ID: 901155454

View in Genome Browser
Species Human (GRCh38)
Location 1:7134549-7134571
Sequence CTTTGGAAGGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901155454_901155460 -8 Left 901155454 1:7134549-7134571 CCTTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 901155460 1:7134564-7134586 TTCCAAAGTGTTGGGATTATAGG 0: 143
1: 4739
2: 65111
3: 352379
4: 236116
901155454_901155462 11 Left 901155454 1:7134549-7134571 CCTTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 901155462 1:7134583-7134605 TAGGACTGAGCCACCATGCCTGG 0: 1
1: 120
2: 3831
3: 35100
4: 104052

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901155454 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr