ID: 901151135

View in Genome Browser
Species Human (GRCh38)
Location 1:7102584-7102606
Sequence TGTATGCGCAAGGATGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901151135 Original CRISPR TGTATGCGCAAGGATGGAGG AGG Intronic
900113899 1:1020587-1020609 TGTCTCCGCGAGGAGGGAGGCGG - Intronic
901041854 1:6368741-6368763 TGGCTGTGCAAGGATGGGGGCGG + Intronic
901151135 1:7102584-7102606 TGTATGCGCAAGGATGGAGGAGG + Intronic
901872069 1:12143995-12144017 TGTTTGTGCAAGGATGGAGTGGG + Exonic
904333146 1:29778910-29778932 TGTAGGAGAAAGGATGGAGGTGG + Intergenic
905956950 1:42005091-42005113 TGTATGGGGTAGGGTGGAGGGGG - Intronic
907939751 1:59076169-59076191 GGTATACGCAGAGATGGAGGAGG + Intergenic
908223431 1:62032267-62032289 TGTTTGCTTCAGGATGGAGGGGG - Intronic
908465166 1:64386411-64386433 TGCAGGGGCATGGATGGAGGTGG - Intergenic
909025586 1:70478051-70478073 TGTAAGCACATGGATGAAGGTGG - Intergenic
912423216 1:109562138-109562160 TGTATGCACACGTATGGAGTAGG + Intronic
915751112 1:158212399-158212421 TGGCTGCACAAGGATGGGGGTGG - Intergenic
915989591 1:160500542-160500564 TGGATGTGCAAGGGTGGATGGGG - Intronic
916789603 1:168113679-168113701 TGTAGGGACAAGGATGGAGTTGG + Intronic
921263186 1:213401653-213401675 TGAAGGCCCAAGGAAGGAGGTGG - Intergenic
921332035 1:214049160-214049182 TGTATGGACATGGATGGAGCTGG + Intergenic
1063251016 10:4274893-4274915 TGTAGGCACATGGATGGAGCTGG + Intergenic
1065468330 10:26049482-26049504 TGTATGCTGATGGAAGGAGGAGG + Intronic
1065554230 10:26898779-26898801 TGCAAGGGCATGGATGGAGGTGG + Intergenic
1066492322 10:35905768-35905790 TGTAGGAACAAGGATGGAGCTGG - Intergenic
1070770051 10:79077035-79077057 TGTATGGGGAAGCAGGGAGGTGG + Intronic
1071725100 10:88190723-88190745 TGTATAAACAAGGGTGGAGGAGG - Intergenic
1073027167 10:100496433-100496455 TGTAAGGGCAAGGATGAGGGTGG + Intronic
1077600158 11:3569043-3569065 TGTAGGTGCCAGGATGGAGATGG - Intergenic
1082216281 11:49573682-49573704 TGCATGGGCATGGATGGAGCTGG - Intergenic
1082724826 11:56721995-56722017 TGTATGATTAAGGATAGAGGTGG - Intergenic
1083941117 11:65896498-65896520 GGCAGGAGCAAGGATGGAGGCGG - Intronic
1084256075 11:67943659-67943681 TGTAGGTGCCAGGATGGAGATGG - Intergenic
1087942324 11:104113322-104113344 TGCATTGGCAAGGATGGGGGAGG + Intronic
1088524373 11:110737188-110737210 TGTATGCACAAGGATGGCTGAGG + Intergenic
1089597413 11:119589676-119589698 TGTATGTGCAGGGGTGGGGGTGG - Intergenic
1089651660 11:119918314-119918336 TGTATGCTCTGGGTTGGAGGTGG + Intergenic
1092076451 12:5677620-5677642 GGTATGGTCAGGGATGGAGGTGG - Intronic
1092140323 12:6179215-6179237 TGGATGGGGAAGGAAGGAGGAGG - Intergenic
1092426306 12:8378402-8378424 TGTAGGTGCCAGGATGGAGATGG - Intergenic
1093167507 12:15821938-15821960 TGTATGGGCAACTATGGAGAGGG - Intronic
