ID: 901157231

View in Genome Browser
Species Human (GRCh38)
Location 1:7149011-7149033
Sequence GCCCTGTGGGCACATTCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901157227_901157231 -3 Left 901157227 1:7148991-7149013 CCAGTGGAGTGGGGCTTCCTGCC 0: 1
1: 0
2: 2
3: 22
4: 260
Right 901157231 1:7149011-7149033 GCCCTGTGGGCACATTCCCGAGG 0: 1
1: 0
2: 0
3: 9
4: 134
901157222_901157231 28 Left 901157222 1:7148960-7148982 CCTTGCTGGCAGCTGTCAGGGGT 0: 1
1: 0
2: 5
3: 26
4: 295
Right 901157231 1:7149011-7149033 GCCCTGTGGGCACATTCCCGAGG 0: 1
1: 0
2: 0
3: 9
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901157231 Original CRISPR GCCCTGTGGGCACATTCCCG AGG Intronic
901157231 1:7149011-7149033 GCCCTGTGGGCACATTCCCGAGG + Intronic
901196685 1:7444217-7444239 GCCCTGAGGCCACACTCCAGAGG - Intronic
902465994 1:16619175-16619197 CCCCAGTGGGCACATTTCCTAGG - Intergenic
902508697 1:16954129-16954151 CCCCAGTGGGCACATTTCCTAGG + Intronic
902708272 1:18221452-18221474 GCCCTCTGGACACATCCCCTTGG + Intronic
905262621 1:36730348-36730370 GCTTTGTGGGCACCTTCCGGAGG + Intergenic
906149764 1:43580890-43580912 GGCCTATGGGCACATTTCCCAGG + Intronic
906237624 1:44221413-44221435 GCCCTGTGGGCTCATGCCCTTGG - Exonic
907188408 1:52629572-52629594 GCCCAGTGACCACAATCCCGGGG - Intergenic
908316296 1:62936144-62936166 GCCATGTGGGCACCTGCCAGTGG - Intergenic
912002825 1:104856357-104856379 GGTCTGTGGGCACAGGCCCGAGG + Intergenic
915323571 1:155069382-155069404 GCCCTGTGGGCCTTTTCCCTGGG + Exonic
921991612 1:221372964-221372986 GGTCTGTGGGCACAGGCCCGAGG + Intergenic
924032210 1:239897077-239897099 GCCACGTGGGCACATTGCCTAGG - Intronic
924384824 1:243490858-243490880 GCCCTGTGGGCAGGTCCCCAGGG + Intronic
1071867103 10:89746655-89746677 ACTCTGTGGGCACAGGCCCGAGG + Intronic
1073483081 10:103799125-103799147 GCACTGGGGGCACATTCCCTGGG - Intronic
1075263470 10:120981798-120981820 TCCCTGTGGGAAAATTCCCCAGG + Intergenic
1075871377 10:125774305-125774327 GGCCTGGGGGCCCAGTCCCGAGG - Exonic
1076704014 10:132291414-132291436 GCCCTGTGGACACCTCCTCGTGG + Intronic
1076722899 10:132400470-132400492 ACCCTGTGGGCACCTGCCCCAGG - Intronic
1077061874 11:621088-621110 GCCCCGTGGGGACAGCCCCGTGG + Exonic
1077412810 11:2411286-2411308 GCCCTGTGTGCACAAGCCCTGGG - Intronic
1078113989 11:8426475-8426497 GGTCTGTGGGCACATGCCTGGGG + Intronic
1084474500 11:69381115-69381137 AGCCAGTGGGCACATTCCTGGGG + Intergenic
1084648552 11:70474699-70474721 GCCTTTTGGGCCCATTCACGTGG + Intronic
1089458340 11:118638713-118638735 GCCATGTGGGCTCCTTCCCTCGG - Intronic
1089678337 11:120105519-120105541 GCCCTGTGTCCACACTTCCGAGG - Intergenic
1090081878 11:123618902-123618924 TCCCTGTGGGCTCATCCCAGAGG - Intronic
1101379896 12:104205375-104205397 GGCCTGTGGGCACAGGCCTGAGG + Intergenic
1102019443 12:109671539-109671561 GCCCTGTGGGGAGATCCACGTGG + Intergenic
