ID: 901154266

View in Genome Browser
Species Human (GRCh38)
Location 1:7124960-7124982
Sequence CGGCACTTAGAGTGGATTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901154266_901154270 12 Left 901154266 1:7124960-7124982 CCTTAAATCCACTCTAAGTGCCG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 901154270 1:7124995-7125017 CCTCCTAGCTGTGAGCACCCAGG 0: 1
1: 0
2: 1
3: 26
4: 234
901154266_901154271 13 Left 901154266 1:7124960-7124982 CCTTAAATCCACTCTAAGTGCCG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 901154271 1:7124996-7125018 CTCCTAGCTGTGAGCACCCAGGG 0: 1
1: 0
2: 2
3: 13
4: 171
901154266_901154273 27 Left 901154266 1:7124960-7124982 CCTTAAATCCACTCTAAGTGCCG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 901154273 1:7125010-7125032 CACCCAGGGAGCTCCGAGCCTGG 0: 1
1: 0
2: 1
3: 34
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901154266 Original CRISPR CGGCACTTAGAGTGGATTTA AGG (reversed) Intronic
901154266 1:7124960-7124982 CGGCACTTAGAGTGGATTTAAGG - Intronic
903080803 1:20810660-20810682 CAGGACTTAGAGATGATTTAGGG - Intronic
921772394 1:219056704-219056726 TGGTACTAAGAGTGGTTTTAGGG + Intergenic
1077630778 11:3809681-3809703 AGGGACTTAGAGTCCATTTAGGG + Intronic
1080123433 11:28703449-28703471 CTGCACTTAGCATGGATTTCAGG + Intergenic
1093515052 12:19975739-19975761 CGGCACATGGAGTGGACTCATGG - Intergenic
1095260226 12:40089686-40089708 CAGCTCTAAGAGTGGATTAACGG + Intronic
1095542859 12:43330574-43330596 AGGCACTGAGAGTGGATGAAGGG - Intergenic
1099575507 12:84374800-84374822 CTGCAGTTAAAGAGGATTTAGGG - Intergenic
1101471383 12:104999900-104999922 GGGCACTGAGAGTGGATGAAGGG - Intronic
1104234218 12:126917397-126917419 CGTCACTGAGAGTGAGTTTAAGG + Intergenic
1107790757 13:43999809-43999831 GGACACTCACAGTGGATTTAGGG - Intergenic
1109655425 13:65384516-65384538 AGGCACTGAGAATGGATTGAGGG - Intergenic
1120758064 14:88262709-88262731 CAGCTGTTATAGTGGATTTATGG - Intronic
1124029271 15:25994835-25994857 AGGGCCTTCGAGTGGATTTAGGG + Intergenic
1124029367 15:25995418-25995440 AGGGCCTTAGAGTGGATTTAGGG + Intergenic
1124795465 15:32774036-32774058 CTGCTCTTAGAGTGGACTTTGGG + Exonic
1126518010 15:49557092-49557114 AGGCACTGAGAGTGGATGGAGGG - Intronic
1129931032 15:79411521-79411543 AGGCACTGAGAGTGGATGGAGGG + Intronic
1131020002 15:89089293-89089315 GGCCACTTAGAGTGCATTTGTGG - Intronic
1133920493 16:10148445-10148467 CGGCATTTAGATAGTATTTAAGG - Intronic
1138268832 16:55680191-55680213 TGGCACAGACAGTGGATTTAAGG + Intronic
1140566619 16:76049666-76049688 AGGCACTGAGAGTGGATGGAGGG - Intergenic
1140581385 16:76235107-76235129 CGGCCCTTGGAGTGGACGTAGGG + Intergenic
1141259834 16:82442571-82442593 TAGCACTTAGAGTGGATATTAGG + Intergenic
1144255395 17:13462627-13462649 CGGCACTTGGAGTGACTTTGGGG - Intergenic
1149357942 17:55863012-55863034 AGGCACTTTCATTGGATTTAGGG - Intergenic
1157863140 18:51159652-51159674 CGGCACTGAGGGTGAATTTCAGG - Intergenic
1162838340 19:13336657-13336679 CAGCACTTACAGAGTATTTATGG + Intronic
1166678522 19:44753930-44753952 TGGCACTCAGAGGGGCTTTACGG + Intronic
929778220 2:44941700-44941722 CTGCACTCACTGTGGATTTAGGG + Intergenic
933555373 2:83824188-83824210 AGGCACTGAGAGTGGATGGAGGG - Intergenic
934099568 2:88640473-88640495 AGGCACTGAGAGTGGATGGAGGG + Intergenic
