-53353237 CTCCCTTGGAAGTCAGAGTAGGG + Intergenic
1096928600 12:55177625-55177647 AATCTTTGGAAGTCAGAAAATGG - Intergenic
1098320165 12:69235328-69235350 CTACCCTGTAAGTCAGGAAATGG - Intergenic
1101924872 12:108963171-108963193 CACCCTTGGAGCTCTGGGAAGGG - Intronic
1102741173 12:115208760-115208782 CCCCTTTGGAATTCAGAAAATGG + Intergenic
1103232270 12:119341429-119341451 CTGCCTTTGAAGTCAGGCAAAGG + Intronic
1103656075 12:122471518-122471540 ACCACTTGGAAGTAAGGAAAGGG - Intergenic
1104500684 12:129282557-129282579 CACACATGGAGGTCAGGAGAGGG - Intronic
1108813120 13:54254443-54254465 CACTCTTGGAGGTTGGGAAAAGG + Intergenic
1109388304 13:61662262-61662284 CACTCATGGAAGCCTGGAAATGG + Intergenic
1109673357 13:65638905-65638927 CACCATTGGCAGTTTGGAAATGG - Intergenic
1110067945 13:71132559-71132581 CACCCTTAGAAGCTAGGAATAGG + Intergenic
1113415053 13:110122518-110122540 CACCACCAGAAGTCAGGAAAAGG - Intergenic
1117724570 14:58660199-58660221 CACCATTGGACGGAAGGAAAAGG + Intergenic
1118699552 14:68419859-68419881 GACCCTAGGATGGCAGGAAATGG - Intronic
1119766196 14:77189711-77189733 CTCCCTGGGGAGTCAGGAAAGGG + Intronic
1120665955 14:87307103-87307125 CAGCCTTGGAATTCATGTAAAGG + Intergenic
1121106608 14:91283880-91283902 GATCCTTGGAAGTCAGGGATTGG - Intronic
1122643005 14:103172255-103172277 CTCCCCAGGAAGTAAGGAAATGG - Intergenic
1126080591 15:44957393-44957415 CACACTTGGAATTCAGGAAGAGG - Intronic
1127164485 15:56230710-56230732 CACACTATGAAGTCAAGAAAAGG + Intronic
1128561639 15:68672663-68672685 CAGCTTTGGAAGTGAAGAAATGG + Intronic
1134170040 16:11961216-11961238 GACCTTTGGAAGACAGGCAAAGG - Intronic
1135082161 16:19445642-19445664 AACCTGTGGAAGTCAGAAAAGGG + Intronic
1135688956 16:24521025-24521047 CTCCCCTGTAAATCAGGAAAAGG - Intergenic
1140773893 16:78231982-78232004 CATCCTTGGAACTTAGTAAAGGG - Intronic
1142737092 17:1907932-1907954 CTCTCCTGGAAGTCAGGAAAGGG + Intergenic
1142951667 17:3486293-3486315 CAGCCTTGGAAGTTAGGAATGGG - Intronic
1143016779 17:3895030-3895052 CAGGCTGGGAAGTCAGGAAAGGG + Intergenic
1143032302 17:3974469-3974491 CACCCCTGGACCTCAGGAAGAGG + Intergenic
1143728099 17:8863957-8863979 CACCCTTGCAACTCAGGACTTGG - Intronic
1143952308 17:10643194-10643216 GACCTTGGGAACTCAGGAAAGGG - Intronic
1144374164 17:14622458-14622480 CACCCGTGGAGGTTAGGAAACGG - Intergenic
1144841738 17:18190828-18190850 CAGCCTGGGCAGTCAGGGAAAGG + Intronic
1147171238 17:38620248-38620270 AACCCTTGGAAGTAAGGAGTTGG - Intergenic
1148020219 17:44548364-44548386 CTCCCTTGGGAGGGAGGAAAAGG - Intergenic
1148834534 17:50458889-50458911 CAGCCTAGAAAATCAGGAAATGG - Intronic
1149334430 17:55620980-55621002 AACACTTGGAAAGCAGGAAAGGG - Intergenic
1149647110 17:58248987-58249009 CACCCGTGGGAGGCAGGAAATGG - Intronic
1150754858 17:67902457-67902479 CACGCTTGGAACTAAGGAGAAGG - Intronic
1152875342 17:82783215-82783237 CAGCCTTTGAAATGAGGAAAAGG + Intronic
1153741752 18:8137441-8137463 CACCCTTGCAATTCAGGCAGGGG + Intronic
1155354459 18:24937872-24937894 CACCATTGCAAGGGAGGAAAGGG - Intergenic
1157191108 18:45582530-45582552 CACGCTTAAAAGTTAGGAAAAGG + Intronic
1158764831 18:60437389-60437411 CCCACTTGGAAGTCAGAGAATGG - Intergenic
1159125965 18:64225118-64225140 AAACATTAGAAGTCAGGAAAAGG - Intergenic
1163062457 19:14770314-14770336 CACTCTTGGCAGACGGGAAAGGG - Intronic
1164743761 19:30595764-30595786 CACTCCAGGAAGTCAGGGAAAGG - Intronic
1165999543 19:39870269-39870291 CACCCTGGGAAAGCAGGAAGCGG + Exonic
1166101851 19:40576033-40576055 CAGCATTGGAAGTGAGGTAAAGG - Exonic
1168508308 19:56954769-56954791 CTCCCTTGGAAATAACGAAAAGG - Intergenic
1168652321 19:58098998-58099020 CCCCCCTGGAAGGCAGGATAGGG + Intronic
925697243 2:6594009-6594031 CACCCATGGTTCTCAGGAAAGGG + Intergenic
925839854 2:7980721-7980743 CCCCCTGGGGATTCAGGAAAGGG + Intergenic
926036448 2:9639655-9639677 GGCCCCTGGAATTCAGGAAAGGG - Intergenic
926122355 2:10250879-10250901 AACACATGGAATTCAGGAAATGG - Intergenic
929142877 2:38681837-38681859 CACCCTTGGAGCTTTGGAAATGG + Intronic
929205661 2:39289646-39289668 CATTCTTAGAAGTCAGGAATAGG + Intronic
933853164 2:86387058-86387080 AACTCTTGGAATTCTGGAAAAGG - Intergenic
934886835 2:98032355-98032377 GACCCCTGGAAGCCAGGAAGAGG - Intergenic
935631984 2:105219689-105219711 CACCTTTGTAAGTCATGGAAGGG + Intergenic
936813742 2:116433957-116433979 CACCTTTGGAATTGGGGAAAAGG - Intergenic
937895439 2:126973937-126973959 CTCCCTGGGAGGTCAGGACAGGG + Intergenic
939620108 2:144408711-144408733 AAGCCTTGGCAATCAGGAAATGG - Intronic
941858553 2:170254637-170254659 CACCCTGGGAAGTTGGGACAAGG - Intronic
942829382 2:180221623-180221645 CATCTTTGTGAGTCAGGAAATGG + Intergenic
943907504 2:193518209-193518231 CACCTTTGGAAAACAAGAAATGG + Intergenic
944216853 2:197264761-197264783 CACCCTCAGGAGTCTGGAAAAGG - Intronic
945157653 2:206856435-206856457 CACCCTTGGAAGTTAGGGTTTGG + Intergenic
945625334 2:212197691-212197713 CACCCTTCTAAAACAGGAAATGG - Intronic
947488947 2:230577554-230577576 CAGCCTTGGAAGTCTAGTAAAGG + Intergenic
948122161 2:235539093-235539115 CACCATTTCAAATCAGGAAAAGG - Intronic
948345942 2:237298297-237298319 GACCCTTGTAATTGAGGAAATGG + Intergenic
1169983268 20:11411341-11411363 TTTCCTTGGAAGTCAGGAACAGG - Intergenic
1172159771 20:32859066-32859088 CAGCCTTGGAGGTCAGGCAGAGG - Intronic
1172860335 20:38044728-38044750 CACCCTTACCAGTTAGGAAATGG + Intronic
1175144954 20:56888805-56888827 GAGCCTTGGCAGGCAGGAAATGG - Intergenic
1176264115 20:64199712-64199734 CTCTCTGGGAGGTCAGGAAAGGG + Intronic
1177037026 21:16056912-16056934 TACCCTTGGCAGATAGGAAAGGG - Intergenic
1179587590 21:42383497-42383519 CACCCTGGGATGTCAGGAGCAGG + Intronic
1183145011 22:35982329-35982351 GACCGGTGGAAGTCAGGGAAAGG - Intronic
1184196302 22:42931376-42931398 CACCCAGGGAAGTGAGGAAATGG + Intronic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
1185390119 22:50555488-50555510 CTCTTTTGGAATTCAGGAAAAGG + Intronic
949841926 3:8329211-8329233 CACTCATGTTAGTCAGGAAAGGG - Intergenic
