ID: 901154595

View in Genome Browser
Species Human (GRCh38)
Location 1:7127069-7127091
Sequence CAGGACTGCCACTTCTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901154585_901154595 23 Left 901154585 1:7127023-7127045 CCTCCCAAAGCGCTGGGATTACA 0: 2992
1: 297958
2: 272622
3: 210278
4: 227214
Right 901154595 1:7127069-7127091 CAGGACTGCCACTTCTTTGTAGG 0: 1
1: 0
2: 1
3: 17
4: 173
901154592_901154595 -8 Left 901154592 1:7127054-7127076 CCACTGTGCCGGGTCCAGGACTG 0: 1
1: 0
2: 5
3: 38
4: 464
Right 901154595 1:7127069-7127091 CAGGACTGCCACTTCTTTGTAGG 0: 1
1: 0
2: 1
3: 17
4: 173
901154587_901154595 20 Left 901154587 1:7127026-7127048 CCCAAAGCGCTGGGATTACAGGC 0: 2178
1: 223513
2: 277731
3: 230911
4: 270282
Right 901154595 1:7127069-7127091 CAGGACTGCCACTTCTTTGTAGG 0: 1
1: 0
2: 1
3: 17
4: 173
901154583_901154595 29 Left 901154583 1:7127017-7127039 CCTCAGCCTCCCAAAGCGCTGGG 0: 933
1: 88952
2: 216408
3: 338669
4: 369626
Right 901154595 1:7127069-7127091 CAGGACTGCCACTTCTTTGTAGG 0: 1
1: 0
2: 1
3: 17
4: 173
901154588_901154595 19 Left 901154588 1:7127027-7127049 CCAAAGCGCTGGGATTACAGGCA 0: 1017
1: 94555
2: 237287
3: 301943
4: 261979
Right 901154595 1:7127069-7127091 CAGGACTGCCACTTCTTTGTAGG 0: 1
1: 0
2: 1
3: 17
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901154595 Original CRISPR CAGGACTGCCACTTCTTTGT AGG Intronic
901154595 1:7127069-7127091 CAGGACTGCCACTTCTTTGTAGG + Intronic
901212487 1:7534484-7534506 GAGGACTGCCACTTGTTTACAGG - Intronic
901691449 1:10975977-10975999 CAGGAATGCCGCTTCCTTGTTGG + Intronic
902162529 1:14542918-14542940 CAGGGCTGCCACTTCTGGCTGGG - Intergenic
904087990 1:27923452-27923474 GGGCACTGTCACTTCTTTGTAGG - Intergenic
907495442 1:54841175-54841197 CAGGACTTGCACTTCTTCATTGG - Intronic
908061526 1:60355417-60355439 CAGCATTCCCACTTCTGTGTAGG + Intergenic
910065093 1:83142878-83142900 CAGGACTTTCACTTGTTTCTTGG + Intergenic
910082538 1:83358229-83358251 TAGGACTTCCAATTCTATGTTGG + Intergenic
912008263 1:104930789-104930811 CAGACCTCCCACTTCTTTGATGG - Intergenic
912142016 1:106741817-106741839 CAGGAATCCTTCTTCTTTGTTGG + Intergenic
916265771 1:162888538-162888560 CTGGACTTCCTCTTCTTTTTGGG + Intergenic
916338503 1:163700506-163700528 CAGGGCAGTTACTTCTTTGTAGG + Intergenic
916861127 1:168806630-168806652 CATTATTGCTACTTCTTTGTAGG - Intergenic
919594065 1:199539553-199539575 CAGGAATGCCAGTTATTTGTGGG - Intergenic
921712144 1:218383611-218383633 AAGGACTGCCATTTCTTGCTAGG - Intronic
921893976 1:220379987-220380009 CAGGACAGGCACTCCTGTGTTGG - Intergenic
922207628 1:223462103-223462125 CATGTCTGCCCCTCCTTTGTGGG + Intergenic
922495495 1:226054223-226054245 CAGCACTGCCACTTATTACTAGG - Intergenic
924460251 1:244252828-244252850 CAGGCCTGCTGCTTCCTTGTGGG + Intergenic
1063068460 10:2634602-2634624 AGTGACTGCCACTTCTATGTGGG + Intergenic
1068471080 10:57464683-57464705 CAGCACTCTCACTTCTTGGTAGG - Intergenic
1072899348 10:99393671-99393693 GAGGACTTCCACTTCTTGGTGGG - Exonic
