ID: 901153765

View in Genome Browser
Species Human (GRCh38)
Location 1:7122067-7122089
Sequence GAACACTCCATGGCCTTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901153765_901153772 8 Left 901153765 1:7122067-7122089 CCGGGAAAGGCCATGGAGTGTTC 0: 1
1: 0
2: 1
3: 19
4: 160
Right 901153772 1:7122098-7122120 GTGAGTGTCCGAGGGGAAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 175
901153765_901153771 1 Left 901153765 1:7122067-7122089 CCGGGAAAGGCCATGGAGTGTTC 0: 1
1: 0
2: 1
3: 19
4: 160
Right 901153771 1:7122091-7122113 GGGCTCTGTGAGTGTCCGAGGGG 0: 1
1: 0
2: 1
3: 9
4: 198
901153765_901153770 0 Left 901153765 1:7122067-7122089 CCGGGAAAGGCCATGGAGTGTTC 0: 1
1: 0
2: 1
3: 19
4: 160
Right 901153770 1:7122090-7122112 TGGGCTCTGTGAGTGTCCGAGGG 0: 1
1: 0
2: 0
3: 12
4: 148
901153765_901153773 11 Left 901153765 1:7122067-7122089 CCGGGAAAGGCCATGGAGTGTTC 0: 1
1: 0
2: 1
3: 19
4: 160
Right 901153773 1:7122101-7122123 AGTGTCCGAGGGGAAGCTGGTGG 0: 1
1: 0
2: 0
3: 13
4: 211
901153765_901153769 -1 Left 901153765 1:7122067-7122089 CCGGGAAAGGCCATGGAGTGTTC 0: 1
1: 0
2: 1
3: 19
4: 160
Right 901153769 1:7122089-7122111 CTGGGCTCTGTGAGTGTCCGAGG 0: 1
1: 0
2: 1
3: 31
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901153765 Original CRISPR GAACACTCCATGGCCTTTCC CGG (reversed) Intronic
900873319 1:5322069-5322091 GAACAATGCATGGCTCTTCCTGG - Intergenic
901153765 1:7122067-7122089 GAACACTCCATGGCCTTTCCCGG - Intronic
904212270 1:28893783-28893805 GATGGCTCCATGGCCTCTCCTGG + Intronic
904565545 1:31426119-31426141 GACCCCTCCAAGGCCTCTCCAGG - Intronic
905460659 1:38120796-38120818 GCACACGCCATGCCCTTTGCTGG + Intergenic
906386164 1:45370359-45370381 TAACAATCAATGGCATTTCCTGG - Intronic
907058128 1:51391294-51391316 TCACACACCATGGCCTTTCGTGG + Intronic
908598056 1:65709476-65709498 GAACATTCTGTGGACTTTCCTGG - Intergenic
911780895 1:101876772-101876794 GAAGACTGCATGGTTTTTCCAGG + Intronic
913314954 1:117541721-117541743 GAATACTCCTTGGCCTCTCCAGG + Intergenic
913528264 1:119713720-119713742 GGACACCCCACTGCCTTTCCTGG - Intronic
914705423 1:150166186-150166208 GATCTCTGCATTGCCTTTCCTGG - Intergenic
918067727 1:181112896-181112918 GTCAACCCCATGGCCTTTCCCGG + Intergenic
921302575 1:213764979-213765001 CCATTCTCCATGGCCTTTCCAGG + Intergenic
922088420 1:222372638-222372660 ATACATTCCATGGCTTTTCCGGG - Intergenic
922798979 1:228355490-228355512 ACACACTCCATGGTCTCTCCAGG - Intronic
1063880983 10:10531883-10531905 GAACAGGCCCTGGCCTGTCCTGG + Intergenic
1065917272 10:30364561-30364583 CAACCCTCCCTGGCCTCTCCTGG + Intronic
1066584714 10:36919658-36919680 TCACACCCCAGGGCCTTTCCTGG - Intergenic
1067228448 10:44390413-44390435 GAAGCCTCCATGCCCTCTCCAGG + Intergenic
1067414837 10:46095329-46095351 GATCACTCCAGGGCATGTCCAGG + Intergenic