1094220341 12:27986211-27986233 GGTATGAGCAAGGGTGAAGGTGG - Intergenic
1096478391 12:51922571-51922593 TGTATGCTCACGTATGGAGCAGG + Intronic
1097625607 12:61996465-61996487 TGTGTGTGCAAAGTTGGAGGAGG + Intronic
1098191867 12:67957667-67957689 TCTATGAGCAAGGATCGAGAAGG - Intergenic
1098781300 12:74690175-74690197 TTTGTGGGCAAGGATGAAGGAGG - Intergenic
1100109647 12:91224064-91224086 TGTACGCTCAGGGAAGGAGGAGG + Intergenic
1101641221 12:106586843-106586865 TGCCTGGGCAAGAATGGAGGAGG - Intronic
1109396371 13:61765475-61765497 TGTGTGCGCAAGGAAGCATGGGG + Intergenic
1112414133 13:99190270-99190292 TGTATGCGGAAGGAAGAAGGTGG + Intergenic
1116237842 14:42303499-42303521 TGTATGTGATAGGAAGGAGGGGG + Intergenic
1118282130 14:64439234-64439256 CGTATGAGAGAGGATGGAGGAGG - Intronic
1118985659 14:70752638-70752660 TTTATTCTCCAGGATGGAGGTGG - Intronic
1123725875 15:23101053-23101075 GGTCTGGGAAAGGATGGAGGAGG + Intergenic
1123781491 15:23633200-23633222 GGTATGGGGAAGGATGGAGTTGG + Intergenic
1128870713 15:71153292-71153314 TGTATGCACAAGGAGGCTGGAGG - Intronic
1129460141 15:75696441-75696463 TGTGTGCGCAAGCATGTGGGTGG + Intronic
1129843981 15:78759893-78759915 GGGATGAGCAAGGATGGAGATGG - Intronic
1133372022 16:5252513-5252535 TGTAGGTGCCAGGATGGAGATGG + Intergenic
1133771242 16:8868403-8868425 TGTTTGCGCCCGGATGGGGGTGG - Intronic
1134511866 16:14854984-14855006 GGAATGAGCAAGGAAGGAGGAGG + Intronic
1134699509 16:16253483-16253505 GGAATGAGCAAGGAAGGAGGAGG + Intronic
1134972320 16:18541188-18541210 GGAATGAGCAAGGAAGGAGGAGG - Intronic
1135177442 16:20243034-20243056 AGAATGCACCAGGATGGAGGAGG + Intergenic
1142674320 17:1504263-1504285 GGCATGCGCAAGGCTGGGGGTGG + Intronic
1143687738 17:8532555-8532577 TTGGTGGGCAAGGATGGAGGTGG - Intronic
1143710524 17:8731596-8731618 TGCAGGCACATGGATGGAGGTGG + Intronic
1144998758 17:19288949-19288971 TGTATGGGCAAGGTGGGAGCAGG + Intronic
1146453204 17:32990988-32991010 TGCATGTGCAGGGATGGTGGTGG - Intronic
1146453269 17:32991228-32991250 TGGATGTGCAAGGATGGTAGTGG - Intronic
1147915414 17:43882631-43882653 TTTAGGCAGAAGGATGGAGGAGG - Intronic
1148201632 17:45753426-45753448 CGTGTGCGCATGGATGGGGGAGG + Intergenic
1148201640 17:45753457-45753479 CGTGTGCGCATGGATGGGGGAGG + Intergenic
1150344471 17:64393724-64393746 TGTAGGTGCAAGGAAGGAAGTGG - Intronic
1155178317 18:23321129-23321151 GGTAAGGGCAAGGAAGGAGGAGG - Intronic
1159523420 18:69556428-69556450 ATTATGCACAAGGATGGAGAAGG - Intronic
1161061505 19:2217420-2217442 TGTGTGCACAGGGATGGAGAGGG + Intronic
1161416542 19:4150250-4150272 TGAATGGGGAAGGAGGGAGGAGG + Intergenic
1162192226 19:8955992-8956014 TGTATGCCCCATGGTGGAGGTGG + Exonic
1164496351 19:28767235-28767257 TGCAGGAGCAAGGATGGAGCTGG - Intergenic
1166912965 19:46173956-46173978 TGTCTGGGCAAAGATGGAGCTGG + Intergenic