1073525488 10:104177769-104177791 CCTGACTCCCAATTCTTTGTAGG - Intronic
1073552842 10:104419090-104419112 CTTGGCTGCCACTTCTTTCTGGG + Intronic
1075306742 10:121374705-121374727 CCTTACTGCCTCTTCTTTGTGGG + Intergenic
1075540013 10:123304544-123304566 CAGAACTGCCCCCTCTTTTTGGG + Intergenic
1075947519 10:126449509-126449531 TAGGACTTCCACTACTATGTTGG - Intronic
1077116613 11:888008-888030 CAGGACTGCCCCTTCCTGCTTGG - Intronic
1077854614 11:6110616-6110638 CAGTACTGCCACTTCCCAGTGGG - Intergenic
1081721101 11:45288972-45288994 CAGCACTTCCAATTATTTGTGGG - Intergenic
1081835657 11:46151484-46151506 GAGGACTGTCACTCCTTTGATGG - Intergenic
1083614613 11:64020042-64020064 AAGAACTGCAACATCTTTGTGGG - Intronic
1084647644 11:70468409-70468431 CAGGACTGCCCGTGCTTTGTGGG - Intronic
1085691245 11:78665663-78665685 CAGCCTTGCCACTTCTTAGTGGG + Intronic
1086205227 11:84250034-84250056 CAGGACCGCCAGTTCTTTTGAGG + Intronic
1086559965 11:88156043-88156065 CAGGAATGCCAATAATTTGTAGG - Intronic
1089908324 11:122068949-122068971 CAGGACTATGACTTCTGTGTTGG + Intergenic
1091108916 11:132947054-132947076 CAGCTCTGCCACTTGGTTGTAGG + Intronic
1091301267 11:134509682-134509704 CAGCACCGCCACCTCTTTGTGGG + Intergenic
1091922697 12:4318632-4318654 CAGAACAGCCACTTGTATGTTGG + Intergenic
1092666092 12:10800001-10800023 CAATTCTGCCACTTCTTTGGTGG - Intergenic
1093361960 12:18239791-18239813 CAGTGCTTCCACTTGTTTGTAGG + Intronic
1097964874 12:65568158-65568180 CAGGACTGCCACAGCTTTGCTGG - Intergenic
1098357940 12:69628787-69628809 CAGAAATGCCACTTCCTAGTTGG + Intergenic
1098677878 12:73314458-73314480 CAGGAATGCCAATAATTTGTAGG + Intergenic
1101560954 12:105857545-105857567 CAGGAATGACATTTCTATGTGGG - Intergenic
1103360800 12:120352465-120352487 CAGCTCTGCCACTTCCTAGTTGG + Intronic
1104104863 12:125649771-125649793 CAGGACTGCTACTTCTTGAGGGG + Intronic
1104807562 12:131599170-131599192 CAGGACTGGAACTACTCTGTAGG - Intergenic
1108155504 13:47580268-47580290 CAGGAATGCCAATAATTTGTAGG - Intergenic
1108248988 13:48546022-48546044 CAGCACTGCCACTTCATTCATGG + Intergenic
1111272007 13:85897953-85897975 CAGGAATGCCAATAATTTGTAGG - Intergenic
1112078153 13:95935756-95935778 CAGGAATGCCAATAATTTGTAGG + Intronic
1112136648 13:96585943-96585965 CAGGAATCCCACTACTTTGTAGG - Intronic
1113093238 13:106636679-106636701 TAGGACTGTCAGTTCTTTGAGGG + Intergenic
1113882158 13:113633212-113633234 CTCGTCTGCCACTTCGTTGTAGG - Exonic
1120178781 14:81322447-81322469 CAAGAATGCCACTTATTTGGAGG - Intronic
1126361760 15:47853773-47853795 CAGGATTACCTCTTCTTTGTAGG + Intergenic
1129516955 15:76162846-76162868 CAGGTCTGCCAGTTCTTTCCTGG + Intronic
1129639507 15:77360618-77360640 GAGGACTGACTCTTCTTTATAGG + Intronic
1131073443 15:89480099-89480121 CATGGCTGCCAGTTCTTTTTGGG - Intronic
1131624829 15:94106492-94106514 CAGGATTTCCATTTCTTTCTTGG + Intergenic
1132161962 15:99550668-99550690 AAGCACAGCCACTTCCTTGTTGG - Intergenic
1132393251 15:101454039-101454061 CAGCACTGACCCTTCTTTCTGGG - Intronic