1067434885 10:46269910-46269932 GATCACTCCAGGGCATGTCCAGG + Intergenic
1069480987 10:68781882-68781904 GAACACTCCAAGGCCATTTTGGG - Intronic
1070997668 10:80800179-80800201 GATCACTCCACGGGCTTTTCTGG + Intergenic
1072408504 10:95177476-95177498 GAAAACTTTATGGCCTTTGCTGG - Intergenic
1075718309 10:124569835-124569857 GTACACTTGATGTCCTTTCCTGG - Intronic
1076469245 10:130707209-130707231 TAATACTCCATGGCATTTCCGGG - Intergenic
1077007644 11:365994-366016 AAACACTCCAGGGCTTTCCCAGG - Intergenic
1077708492 11:4512155-4512177 GAACATTCTCTGGCCTTTCCTGG + Intergenic
1080126654 11:28742887-28742909 GAAGACTCCACCGCCTTTCAAGG - Intergenic
1084672238 11:70614147-70614169 TGACACTCCTTGGCCTTCCCTGG - Intronic
1085923599 11:80988662-80988684 GAGCAGCCCATGGCCTGTCCAGG + Intergenic
1089068094 11:115677461-115677483 GAACACTGGATGGACTTTCAGGG + Intergenic
1089507338 11:118972310-118972332 GAACATTCCAAGGCCTCTTCTGG + Intronic
1091043378 11:132303318-132303340 GAACCCTCCCTCGCCTCTCCTGG + Intronic
1092332658 12:7600010-7600032 GATGAGTTCATGGCCTTTCCAGG + Intergenic
1100508336 12:95243080-95243102 GAAAACTCCATGGCCAGGCCTGG + Intronic
1101178558 12:102184127-102184149 GAAAACTCTAAGCCCTTTCCCGG - Intronic
1101914751 12:108887428-108887450 GAACTCTTCATGACCCTTCCAGG + Exonic
1104674138 12:130701295-130701317 GAACACTCCAAGGCCTTCCCAGG - Intronic
1105008929 12:132741357-132741379 CAACGCTCCAAGGCCCTTCCCGG + Intronic
1106906138 13:34411283-34411305 AAAGACTCCTTGGCTTTTCCAGG - Intergenic
1107412285 13:40168992-40169014 GGTCATTCCATGTCCTTTCCAGG - Intergenic
1109817272 13:67601847-67601869 GAACACTAGATTACCTTTCCTGG - Intergenic
1111545386 13:89727163-89727185 GAACACTCCATGTCTTTTCATGG + Intergenic
1112414144 13:99190326-99190348 GTACTCTCCATGGCGTTCCCAGG - Intergenic
1112492662 13:99881126-99881148 AGACACTCCATGGCCTTTGATGG - Intronic
1113467305 13:110521193-110521215 GCACTCTCCACGGCCCTTCCTGG - Intergenic
1114444537 14:22778148-22778170 GTGATCTCCATGGCCTTTCCTGG - Intronic
1114600139 14:23949425-23949447 TCACACACCATGGCCTTTTCAGG + Intergenic
1114910735 14:27192591-27192613 GAAAACTTCATGGATTTTCCTGG - Intergenic
1115062667 14:29212402-29212424 AAACACTCCCTAGCATTTCCAGG + Intergenic
1116756693 14:48957628-48957650 GAGCACTCCAAGGCTTCTCCAGG + Intergenic
1118985679 14:70752729-70752751 AAACACTCTATGATCTTTCCAGG - Intronic
1120347605 14:83310016-83310038 AAACACTCCATTGCATTTACTGG - Intergenic
1120745351 14:88146875-88146897 GTACACTCCATGGAGTTCCCTGG + Intergenic
1120775399 14:88430275-88430297 GAACTCTCCATGGCCTTAGCAGG - Intronic
1121038126 14:90723528-90723550 GAACACTCCAAGCTCTTTCCCGG + Intronic
1122151167 14:99726904-99726926 GCGGACTCCATGGCCCTTCCTGG + Exonic
1123137084 14:106038054-106038076 AGCCACTCCAGGGCCTTTCCTGG + Intergenic