925261251 2:2530428-2530450 TGTCTGTGCCAGGCTGGAGGAGG - Intergenic
925647430 2:6050991-6051013 TGTAGGAGCATGGATGGAGTTGG + Intergenic
925985567 2:9212315-9212337 TGGATGTGCAAGGGTGCAGGTGG + Intronic
926755211 2:16228943-16228965 TGTATGCAAAAGCATGGAGGTGG - Intergenic
927917734 2:26947527-26947549 TGTAGGGGCAGGGATGGGGGTGG + Exonic
928069871 2:28203940-28203962 AGTATTGGCAAGGATGTAGGAGG - Intronic
930282056 2:49381073-49381095 TGTAGGGACATGGATGGAGGTGG - Intergenic
932224450 2:70028723-70028745 TACATGCGCAAGGGAGGAGGGGG - Intergenic
935836213 2:107057121-107057143 TCTATGCACAAGGAGGGAGGAGG + Intergenic
938215232 2:129506289-129506311 AGTATGGGGAAGGATGGATGGGG - Intergenic
938817446 2:134918706-134918728 CGCATGCGCAAGGGCGGAGGCGG + Intronic
939188103 2:138884008-138884030 TGTCTGTGCAAGCCTGGAGGAGG + Intergenic
940215624 2:151300529-151300551 TGAAGGCGCTAGGATGGAGATGG + Intergenic
940607082 2:155939437-155939459 TGTAGGAGCATGGATGGAGCTGG - Intergenic
940775315 2:157877483-157877505 TGTAAGCAAAAGGATGGAGTAGG + Intronic
941678907 2:168374540-168374562 TGTAGGGGCATGGATGAAGGTGG + Intergenic
943152468 2:184132000-184132022 TGTAGGAGCATGGATGGAGCTGG - Intergenic
946649884 2:221880751-221880773 TGTAAGCCCAGTGATGGAGGTGG - Intergenic
948705738 2:239791315-239791337 TGCATGAGCAAGAATGGGGGGGG - Intronic
1168968855 20:1917127-1917149 TGGATGAGAAAGGAGGGAGGTGG + Intronic
1169012426 20:2261488-2261510 TGGATGTGAAAGGAGGGAGGTGG + Intergenic
1170131560 20:13026023-13026045 TGCAGGAGCAGGGATGGAGGTGG - Intronic
1170145842 20:13173545-13173567 TGGATGGGCTAGGCTGGAGGAGG + Intergenic
1174581023 20:51571790-51571812 GGCAAGTGCAAGGATGGAGGAGG + Intergenic
1175460894 20:59151180-59151202 TGGATGCCTAAGGCTGGAGGGGG + Intergenic
1177984623 21:27959141-27959163 TGTATGAACATGGATGGAGCTGG - Intergenic
1178085559 21:29108251-29108273 TGTGTGCGCATGGAGAGAGGGGG - Intronic
1178786323 21:35657026-35657048 TGTATTTGGAGGGATGGAGGTGG - Intronic
1178889924 21:36512730-36512752 TGTATGCACACGGCTGAAGGGGG + Intronic
1179112099 21:38456146-38456168 TGTCTGCTCAGAGATGGAGGAGG - Intronic
1181763147 22:25071932-25071954 TGTATGTGTTAGGATGGGGGTGG + Intronic
1184361331 22:44020672-44020694 TGGTAGGGCAAGGATGGAGGAGG + Intronic
1184846287 22:47089885-47089907 TGTTTGCTCAAGGTTGGTGGTGG + Intronic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
956414987 3:69016194-69016216 TATATGGGCAAGGAGGGAAGAGG + Intergenic
956544138 3:70380838-70380860 TGTATGGGCATGGATGAAGCTGG - Intergenic
957070985 3:75567693-75567715 TGTAGGTGCCAGGATGGAGATGG - Intergenic
958441521 3:94161860-94161882 TGTATGAGCAGGGGTGGAAGGGG - Intergenic
958643413 3:96838194-96838216 TGCATGGACATGGATGGAGGAGG - Intronic
962276384 3:134017795-134017817 TGTATGCAGAGGAATGGAGGGGG - Intronic