1138650856 16:58460525-58460547 CAGGCCTGACACTGCTATGTTGG - Intergenic
1141273649 16:82564401-82564423 TAGGACTTCCACTACTATGTTGG - Intergenic
1141584781 16:85026597-85026619 AAGGACTGCCACTTCTGCTTGGG + Intergenic
1142103768 16:88291127-88291149 CCGGACTGCCCCATCTATGTGGG - Intergenic
1144642385 17:16944740-16944762 CAGAACTGCCACTCCTTAGTGGG - Intronic
1147380568 17:40053257-40053279 CAGAACTCTCACTTCTTGGTGGG + Intronic
1149020926 17:51963281-51963303 CAGGAATGCCAATAATTTGTTGG - Intronic
1149978973 17:61294271-61294293 CAGTACTACCACCTATTTGTGGG - Intronic
1150788924 17:68184478-68184500 CAGGAGTGGGGCTTCTTTGTCGG - Intergenic
1150948177 17:69770454-69770476 CAGGAATGCCAATAATTTGTAGG + Intergenic
1150957300 17:69873285-69873307 CTGGAATGCCACTGCTTTATGGG - Intergenic
1151916318 17:77120813-77120835 CAGGGCTGACATTTCTGTGTTGG - Intronic
1152054902 17:78016956-78016978 CAGCTCTGCCACTTCTTTGCTGG - Intronic
1152993321 18:383079-383101 CAGGACTGCCTGTACTGTGTGGG + Intronic
1155326515 18:24670377-24670399 CAGGCCTTCCATTTCTTTTTAGG + Intergenic
1157940458 18:51922787-51922809 CAGGAATGCCAATAATTTGTAGG - Intergenic
1159905699 18:74089448-74089470 CAGGACTTCCAGTACTATGTTGG + Intronic
1163538284 19:17890961-17890983 CAGGATGGCCACTTCTTCCTTGG - Exonic
926746941 2:16166640-16166662 GAGGGCTGCCTCTTCTTTCTGGG - Intergenic
929255449 2:39806363-39806385 TAGGACTGCCAGTTTTATGTTGG + Intergenic
933941978 2:87252642-87252664 CAGGCCTCCTCCTTCTTTGTTGG + Intergenic
936102743 2:109597753-109597775 CACGTCTGGCACTTCTTTCTAGG - Intronic
936733998 2:115418245-115418267 CAGGCCTTCCACATCTTAGTAGG - Intronic
937201077 2:120204876-120204898 CAGGACTGTGACTTCCTTGAGGG - Intergenic
937722922 2:125125173-125125195 CAGGACTGCCAATTATTCTTAGG + Intergenic
938310649 2:130286366-130286388 CAGGCCTGCCCCTCCTGTGTAGG + Intergenic
938577994 2:132621513-132621535 CAGCACTGCCAGCTCTCTGTGGG + Intronic
943310750 2:186321720-186321742 CAGATCTGACACTTCTTTATTGG - Intergenic
947231218 2:227888564-227888586 CAGGGCTGCCTCTTCTCTGGTGG - Intronic
948960965 2:241336792-241336814 CAGGGCTGCCAATTCTTTTCAGG - Intronic
1169113689 20:3048958-3048980 CATGTCTCCCACTTCTTTGCAGG + Intergenic
1169770427 20:9194170-9194192 AATGATTCCCACTTCTTTGTTGG + Intronic
1170259665 20:14389875-14389897 CAGGACTTCCAGTACTATGTTGG - Intronic
1171419637 20:25009235-25009257 CAGCACAGCCCCATCTTTGTGGG + Intronic
1173196189 20:40914634-40914656 CAGAAATGCCAGTTCTTTGGGGG + Intergenic
1175022641 20:55866885-55866907 CAGGAGTGCCAGTAATTTGTAGG - Intergenic
1176992564 21:15515739-15515761 CAGAACTTTCACCTCTTTGTTGG - Intergenic
1177254064 21:18636470-18636492 CAGGACTTCCAATACTATGTTGG - Intergenic
1183184586 22:36284794-36284816 CAGGACTGAGACTTCCTTGGAGG - Intronic
1183208755 22:36436936-36436958 CAGCACTACCACTTCCTGGTTGG + Intergenic
1184172491 22:42768253-42768275 CAGGACTGGGACATCTTTGGGGG - Intergenic
1184534394 22:45076836-45076858 CAGAACTGTCACTTCCTTTTTGG - Intergenic