1126403486 15:48298931-48298953 GAACACTCTAAGGCCTTTTCTGG + Intronic
1128453287 15:67819571-67819593 GCAAAGTCCATGGCCCTTCCTGG + Intergenic
1128761298 15:70217754-70217776 GAACACTCCAAAGCCCTGCCAGG - Intergenic
1129038740 15:72666256-72666278 GAACCCTCCCTGGCCGCTCCTGG - Exonic
1129211150 15:74070974-74070996 GAACCCTCCCTGGCCGCTCCTGG + Exonic
1129399253 15:75270113-75270135 GAACCCTCCCTGGCCGCTCCTGG - Exonic
1129402860 15:75294389-75294411 GAACCCTCCCTGGCCACTCCTGG - Exonic
1129728283 15:77915248-77915270 GAACCCTCCCTGGCCGCTCCTGG + Intergenic
1130259246 15:82342965-82342987 GAACCCTCCCTGTCCTCTCCCGG + Intronic
1130269430 15:82436200-82436222 GAACCCTCCCTGTCCTCTCCCGG - Intronic
1130275993 15:82476631-82476653 GAACCCTCCCTGTCCTCTCCTGG + Intergenic
1130282019 15:82526218-82526240 GAACCCTCCCTGTCCTCTCCCGG - Intergenic
1130468354 15:84204023-84204045 GAACCCTCCCTGTCCTCTCCTGG + Intergenic
1130473388 15:84242381-84242403 GAACCCTCCCTGTCCTCTCCCGG - Intronic
1130480802 15:84356445-84356467 GAACCCTCCCTGTCCTCTCCCGG - Intergenic
1130485394 15:84395733-84395755 GAACCCTCCCTGTCCTCTCCTGG - Intergenic
1130490910 15:84431314-84431336 GAACCCTCCCTGTCCTCTCCCGG + Intergenic
1130495912 15:84469519-84469541 GAACCCTCCCTGTCCTCTCCTGG - Intergenic
1130502494 15:84510113-84510135 GAACCCTCCCTGTCCTCTCCCGG + Intergenic
1130590647 15:85208621-85208643 GAACCCTCCCTGTCCTCTCCTGG + Intergenic
1130595665 15:85246959-85246981 GAACCCTCCCTGTCCTGTCCCGG - Intergenic
1131188724 15:90295600-90295622 GAACCCTCCCTGGCCTCTCCTGG - Intronic
1133409075 16:5552961-5552983 GATCAGTCCATGTCCTTTACAGG + Intergenic
1133770336 16:8863930-8863952 GGACACTCCAAGGCCATGCCTGG - Intronic
1138791735 16:59912442-59912464 ACTCACTTCATGGCCTTTCCTGG + Intergenic
1140632849 16:76874277-76874299 GAACAGTTCATGTCCTTTGCAGG + Intergenic
1141497089 16:84417787-84417809 GAACACTCTATGGATTTTCCTGG + Intronic
1141859074 16:86704289-86704311 GGGCACTGCATGCCCTTTCCAGG - Intergenic
1148236646 17:45973641-45973663 GCACACTCCCAGGCCTTTCCGGG - Intronic
1151619561 17:75237668-75237690 CATCACTCCGTGGCCATTCCAGG + Exonic
1152200531 17:78943273-78943295 GACCGCTCCATGGCCTTGTCAGG + Intergenic
1157050180 18:44154486-44154508 GAAGATTCCACAGCCTTTCCTGG - Intergenic
1157200565 18:45655721-45655743 GAACTTTCTATGGCCTTTCAGGG + Intronic
1158690267 18:59654147-59654169 GAAAACACCATTGCCTATCCAGG + Intronic
1160403469 18:78628625-78628647 GAAGACCACCTGGCCTTTCCAGG + Intergenic
1160668060 19:342539-342561 AAACCCTCCATGGCTTTTCATGG - Intronic
924962066 2:44921-44943 GAAGACTCCCTGCACTTTCCTGG - Intronic
925104189 2:1275673-1275695 GAACACTTCAAGGCCATTCCAGG - Intronic
927092962 2:19726576-19726598 GAACACCCCAGGGCCTTTGTGGG - Intergenic
927325739 2:21802998-21803020 GAACACTCCATTCCCTCACCTGG + Intergenic