950181269 3:10915147-10915169 CACCCCTGGTAGTGAGGAATGGG - Intronic
950424795 3:12919346-12919368 CTCCCTTGGGAGGCAGGAAGGGG - Intronic
950799551 3:15539154-15539176 CACTCTGGAAAGTCAGGCAATGG - Intergenic
951406734 3:22309425-22309447 CACCCTTAGAAGTGAGAAACTGG - Intronic
953791689 3:45952486-45952508 CACCCTTCCAAGTCAGTTAAAGG - Intronic
956128188 3:66030741-66030763 CAGCCTTGGAAGTCACTATAAGG + Intronic
957610079 3:82454406-82454428 AGCCCTTGGAAGCTAGGAAAAGG + Intergenic
959913112 3:111787487-111787509 CACCATGAAAAGTCAGGAAAAGG - Intronic
961348913 3:126286739-126286761 CTCTTTTGGAATTCAGGAAAAGG - Intergenic
961411131 3:126721227-126721249 GAAGCTTGGAAGTCAGGCAAAGG - Intronic
963077012 3:141356215-141356237 GACCATGGGAAGTGAGGAAATGG + Intronic
963649253 3:147957301-147957323 CACACTTGGAAGTAAAGAATAGG - Intergenic
964210687 3:154223816-154223838 CACCCTTTGAAGTGGTGAAATGG + Intronic
964543480 3:157805719-157805741 CAGTCCTGGAAGTCAGCAAATGG + Intergenic
965507787 3:169535206-169535228 CACCCATTGGAGTCAGGCAATGG + Intronic
965538532 3:169849849-169849871 CACCCTTCTCAGTTAGGAAATGG + Intronic
966506589 3:180709917-180709939 TTCCCTTTGAAGTCAGGAAGAGG - Intronic
969533250 4:7740931-7740953 CACCCTGGGCACTCAGGGAAAGG - Exonic
970229184 4:13891407-13891429 GACCCTGAGAAGTCTGGAAATGG + Intergenic
972463075 4:39325049-39325071 CACTGTTAGAGGTCAGGAAAAGG - Intronic
973066507 4:45800745-45800767 CACCCTAGGAAATTAGAAAAAGG - Intergenic
974468486 4:62288842-62288864 CACCCATGAAACTCAGCAAATGG - Intergenic
980987089 4:139705970-139705992 CACATTTTGACGTCAGGAAAAGG + Intronic
982103017 4:151986981-151987003 CCTCCATGGAAGTCAGAAAATGG + Intergenic
982392450 4:154879755-154879777 CACCTTTAGAAGTCATGATAGGG + Intergenic
982781232 4:159493186-159493208 CACCCCTGGAAGGCAGGGCATGG + Intergenic
983735173 4:171049301-171049323 CACCCTTGGAAAGGAAGAAAAGG + Intergenic
984256705 4:177398225-177398247 CAGACTTGGAAGACAGTAAAGGG - Intergenic
984958931 4:185075312-185075334 CACCCTGAGAAGCAAGGAAAGGG + Intergenic
986088431 5:4477466-4477488 CTCCTTTCAAAGTCAGGAAATGG + Intergenic
986974736 5:13381823-13381845 CACCCATGGAATTCAGGCAGGGG - Intergenic
1000350681 5:160350034-160350056 CTTCCTTAGAAGGCAGGAAAAGG - Intronic
1000735562 5:164894730-164894752 CACCTTTGGAAGAGAGGTAAAGG - Intergenic
1001722610 5:173868890-173868912 CCCCTTTGGAAGACAGAAAAGGG - Intergenic
1006466189 6:34196276-34196298 CTCCCTCGGAAGACAGGAAACGG + Intergenic
1006983952 6:38165860-38165882 CAGCCTTGCAAGTCCGGAAACGG + Intergenic
1007084004 6:39130050-39130072 CACACATGGAAGAGAGGAAAAGG + Intergenic
1007250563 6:40492238-40492260 CACCCTTGGGACTCAGGGGAGGG - Intronic
1012141811 6:95634906-95634928 TACCCTTGGAAGTGGGCAAAAGG - Intergenic
1013461111 6:110376412-110376434 CAACCTAGGAAGACAGGAATGGG + Intergenic
1015384637 6:132607853-132607875 CATTCTAGGAATTCAGGAAAAGG - Intergenic
1017491810 6:154951891-154951913 CAACTTTGGAAGGAAGGAAAAGG - Intronic
1019459757 7:1151269-1151291 GCCCCTTGGAGGTCAGGAACGGG + Intergenic