949169389 3:980537-980559 CAGGGCTGGGACTTCTGTGTGGG - Intergenic
950435159 3:12974944-12974966 CAGGCCTGCCTCTTCTATCTGGG - Intronic
951471760 3:23064035-23064057 CAGAAATGCTACTTCATTGTTGG - Intergenic
954635756 3:52069948-52069970 CAGGACTGCCTCTGCTTCTTGGG - Intergenic
954833048 3:53439598-53439620 TTTGACTTCCACTTCTTTGTAGG + Intergenic
955781443 3:62489129-62489151 CATGACTGCTACTTCTTTGGGGG - Intronic
956372241 3:68575572-68575594 CAGGACTTCCAATACTATGTTGG - Intergenic
956976984 3:74592202-74592224 CAGGATTGCCACTTCTGTGGTGG + Intergenic
959332977 3:105030120-105030142 CTGGACTACCACTTCTTTCAAGG + Intergenic
961935274 3:130576145-130576167 CGTGATTGCCTCTTCTTTGTAGG + Intronic
962204185 3:133421622-133421644 CAGGACTGCAACTTATCTTTTGG + Intronic
965745544 3:171921217-171921239 CAGGAATGCCAGTTATTTTTGGG - Intronic
965958674 3:174402910-174402932 CAGAACTTCCAATTCTATGTTGG - Intergenic
969856714 4:10005852-10005874 CAGCTCTGCCACTTCTTTGCTGG + Intronic
970057157 4:11988152-11988174 CAGGTCTGCCACCTAGTTGTGGG - Intergenic
971768454 4:30865388-30865410 CAGGATTTCCACTTCATTTTTGG - Intronic
973695320 4:53484854-53484876 GAGGACTCCAACTTCTTTTTTGG - Intronic
979200470 4:117971886-117971908 TAGGACTGCTACTTCTTGATTGG + Intergenic
979381049 4:120007164-120007186 CATTACTGACACTTCTTTGGTGG - Intergenic
980010295 4:127587841-127587863 CAGGAATGCCAATACTTTGTAGG - Intergenic
981577322 4:146218729-146218751 AAGGAAGGCCACTTCTTTGGGGG + Intergenic
982843610 4:160222854-160222876 CAGGAATGCCAATAATTTGTAGG + Intergenic
983097245 4:163577706-163577728 CAGGAATGCCACTAATTTGTAGG + Intronic
988052064 5:26043323-26043345 CAGGACTGCCAATAAGTTGTAGG - Intergenic
988853272 5:35200045-35200067 CAGCACTACCTCTTCTTTCTTGG - Intronic
989195251 5:38709904-38709926 CATGATTGCCACTTATTTGGAGG - Intergenic
989578298 5:43009065-43009087 CAACACTGCAATTTCTTTGTAGG - Intergenic
992487073 5:77207962-77207984 ATTGACTGCAACTTCTTTGTTGG - Intergenic
994048508 5:95335907-95335929 CAAGTCTGTCACTTCTTTTTGGG + Intergenic
994617176 5:102118477-102118499 TAGGACTGCAACATCTTTGGGGG - Intergenic
995779277 5:115758593-115758615 CAGGCCAGCCACGTCTATGTGGG + Intergenic
996127731 5:119745601-119745623 CATCACTGCCACTTCTGTGAAGG - Intergenic
997058695 5:130476012-130476034 CAGGAATGCCAATTATTTTTAGG + Intergenic
997795826 5:136809955-136809977 CAAGACTGCCAGCTCTTTGAGGG - Intergenic
997817335 5:137032087-137032109 CAGGAATGCCATTTCTTTTTTGG + Intronic
999027861 5:148255878-148255900 CAGGACTTCCAATACTGTGTTGG + Intergenic
1002988579 6:2216526-2216548 CTGCACTCACACTTCTTTGTGGG + Intronic
1005075289 6:21901116-21901138 CAGGACTTTCCCTTCTCTGTTGG - Intergenic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1006636993 6:35468219-35468241 CAGGACTGCGACAACTCTGTGGG + Intergenic
1009667286 6:66700405-66700427 CAGAACTTCCTCTTCTTTGGAGG - Intergenic
1010948549 6:82007029-82007051 CAGGAATGCCAATAATTTGTAGG - Intergenic
1013867243 6:114713415-114713437 CAGCACTGCAGCTTCTTTGTAGG - Intergenic