927400159 2:22701928-22701950 AAACCCTCCCTGGCCCTTCCAGG - Intergenic
927808618 2:26169731-26169753 GAATATTCCAGAGCCTTTCCAGG - Intergenic
930572690 2:53107251-53107273 GAACAATCCATATCCTTTGCAGG + Intergenic
931499848 2:62854494-62854516 GAACACTTAGTGGCCTTTGCAGG + Intronic
932347334 2:71004268-71004290 GGACACTCCATGGCCTACTCAGG - Intergenic
932503457 2:72205481-72205503 GAGCATTCCCTGGCCTTTTCTGG - Intronic
933980233 2:87543217-87543239 GAAGAGACCAGGGCCTTTCCAGG + Intergenic
936313593 2:111407574-111407596 GAAGAGACCAGGGCCTTTCCAGG - Intergenic
938026778 2:127956222-127956244 GAAGCTTCCATGGCCTCTCCAGG - Intronic
940770735 2:157836875-157836897 GAACACTCCATCTCCTCTTCTGG + Intronic
940804565 2:158172129-158172151 GTAGACTCCATGTCCTTTCTTGG + Exonic
941368514 2:164636050-164636072 GATCACTCCAGGGCCTCTCTTGG + Intergenic
945598312 2:211824038-211824060 GAACACTCCATGCCCAAGCCTGG - Intronic
945974159 2:216258030-216258052 GAACACCCAGTGGCCTTCCCTGG + Exonic
946026690 2:216676197-216676219 AAACACTCCAGGACCTCTCCCGG - Exonic
947795947 2:232894094-232894116 CAAAACTCCATGGCCTGCCCTGG + Intronic
1169651956 20:7878650-7878672 GAACTCTCCATGGTCATTCCTGG - Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1177024807 21:15908757-15908779 ACTCACTCCATGGCCTTCCCTGG - Intergenic
1179639763 21:42739399-42739421 CCTCACTCCCTGGCCTTTCCAGG - Intronic
1180951212 22:19721432-19721454 TCACATTCCAGGGCCTTTCCAGG - Intronic
1181865683 22:25853021-25853043 GAACACTCCATCGAGTTTCATGG - Intronic
1184094659 22:42310039-42310061 GAAAACTTCATGGCCGCTCCGGG - Intronic
1185212790 22:49581132-49581154 GAAAATTCCATGGGCTTGCCTGG + Intronic
950398145 3:12749822-12749844 GAAGTCTCCATGGCTTTTCCTGG + Exonic
952881417 3:37988271-37988293 AAACTCTCAATGGCCGTTCCCGG - Intronic
952929509 3:38348119-38348141 GAATAGCCCATGGCCTTGCCTGG + Intronic
953547613 3:43875208-43875230 GAATTCTCCTTGGGCTTTCCAGG + Intergenic
957382888 3:79456880-79456902 GAACACAGCAAGACCTTTCCTGG - Intronic
958052885 3:88370527-88370549 GGACACTTCATGGCCTTCCCTGG + Intergenic
960250641 3:115448517-115448539 CCAGACTCCATGGACTTTCCAGG + Intergenic
963467217 3:145698541-145698563 GAACACTGCATGCCCTTGCACGG - Intergenic
970607579 4:17694992-17695014 GAACATTCCAGGGCCTTTGCAGG - Intronic
973837044 4:54819956-54819978 GATCAAGACATGGCCTTTCCAGG - Intergenic
975449816 4:74511300-74511322 TCACACACCAGGGCCTTTCCGGG + Intergenic
977794643 4:101148741-101148763 TTACACTCCTTGTCCTTTCCTGG - Intronic
982349064 4:154394847-154394869 CAAAACTGCATGGCCTTTCCAGG + Intronic
990175848 5:53107537-53107559 AATCAGTACATGGCCTTTCCAGG + Intronic
997691612 5:135831181-135831203 GGACTCCCCCTGGCCTTTCCTGG - Intergenic
1001547645 5:172580335-172580357 GAAGCCTCCAAGGCCTTTCATGG + Intergenic
1002915753 6:1526454-1526476 GGACACCCCAGGGCCTTTCCTGG + Intergenic