962560660 3:136602997-136603019 TGTGTGGGCAGGGAAGGAGGTGG - Intronic
965055682 3:163711657-163711679 TGTATGTGTAAGGATGCATGTGG - Intergenic
966254134 3:177898746-177898768 TTAATGAGCAAGGATGGTGGGGG + Intergenic
966744297 3:183261098-183261120 TGTTTGCTCAAGGAGGAAGGAGG - Intronic
967077740 3:186019749-186019771 TGTAGGCACATGGATGGAGCTGG + Intergenic
967138269 3:186530884-186530906 TGAATGCTCAAGTAGGGAGGTGG - Intergenic
969014587 4:4095384-4095406 TGTAGGTGCCAGGATGGAGATGG - Intergenic
969577701 4:8046242-8046264 TGTGTCCGCAGGGCTGGAGGGGG - Intronic
969739358 4:9013055-9013077 TGTAGGTGCCAGGATGGAGATGG + Intergenic
969798541 4:9544570-9544592 TGTAGGTGCCAGGATGGAGATGG + Intergenic
971403659 4:26300238-26300260 TGTATGGGCAGGGGTGGGGGTGG + Intronic
972801069 4:42476243-42476265 TGTATATGCTAGGAAGGAGGGGG - Intronic
974371653 4:61023846-61023868 TGTAGGGGCATGGATGAAGGTGG + Intergenic
977428230 4:96896942-96896964 TGTGTGTGTTAGGATGGAGGTGG - Intergenic
979428031 4:120592185-120592207 TATATGAACAAGGATGGAGGAGG - Intergenic
984708273 4:182863637-182863659 TGAATGAGCAAAGAAGGAGGTGG - Intergenic
984709317 4:182871882-182871904 TGAATGAGCAAAGACGGAGGGGG - Intergenic
985209313 4:187575109-187575131 TGTATGCAGAAGAATGGAGCTGG + Intergenic
986920246 5:12671595-12671617 TATATACACAAGGGTGGAGGAGG - Intergenic
987369438 5:17179824-17179846 TGTGTTCACAAGGAAGGAGGAGG - Intronic
997817405 5:137032658-137032680 AGTTTGCGGAAGGAAGGAGGTGG + Intronic
998197888 5:140091616-140091638 TATATGTGCAAGGAGGGAAGGGG - Intergenic
999627206 5:153533358-153533380 TGTATCATCTAGGATGGAGGAGG + Intronic
999827596 5:155288877-155288899 TGTAGGGCCAGGGATGGAGGGGG + Intergenic
1000091383 5:157932262-157932284 TGCATGGAGAAGGATGGAGGAGG + Intergenic
1000613703 5:163404630-163404652 TGTGTGTGTAAGGAGGGAGGGGG - Intergenic
1002533123 5:179860569-179860591 GGTAGGCGCAAGGACGCAGGGGG - Exonic
1003081675 6:3026362-3026384 TGTATACACAAAGAAGGAGGAGG + Intergenic
1004471130 6:15930385-15930407 TGTATGCACAAGGATTGAAAGGG + Intergenic
1007216231 6:40241377-40241399 TGCATGAGCATGGATGGAAGAGG + Intergenic
1008590258 6:52986855-52986877 TGGATGGGCAAGGAGGGAGCAGG + Intronic
1008762629 6:54871426-54871448 TGTATGGGCAAGGCTGGGCGTGG + Intronic
1009279502 6:61729173-61729195 TGTAGGCACATGGATGGAGCTGG + Intronic
1009350518 6:62671404-62671426 TGAATGCCCAAGAATGCAGGTGG + Intergenic
1010037000 6:71337481-71337503 TGCAGGGGCATGGATGGAGGTGG + Intergenic
1010614920 6:78000913-78000935 TTTATTCGCAATGTTGGAGGTGG - Intergenic
1011241607 6:85277412-85277434 TGTATGTATAGGGATGGAGGAGG + Intergenic
1015718553 6:136216685-136216707 TGTGGGCGGAAGGATGAAGGAGG - Intergenic
1016817079 6:148312976-148312998 GGGATGTGCAAGGATTGAGGAGG + Intronic