935492142 2:103734125-103734147 AGGCATTTAGAGTGGATGAAGGG - Intergenic
940888542 2:159012712-159012734 TGTCACTTAGAGTGGATGTTGGG + Intronic
941909087 2:170745061-170745083 CAGCAGTTATATTGGATTTATGG + Intergenic
943092483 2:183390830-183390852 AGGCACTGAGAGTGGATGGAGGG - Intergenic
947662942 2:231883546-231883568 CAGTACTTAGAGGAGATTTATGG + Intergenic
1170246340 20:14225947-14225969 CAGGACTTAGAGTGGTTTCAGGG - Intronic
1175144984 20:56888951-56888973 GGGCACTTAGAGTGGATTTTGGG - Intergenic
1183612027 22:38915357-38915379 CGGCACTGTGACTGGATTTGAGG - Intergenic
949616609 3:5760417-5760439 GGGCACTTAAAGTGTATTTGGGG + Intergenic
964034911 3:152183806-152183828 CGGCACTTTGTATGGATTTGTGG - Intergenic
964062269 3:152538395-152538417 AGGCACTGAGAGTGGATGGAGGG - Intergenic
964272252 3:154969760-154969782 CACCACTTAGAGTGGTTTTGAGG + Intergenic
964638282 3:158881277-158881299 CTGCACCAAGAGTGGATTTGAGG - Intergenic
967992005 3:195138491-195138513 CGGCCCTCAGAGAGGCTTTATGG + Intronic
971708384 4:30078529-30078551 AGGCACTGAGAGTGGATAGAGGG - Intergenic
972215368 4:36891568-36891590 AGGCACTGAGAGTGGATGGAGGG - Intergenic
980148300 4:129015830-129015852 AGGCACTGAGAGTGGATGGAGGG - Intronic
981454179 4:144934097-144934119 AGGCACTGAGAGTGGATGAAGGG - Intergenic
982629831 4:157818922-157818944 AGGCACTGAGAGTGGATGGAGGG + Intergenic
982934148 4:161449569-161449591 GGGCACTTAGAGTAAATTCAAGG - Intronic
984478696 4:180270656-180270678 GGGCACTTATACTGGATTTAGGG - Intergenic
986754756 5:10824590-10824612 AGGCACTGAGAGTGGATGGAGGG - Intergenic
990020810 5:51125107-51125129 GGGCACTTCCAGTGGAATTATGG - Intergenic
990186607 5:53216749-53216771 AGGCACTTGGTGTGGATTTCAGG - Intergenic
990603255 5:57382341-57382363 GGGCACTTTTATTGGATTTAGGG + Intergenic
993263228 5:85688549-85688571 CAGCAATAAGAGTGAATTTATGG - Intergenic
998731798 5:145086031-145086053 TGCCACATAGAGAGGATTTATGG + Intergenic
1004806232 6:19206104-19206126 AGGCACTGAGAGTGGATGGAGGG - Intergenic
1007249546 6:40486447-40486469 CGGCAGTTAGTGGGGCTTTATGG + Intronic
1007353594 6:41293989-41294011 AGGCACTGAGAGTGGATGGAGGG + Intergenic
1015325388 6:131918338-131918360 AGGCACTGAGAGTGGATGGAGGG + Intergenic
1015950613 6:138549061-138549083 GGACACTGTGAGTGGATTTAGGG - Intronic
1017416416 6:154225942-154225964 CGTCACTTAGAGTTCAATTAAGG - Intronic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1032971093 7:137164541-137164563 CGGCCCTTGGAGCGGATGTATGG - Intergenic
1042164712 8:65934331-65934353 CACCAGTTAGATTGGATTTATGG + Intergenic
1043576224 8:81660729-81660751 CGACACTTAAAGTGAAGTTAAGG - Intronic
1045638373 8:104219930-104219952 CAGTACTTAGAATGGAATTAAGG + Intronic
1053274951 9:36776259-36776281 GGGCACTTTGAGTGGACTTCGGG + Intergenic
1055228842 9:74035444-74035466 TGGCAGTTAGATTGGAATTAGGG + Intergenic
1058501317 9:105620661-105620683 TGCCACATAGAGTGGTTTTAAGG + Intronic
1060243602 9:121925766-121925788 CGGCACTTAGGATGGGTTTGTGG + Intronic
1190524205 X:51311579-51311601 AGGCACTGAGAGTGGATGGAGGG - Intergenic
1193799081 X:85913904-85913926 AGGCACTGAGAGTGGATATACGG + Intronic
1195533446 X:105983073-105983095 AGGCACTGAGAGTGGATGGAGGG - Intergenic
1195568368 X:106371559-106371581 AGGCACTGAGAGTGGATGAAGGG + Intergenic
1198837909 X:140823830-140823852 AGGCACTGAGAGTGGATGAAGGG - Intergenic