1003022138 6:2518951-2518973 GAATACTCTTTTGCCTTTCCTGG + Intergenic
1003251996 6:4436944-4436966 AGACCTTCCATGGCCTTTCCTGG - Intergenic
1003692460 6:8368017-8368039 GAACTATCCCTAGCCTTTCCAGG + Intergenic
1004527986 6:16427090-16427112 GAACTCTCCATGTCCTTGACTGG + Intronic
1007616912 6:43185572-43185594 GAACACTGCATGGCCTTTGAGGG + Exonic
1009504329 6:64455766-64455788 GAAAACTTCATGTCCTTTGCAGG - Intronic
1011481599 6:87799271-87799293 GCAGACTCCATGGCTTTTACAGG + Intergenic
1011496025 6:87937297-87937319 GCACTCTCCAAGGCCATTCCAGG + Intergenic
1012319142 6:97820985-97821007 GAAAACTCTATGGCATGTCCAGG - Intergenic
1017149545 6:151266125-151266147 AAACTCTCCTTGGCCTTGCCAGG + Intronic
1018164096 6:161077586-161077608 GAACAGTTCAAGGCCATTCCAGG + Intronic
1025723692 7:64038401-64038423 GAACACCCCATTGGATTTCCGGG + Intronic
1025752844 7:64308000-64308022 GAACACCCCATTGGATTTCCGGG + Intronic
1025958237 7:66199073-66199095 GGAGTCTCCCTGGCCTTTCCTGG + Intergenic
1037781361 8:21871447-21871469 GATTACTCCATGGCCTTAGCTGG - Intergenic
1038355610 8:26826334-26826356 GGTCACTCCAAGGCCTTTGCAGG - Intronic
1039600942 8:38836750-38836772 GATCACTGCTAGGCCTTTCCTGG + Intronic
1040335913 8:46415880-46415902 GAAGTCCCCATGGCCTTCCCAGG + Intergenic
1040384141 8:46901944-46901966 GCACAGGCCAGGGCCTTTCCAGG + Intergenic
1043582683 8:81732450-81732472 ACACACTCCAGGGCATTTCCTGG - Exonic
1047106600 8:121738305-121738327 GAACAGTTCATGACCTTTTCTGG - Intergenic
1047194377 8:122708154-122708176 GGACACACCATGCCCTTTCAAGG - Intergenic
1047824681 8:128560284-128560306 GAATTCTCCATGGTCTTTTCTGG + Intergenic
1048106369 8:131414846-131414868 GAACACACCACTGGCTTTCCAGG - Intergenic
1049143698 8:140981434-140981456 GAACACACACTGGCCTTTCAAGG + Intronic
1051753201 9:20366209-20366231 TAACACACCAAGGCCTTTCAGGG - Intronic
1051912619 9:22171784-22171806 AAACAGTCAATTGCCTTTCCTGG - Intergenic
1056319757 9:85425091-85425113 GATCCCTCCATGGCTTTTTCTGG - Intergenic
1056842303 9:90008297-90008319 AATCACACCATGGGCTTTCCTGG - Intergenic
1056935722 9:90913739-90913761 GCAGACTCCATGGGCTTTTCAGG + Intergenic
1057012707 9:91619938-91619960 GCACAATCCATGTCCTGTCCTGG + Intronic
1061695396 9:132369574-132369596 AAACACCCCATGGCCTTTGCAGG - Intergenic
1061701765 9:132421543-132421565 GAACACGCCATCCCTTTTCCTGG - Intronic
1189909361 X:45794467-45794489 GAAGTCCCCATGGCCTTCCCTGG - Intergenic
1192880191 X:75274928-75274950 GACAACTCCTTGGCCATTCCAGG + Intronic
1195228502 X:102822653-102822675 TAACACTACATCCCCTTTCCAGG + Intergenic
1195680963 X:107546257-107546279 CACCACTGCATGGCCTTTTCTGG - Intronic
1199366289 X:146988071-146988093 GCAGATTCCATGGCCTTTCATGG + Intergenic
1202367329 Y:24174284-24174306 GAACCCTCCCTGTCCTCTCCTGG - Intergenic
1202503452 Y:25495839-25495861 GAACCCTCCCTGTCCTCTCCTGG + Intergenic