1021518331 7:21511314-21511336 CACCTTTGAAAATCTGGAAATGG + Exonic
1029120383 7:98263814-98263836 CACCCTTTGACCTCTGGAAACGG - Intronic
1029306478 7:99623596-99623618 CATCCTTGGAGAACAGGAAAAGG - Intronic
1029448105 7:100626121-100626143 AACCCTTTGATGTCAAGAAATGG - Intronic
1031300371 7:120056411-120056433 CCCCCCGGGAATTCAGGAAATGG - Intergenic
1033058978 7:138087156-138087178 CACCCTTGGAAGTGAGAGACTGG - Intronic
1035690287 8:1555404-1555426 CAGGCTTTGCAGTCAGGAAATGG - Intronic
1035891856 8:3353431-3353453 CAGCTTTGGAAATAAGGAAAAGG - Intronic
1039437913 8:37573372-37573394 ACCCCCTGGAAGTCAGGAGAAGG - Intergenic
1040882561 8:52222658-52222680 CACCCTTGGCAGACACCAAAAGG + Intronic
1042257916 8:66825550-66825572 CACTCTAGGAGGTCAGGAGATGG - Intronic
1044985814 8:97755647-97755669 CACCTCAGGAAGTCAGGACATGG + Intergenic
1046505443 8:115131356-115131378 AACCATTGAAAGTCAGGAAAGGG - Intergenic
1047149360 8:122243120-122243142 CTCCCTTGGAAGTTAGGTGATGG + Intergenic
1049472374 8:142782258-142782280 CACCCCTGAAAGGCAGGAAACGG - Intergenic
1055227449 9:74015864-74015886 CACCGGTGGTAGTCAGGTAATGG + Intergenic
1055502540 9:76916053-76916075 GACCCTGGGAACTCTGGAAAAGG + Intergenic
1055649801 9:78396109-78396131 CAGGCTTGGAAGTCTGGGAAGGG + Intergenic
1056339691 9:85613909-85613931 CACCCTTGGATTTTAGGAATAGG - Intronic
1056926089 9:90835569-90835591 CACAGTTGGAAGACGGGAAATGG + Intronic
1059117866 9:111615569-111615591 CACCCTTGTCAGTTAGGGAATGG + Intergenic
1059238564 9:112783627-112783649 CACCCTTGGCAGACAGCAAAAGG - Intronic
1059643750 9:116243548-116243570 CACCCTTTGGGGTCAGGCAAAGG - Intronic
1061009296 9:127945749-127945771 CAGCCCTGGAAGGCAGGAAGGGG + Exonic
1061098494 9:128473951-128473973 CAACCTTGAAAGTCAGGAGAGGG + Intronic
1062148940 9:135007574-135007596 CAACCCCGTAAGTCAGGAAAAGG - Intergenic
1062246979 9:135574202-135574224 AAGCTTTGGAAGTCAAGAAAGGG + Intergenic
1186163417 X:6801994-6802016 CATCATAGGAACTCAGGAAAAGG - Intergenic
1188488084 X:30704868-30704890 CACTCTTGAAAGTCACAAAACGG - Intronic
1189170464 X:38904500-38904522 CCCCCTTGGAAGTCTGGTGAAGG + Intergenic
1189508164 X:41634096-41634118 CTCCCTTGGAAGTGATTAAAAGG - Intronic
1192111921 X:68373607-68373629 CATCCTTGGAAGGGATGAAAAGG + Intronic
1196890043 X:120282953-120282975 CACCCTAGGAGGCCATGAAATGG + Intronic
1198977435 X:142352471-142352493 CAGGCTGGGAAGTGAGGAAAAGG - Intergenic
1200066979 X:153508607-153508629 CACCCTTGGGAGCCAGGGAGAGG - Exonic
1200759966 Y:7028593-7028615 CACTCATGGCAGTCAGAAAAAGG + Intronic
1201858447 Y:18570343-18570365 GCCCCTGGGAATTCAGGAAACGG - Intronic
1201874874 Y:18750038-18750060 GCCCCTGGGAATTCAGGAAACGG + Intronic
1202168625 Y:22017924-22017946 GCCCCTGGGAATTCAGGAAATGG + Intergenic
1202222736 Y:22568444-22568466 GCCCCTGGGAATTCAGGAAATGG - Intergenic
1202320379 Y:23627216-23627238 GCCCCTGGGAATTCAGGAAATGG + Intergenic
1202550388 Y:26042840-26042862 GCCCCTGGGAATTCAGGAAATGG - Intergenic