1103134861 12:118498542-118498564 TCCGTGTGTGCACATCCCCGGGG + Intergenic
1104358023 12:128105710-128105732 TCCCCGTGGGCGCATCCCCGTGG - Intergenic
1112814188 13:103252478-103252500 GGCCTGTGGGCACAGGCCTGTGG + Intergenic
1115514609 14:34173144-34173166 GCTCTGTGGACACCTTCCAGAGG + Intronic
1119189982 14:72674702-72674724 GCCCTGTGGGCCCAGGCCCCAGG + Intronic
1119782249 14:77284298-77284320 GCCCTGTGGACATATTGGCGAGG - Intronic
1119893863 14:78203141-78203163 GCCCCCAGGGCACATTCCCAGGG - Intergenic
1120211958 14:81641990-81642012 GGTCTGTGGGCACAGGCCCGAGG + Intergenic
1121623957 14:95371284-95371306 GCCCTGTAGGCACTGCCCCGGGG - Intergenic
1122467886 14:101946750-101946772 GCTCTGTGGGAACATTGCCCAGG + Intergenic
1122663355 14:103312310-103312332 GCCCTGTGGGCCCTTTCCTCAGG + Intergenic
1123033096 14:105460357-105460379 GCTCTGTGGGCACCTTCGCACGG + Exonic
1124188491 15:27550900-27550922 GCCCTGGAGTCACACTCCCGGGG - Intergenic
1124477244 15:30045464-30045486 GCCCTCTGGGCACAGGCACGTGG - Intergenic
1126967092 15:54066549-54066571 GCCCTGTGGCCACCTTGCAGTGG - Intronic
1131643084 15:94313365-94313387 GCCCTGTGGACTCATTTCCTGGG + Intronic
1132522692 16:398779-398801 GCCCTGGGGACACATTGCCTTGG + Intronic
1132845211 16:1998062-1998084 GCCCTGTTGGCACACTCAAGCGG - Exonic
1132877738 16:2147952-2147974 ACCCTGAGGGCAGAGTCCCGTGG + Intronic
1140616861 16:76675508-76675530 GCCCTCTAGTCACATTCCCCTGG + Intergenic
1142259237 16:89034870-89034892 GCCCTGTGGCCACTTTCTCCAGG - Intergenic
1142571529 17:878037-878059 GCCCTGGGGGCACAGTCTGGAGG + Intronic
1147722228 17:42546475-42546497 GCCCCCTGGGCAGATTCCCCTGG - Intergenic
1147723412 17:42552645-42552667 GCCCCCTGGGCAGATTCCCCTGG - Exonic
1152076214 17:78161454-78161476 GCCCTGAGGGCACAGTCTCCTGG + Intronic
1152721112 17:81924209-81924231 GCCCTGTGGGCACTCACCCGGGG - Intronic
1152920333 17:83063378-83063400 GCCCTGTTAGCACATGCCCCAGG + Intergenic
1154070540 18:11148739-11148761 GCCCCGAGGGCACGCTCCCGGGG + Intronic
1156470037 18:37371701-37371723 GCCCTGTGGTCACATTCACAGGG - Intronic
1157898466 18:51490829-51490851 GCCACGTGGACACATTCCCTGGG - Intergenic
1159122919 18:64191223-64191245 GCCCTGTGGGCAGAGTCTGGAGG - Intergenic
1160924609 19:1537646-1537668 GGCCTGGTGGCACATGCCCGTGG + Intergenic
1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG + Intronic
1165626264 19:37280731-37280753 GCTCTGCGGGCACCTTCCTGCGG + Intergenic
925120574 2:1415254-1415276 GGCCTCTGGACACAGTCCCGGGG + Intronic
925713862 2:6767560-6767582 ACCCTCTGGGAACATTCCCCAGG + Intergenic
931254001 2:60554717-60554739 GCGCCGTGAGCACATTCCCAGGG - Intergenic
938796169 2:134719336-134719358 CCCCTCTGGGCACCATCCCGCGG - Intergenic
943864525 2:192912782-192912804 CCCCTGTGGCCACAGTCCCTAGG - Intergenic
945225658 2:207529641-207529663 GCCCAGTGGGGGAATTCCCGAGG - Intergenic
1169512053 20:6275089-6275111 TCCCAGAGGGCACATTCCCTTGG + Intergenic