1020761041 7:12269031-12269053 TGGCTGTGCAAGGATGGGGGTGG - Intergenic
1023303742 7:38801315-38801337 TGTGTGCTCAAAAATGGAGGGGG + Intronic
1023847954 7:44133575-44133597 TGTTGGGGCAGGGATGGAGGAGG + Intergenic
1024211835 7:47212867-47212889 TGTTTGACCTAGGATGGAGGAGG - Intergenic
1026899510 7:74029036-74029058 TGTATGCGTATGTTTGGAGGAGG + Intronic
1028354161 7:89886310-89886332 TGTATGGACATGGATGGAGCTGG - Intergenic
1029073267 7:97917015-97917037 TGTAGGTGCCAGGATGGAGATGG - Intergenic
1029210110 7:98900908-98900930 TGTATGCCAAGGAATGGAGGTGG - Intronic
1029522178 7:101069997-101070019 TGAGTGGGCAACGATGGAGGCGG - Intergenic
1035421026 7:158729332-158729354 TGGATGTGCAAGCGTGGAGGTGG + Intergenic
1036244424 8:7104282-7104304 TGTAGGTGCCAGGATGGAGATGG + Intergenic
1036256318 8:7209461-7209483 TGTAGGTGCCAGGATGGAGATGG - Intergenic
1036308369 8:7668045-7668067 TGTAGGTGCCAGGATGGAGATGG - Intergenic
1036537512 8:9664452-9664474 TGGATGCCCAATGTTGGAGGTGG - Intronic
1036889806 8:12588968-12588990 TGTAGGTGCCAGGATGGAGATGG - Intergenic
1036897409 8:12647121-12647143 TGTAGGTGCCAGGATGGAGATGG - Intergenic
1037530481 8:19767926-19767948 TCTTTCCCCAAGGATGGAGGAGG + Intergenic
1042006641 8:64187506-64187528 TGTAGGAGCATGGATGGAGCTGG + Intergenic
1042121159 8:65489960-65489982 TGTGTGCGCCAGGAATGAGGTGG - Intergenic
1043034517 8:75179198-75179220 TGTCTGGGCACGGATGGAGAGGG - Intergenic
1044579528 8:93810979-93811001 TGTATGAGTAAGAATGGAAGTGG + Intronic
1046953149 8:120037158-120037180 TGCATGGGGAAGGATGGAAGAGG + Intronic
1049163372 8:141111750-141111772 TGGAGGCACAAGGATGGACGAGG - Intergenic
1049936229 9:504245-504267 TGTGTGTGCGAGGATGGACGTGG + Intronic
1051835990 9:21338202-21338224 TGAAGGCCCAAGGATGGATGAGG + Intergenic
1053192649 9:36086005-36086027 TGTATTGGCAAAGATGGAGACGG - Intronic
1057374456 9:94506583-94506605 TGTAGGGACATGGATGGAGGTGG + Intergenic
1058211008 9:102170094-102170116 TGTAGGGGCAAGGATGAAGCTGG - Intergenic
1061325435 9:129861132-129861154 TATATGGGCAAGGAAGGATGGGG + Intronic
1061385056 9:130284837-130284859 CGAGTGGGCAAGGATGGAGGGGG - Intronic
1061738854 9:132684431-132684453 TGGAGGGGCAAGGATGGAAGTGG - Intronic
1186135039 X:6510601-6510623 TGCAGGAACAAGGATGGAGGAGG + Intergenic
1186876170 X:13820299-13820321 TGTATGAGTAGGGGTGGAGGAGG + Intronic
1188255996 X:27962296-27962318 TGTCTGGGCAAGGATGATGGAGG + Intergenic
1191708283 X:64117204-64117226 TGTAGGGACATGGATGGAGGTGG - Intergenic
1193460206 X:81782031-81782053 TTTATGCTCAAAGTTGGAGGTGG + Intergenic
1195667065 X:107441089-107441111 GGTATGGGCAAGGAAGAAGGAGG + Intergenic
1197273353 X:124449892-124449914 TGTATGCTCAAGGTGGGTGGAGG + Intronic
1197552473 X:127910083-127910105 TGTATGAACATGGATGGAGCTGG + Intergenic
1199723047 X:150556900-150556922 TGTATGGAAATGGATGGAGGAGG + Intergenic