ID: 901150183

View in Genome Browser
Species Human (GRCh38)
Location 1:7096155-7096177
Sequence TCTAGACCCCCTCCTTCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901150183_901150189 26 Left 901150183 1:7096155-7096177 CCAGTAGAAGGAGGGGGTCTAGA 0: 1
1: 0
2: 1
3: 5
4: 93
Right 901150189 1:7096204-7096226 GAGTTTCAAAAAGACTCCAGTGG 0: 1
1: 0
2: 1
3: 24
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901150183 Original CRISPR TCTAGACCCCCTCCTTCTAC TGG (reversed) Intronic
901001060 1:6149057-6149079 ACTGGATCCCCTCCTTCTCCTGG + Exonic
901150183 1:7096155-7096177 TCTAGACCCCCTCCTTCTACTGG - Intronic
902998920 1:20250418-20250440 TAGAGACCATCTCCTTCTACTGG - Intergenic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
904379089 1:30099410-30099432 TCTTGACCACCTCCTCCTCCTGG + Intergenic
904705490 1:32387181-32387203 TCTAGATCACCTCATTTTACAGG - Intronic
905940418 1:41858832-41858854 ACTAGACCCCCTCCTCATGCAGG - Intronic
906053338 1:42893246-42893268 TCTAGTCCATATCCTTCTACTGG - Intergenic
911787660 1:101970634-101970656 TTTAGATCCTCACCTTCTACTGG + Intronic
912529405 1:110309434-110309456 TCTAGGCTCTCTCCTTCCACAGG - Intergenic
915313044 1:155013897-155013919 TCTAGATCCCCCACTTCTCCAGG - Intronic
916160815 1:161911888-161911910 TCTAGCCCCCATCATTTTACAGG + Intronic
916496547 1:165353111-165353133 TGGAGACCACCTGCTTCTACCGG - Exonic
918130026 1:181619355-181619377 TCTAGACACCCTCCTTCCTCAGG - Intronic
918547450 1:185700923-185700945 GCTATAACCCCACCTTCTACTGG - Intergenic
1068335902 10:55631456-55631478 TGCCGACCTCCTCCTTCTACTGG - Intergenic
1069833850 10:71296556-71296578 TCCTGACCCCCTCCTCCTGCAGG + Exonic
1075455491 10:122582252-122582274 CCTAGACCCCCTCCATATTCAGG - Intronic
1075457614 10:122594955-122594977 CCTAGACCCCCTCCATATTCAGG - Intronic
1076210072 10:128632985-128633007 TGCAGAGTCCCTCCTTCTACTGG - Intergenic
1083327054 11:61878251-61878273 TCCAGGCCACCTCCTTCTCCCGG + Intronic
1087990415 11:104741519-104741541 TCATGCCCCCCTCCTTCAACAGG - Intergenic
1089733743 11:120535422-120535444 TCCCTACCCCCTCCTTTTACAGG - Intronic
1089821665 11:121233849-121233871 TCTATACCCCCTCATTACACTGG + Intergenic
1091912248 12:4242005-4242027 TCTTAACCCCCTCCTTCCACTGG - Intergenic
1093143538 12:15537828-15537850 TCCAGACCCAATCCTTCCACTGG - Intronic
1094333143 12:29318587-29318609 TCTAGACCCTTTCCTGCTCCAGG + Intronic
1095336497 12:41034369-41034391 TCTAGACCTTCTTCTGCTACTGG - Intronic
1096393404 12:51247470-51247492 CCTGCACCCCCTCCTGCTACGGG + Intronic
1097173682 12:57130654-57130676 TCTAGCCACCCTCCTTCAAGGGG - Intronic
1101573450 12:105976281-105976303 TCTACAACCCCTCCTTCATCAGG + Intergenic
1102568273 12:113811486-113811508 CATACAGCCCCTCCTTCTACAGG - Intergenic
1109624562 13:64958213-64958235 TCCAGACCCACTGCTTCAACTGG - Intergenic
1114679909 14:24475601-24475623 TCAAGAACCACTCCTTCTCCAGG + Intergenic
1137645310 16:50068039-50068061 TCTATCCCCCCTCCATCAACTGG - Intronic
1138082890 16:54108510-54108532 TCTAGACAGACTCCTTCTAGGGG - Intronic
1138752634 16:59442232-59442254 TCCTTACCCCCTGCTTCTACAGG - Intergenic
1140753823 16:78049609-78049631 TCTTGACCTGCTCCTTCTCCTGG + Intronic
1141131773 16:81442459-81442481 GCTAAATCTCCTCCTTCTACTGG + Intergenic
1148623640 17:49053140-49053162 TCCTGACCCCCTCCTTCTGGAGG + Exonic
1166269816 19:41707075-41707097 CCTACACCCCCTCCTTCCCCGGG + Intronic
936936755 2:117846458-117846480 TCCAGACCCCATCCTTCCAATGG - Intergenic
940748146 2:157594278-157594300 TCTTGACCTCCTCATTTTACAGG - Intronic
942507762 2:176661545-176661567 TCCAGTCCCTCTCCCTCTACTGG + Intergenic
947610163 2:231520020-231520042 TCTAATCCCCCTCCTCCTCCTGG - Intergenic
1170743898 20:19081424-19081446 TCAAGACCCCCTCTTACTCCTGG + Intergenic