1017086689 6:150719152-150719174 CAGGACTGTCACTTTTCTGGTGG + Intronic
1017355814 6:153506352-153506374 CAGGACTTCAACATCTTTTTAGG + Intergenic
1019383148 7:738848-738870 CAGGACGGCCACCTGTCTGTCGG - Intronic
1022370541 7:29766946-29766968 CAGGACTTCCAATACTATGTTGG - Intergenic
1022645906 7:32228499-32228521 CAGGACTGCCACTTAGTAGCTGG - Intronic
1024929242 7:54652623-54652645 CAGGACTGGCTTTCCTTTGTTGG - Intergenic
1027279014 7:76591870-76591892 CAGGACTTTCACTTGTTTCTTGG - Intergenic
1027299377 7:76814443-76814465 TAGGACTTCCAATTCTATGTTGG + Intergenic
1028628462 7:92905001-92905023 CAAGTCTGCCACTGCTCTGTGGG - Intergenic
1029955810 7:104638408-104638430 CAGGACTTCCAATACTATGTTGG + Intronic
1030111215 7:106028652-106028674 CAGGCCTGCCACAGCCTTGTGGG + Intronic
1031465551 7:122106231-122106253 CAGGACTTCCAATACTATGTTGG + Intronic
1035159792 7:156942486-156942508 CAGGACTTCTAATACTTTGTGGG - Intergenic
1035232402 7:157473579-157473601 CAGAACTCCCCCTTCTTTGAGGG + Intergenic
1038973246 8:32661601-32661623 CAGGAATGCCACTTCATTTAGGG + Intronic
1039188571 8:34946022-34946044 CAGGTCTGCCACTTTTTTTCTGG - Intergenic
1041230227 8:55743004-55743026 CAGCTCTGGCACTTCTTCGTTGG + Intronic
1041519541 8:58740236-58740258 CAAGACTGTAAATTCTTTGTAGG + Intergenic
1041698572 8:60763041-60763063 CATGACTCCCATTTCTTTGCTGG - Intronic
1044315816 8:90749294-90749316 CAGGAATGCCAATAATTTGTAGG + Intronic
1044351132 8:91167745-91167767 CAGAACTGGCTCTTCTGTGTTGG + Intronic
1046350847 8:113009312-113009334 CAGGACTGTGAGTTCTTTCTAGG - Intronic
1046355073 8:113072311-113072333 AAGGACTTCCAGTACTTTGTGGG + Intronic
1049343841 8:142128098-142128120 CAGGATTGCCCCATCTTAGTCGG - Intergenic
1049984505 9:936267-936289 GAGGTCTGCCCCTTCTTGGTAGG + Intronic
1050324442 9:4486263-4486285 AGGAACTTCCACTTCTTTGTGGG - Intergenic
1051253857 9:15191650-15191672 CAGCACTACCACTTCTCTCTGGG + Intronic
1052620436 9:30901638-30901660 AAGGACTCCAACATCTTTGTTGG + Intergenic
1053425375 9:38006703-38006725 CAGGACTGCAATCTGTTTGTTGG + Intronic
1055372998 9:75620371-75620393 CAGGACTTCCAATACTATGTTGG + Intergenic
1188805881 X:34589523-34589545 CAGGAATGCCAATAATTTGTAGG + Intergenic
1189248441 X:39581295-39581317 CAGGACTCCCAGTTTTCTGTGGG - Intergenic
1191152844 X:57239663-57239685 CAGGAATGCCAATTCTTTGTAGG + Intergenic
1191908682 X:66123911-66123933 CAGGAATTTCACTTCTTTCTGGG + Intergenic
1192904690 X:75538521-75538543 GAGGACTGCTGCTTCTTTTTCGG + Intergenic
1194350688 X:92822084-92822106 CATGACTGCCACTTCATACTTGG - Intergenic
1195627139 X:107015779-107015801 CAGGAGAGCCACCTCTTAGTTGG - Intergenic
1196220026 X:113103031-113103053 CAGGAATGCCAATAATTTGTAGG + Intergenic
1196763982 X:119226352-119226374 ACTGCCTGCCACTTCTTTGTTGG + Intergenic
1199171006 X:144734249-144734271 CTGGACTTCAACTTCATTGTCGG + Intergenic
1200659018 Y:5938764-5938786 CATGACTGCCACTTCATACTTGG - Intergenic
1202129890 Y:21600079-21600101 CAGGCCTGCCTAGTCTTTGTAGG - Intergenic