1175489359 20:59369004-59369026 TCTAGACTTCCTCCTGCTCCTGG + Intergenic
1175606403 20:60315411-60315433 TCTACACTCCCTCCTGCCACAGG - Intergenic
1177862274 21:26468517-26468539 TCTCCACCCCCTCCTTATCCTGG - Exonic
1178322739 21:31618001-31618023 TCTAGTCTTCCTCCTACTACAGG + Intergenic
1179078274 21:38144298-38144320 TCCCTACCCCCTCCTTCTAAGGG + Intronic
1180876215 22:19176422-19176444 CCTTGAGCCCCTCCTTCTTCAGG + Exonic
1181456093 22:23061014-23061036 TCCACAGCCCCTCCTTTTACTGG - Intronic
1181744757 22:24948272-24948294 TCCAGACGCCCTCATTTTACAGG - Intergenic
1184016104 22:41786784-41786806 TCTGGATCCCCTCCTTCTTCTGG - Intronic
1184602764 22:45553190-45553212 TCTAGGCCCCCTCCTTCTCCTGG - Intronic
1185204701 22:49531124-49531146 TCCAGACGCCCTCCATCCACAGG - Intronic
949515917 3:4806886-4806908 TCTAGATTCCCTCCAACTACAGG - Intronic
952445011 3:33372588-33372610 TCAAGACCCACTCATTTTACTGG - Intronic
954035967 3:47851390-47851412 TCAAGACCCCTACCTTCTCCAGG + Intronic
955152937 3:56386647-56386669 TCCAGACCCCATACCTCTACTGG + Intronic
956557898 3:70542064-70542086 TCTAGACTCCCTGCTTCTTGGGG - Intergenic
960601343 3:119462048-119462070 ACTAGGGCCCCTCCTTCCACCGG + Exonic
962717036 3:138135333-138135355 ACTAAACTTCCTCCTTCTACAGG + Intergenic
962801484 3:138894639-138894661 TCTAGACCCCTTTCCTCTCCAGG - Intergenic
962898073 3:139733849-139733871 TAAAGACCCCCTCGTTCTGCAGG - Intergenic
968096139 3:195932125-195932147 GAGAGACTCCCTCCTTCTACTGG + Intergenic
977408724 4:96634082-96634104 TCTTGAGCCCCTGCTTCAACTGG - Intergenic
980188206 4:129489782-129489804 TCTAGACACCCCCTTTCTATAGG - Intergenic
981367560 4:143920696-143920718 CCTAGACCCCCACCCTCGACAGG + Intergenic
983804671 4:171979684-171979706 GCTATAGCCCCTCCTTCTTCTGG - Intronic
987950238 5:24665209-24665231 TAAAGAGCCCCTCCTTCTTCTGG - Intergenic
988922647 5:35958389-35958411 TCCTGAGCCCCTCATTCTACTGG + Intronic
989602464 5:43212588-43212610 TCTAGTCCTCCTCCTTTTAGTGG + Intronic
993115235 5:83712614-83712636 TCTGAACACTCTCCTTCTACAGG - Intronic
994381572 5:99078160-99078182 TATAGACACCTTCCTTCTTCTGG - Intergenic
1005447768 6:25942235-25942257 CCTGGACCCCCTCCTTCTCTTGG + Intergenic
1012037925 6:94166305-94166327 TCTTGACTCCCTCCTCCTATAGG - Intergenic
1013769479 6:113611615-113611637 GCTAGATCGCCTCCTTCTGCTGG + Intergenic
1014990438 6:128068404-128068426 AATAGACCGCCTCCTTCTTCTGG + Intronic
1020256387 7:6504823-6504845 TCTCCACCACCTCCTTCTTCCGG + Exonic
1020852612 7:13376533-13376555 TCTAGTCCACCTCCTTCTGAGGG + Intergenic
1020910872 7:14129121-14129143 TCTAGACCTCAGTCTTCTACTGG - Intergenic
1021213473 7:17886215-17886237 TCTATCCCTCCTCCCTCTACAGG + Intronic
1021554792 7:21908403-21908425 TCTAGACCTGCTTCTTCTAGGGG + Exonic
1022096590 7:27145154-27145176 CTTAGACCCCCTCTTTCCACTGG + Intronic
1029663491 7:101979182-101979204 TCTAGAGCACCTCCATCTCCTGG - Intronic
1032362704 7:131271174-131271196 TGTAGGCCCCCTCCTTTTCCTGG - Intronic
1032423738 7:131803533-131803555 TCTGGCCCTCCTCCTTCTCCTGG - Intergenic
1034073115 7:148206979-148207001 TCTACACACTCTCCTTCTACAGG + Intronic
1039256276 8:35722451-35722473 ACTAGACCCCAGCCTTCTCCTGG + Intronic
1040072734 8:43201542-43201564 TTTAAACCCCCTACTTCTAAGGG + Exonic
1052246905 9:26347177-26347199 TCTAGGACCCCACCTTCCACCGG + Intergenic
1052476349 9:28965329-28965351 TCTTGACCCCTTCCTTTTAAAGG + Intergenic
1058869508 9:109190226-109190248 TCTAGCCCCCTGCCTCCTACTGG - Intronic
1059995559 9:119905210-119905232 CCAAGACCCCCTCCCTCTACTGG + Intergenic
1061527733 9:131181207-131181229 TGTAGACACGCTCCTGCTACAGG - Intronic
1061669500 9:132180615-132180637 TGCAGACCCCCTCATTTTACAGG - Intronic
1062718291 9:138022210-138022232 TGGAGAGCCCCTCCCTCTACTGG - Intronic
1192194508 X:69019274-69019296 TGCAGGCCCCTTCCTTCTACTGG - Intergenic