1170215138 20:13883565-13883587 CTCCTGTGGGCTCATTCACGAGG - Intronic
1170938996 20:20833202-20833224 GACCAGTGGGCACAGTCCTGGGG - Intergenic
1171491167 20:25518375-25518397 GCCCTATTGGCACATTCCCTTGG + Intronic
1172474354 20:35226378-35226400 GCCCTGGGGGAACATATCCGGGG - Intergenic
1173728526 20:45313149-45313171 GGCCTGTGGGCACATTAGCCAGG + Intronic
1174163801 20:48570527-48570549 GCGCTGTGAGCCCATTCCTGAGG + Intergenic
1175721375 20:61289551-61289573 GGCCTGTGGTCACACTCCCCAGG - Intronic
1179732087 21:43373715-43373737 GCCCTGTGGGCCCAGGCCTGAGG - Intergenic
1180137265 21:45869720-45869742 GCCCTGGGGTCACACTCCCCAGG - Intronic
1180151568 21:45950815-45950837 GCCCTGTTGGCACTGCCCCGTGG + Intergenic
1182276884 22:29195477-29195499 GCCCTGGTGGGACATTCCCAGGG - Intergenic
1182446247 22:30391289-30391311 CCCATGTGGCCACATTCCCCAGG - Intronic
1184860614 22:47171433-47171455 CCCCTGGGGGCAAATTCTCGAGG + Intronic
1185053918 22:48568131-48568153 GCCCTGTGGGCTCAGTCACACGG - Intronic
950081051 3:10222387-10222409 GCACTTTGGCCACATTCCTGGGG + Intronic
950103102 3:10370268-10370290 GCCATGTGGGCACAGCCCTGTGG - Intronic
951549328 3:23861468-23861490 GGTCTGTGGGCACAGGCCCGGGG - Intronic
952738907 3:36716749-36716771 GCTCTGGGGGCACATCCCCTAGG + Intronic
954412699 3:50377943-50377965 ACCCTGTGGGCACATCTCCGGGG + Intronic
962808486 3:138943290-138943312 GGCCTGCAGGCTCATTCCCGTGG + Intergenic
963067575 3:141275460-141275482 TGCCTGTGGGCACACTCCCTTGG - Intronic
963300279 3:143589842-143589864 TCTCTGTGAGCACATTCCGGTGG - Intronic
965783041 3:172308053-172308075 GCCCTTTTGGCACATTTCAGTGG + Intronic
966196904 3:177322876-177322898 TACATGTCGGCACATTCCCGGGG + Intergenic
967408029 3:189138901-189138923 GCCCTGTGGCCACACTCCTTGGG + Intronic
968886830 4:3339340-3339362 GGCCTGTTGGCACATGCCTGTGG + Intronic
969520502 4:7675357-7675379 GCCCTGGGGGCACAGTCTGGAGG - Intronic
972699936 4:41483906-41483928 ACTCTGTAGGCACATTCCCTGGG + Intronic
974962895 4:68725369-68725391 GGTCTGTGGGCACATGCCCGAGG + Intergenic
980438246 4:132809246-132809268 GGTCTGTGGGCACAGGCCCGAGG - Intergenic
983588674 4:169383388-169383410 GGCCCGTGGGCACAGGCCCGAGG + Intergenic
985205397 4:187530180-187530202 GTCCTGTGGGCACACTGCCCTGG - Intergenic
985725231 5:1512607-1512629 GCCCTGTGGGCTGACTCCCTCGG + Intronic
992904567 5:81333829-81333851 GGTCTGTGGGCACAGGCCCGAGG - Intronic
993188042 5:84645625-84645647 GGTCTGTGGGCACAGGCCCGAGG - Intergenic
998521626 5:142806230-142806252 GGCCTGGTGGCACATGCCCGTGG - Intronic
999367974 5:151035198-151035220 GCCCTCAGGGCCCTTTCCCGGGG - Intronic
999718183 5:154378965-154378987 GCCTTGTGGACAGATTCCCTGGG - Intronic
1002468074 5:179417756-179417778 GTCCTCTGGGCACCTTCCTGAGG - Intergenic
1003499838 6:6695144-6695166 GGTCTGTGGGCACAGGCCCGGGG + Intergenic
1003500764 6:6701055-6701077 GCAATGTGGGCACATACCCTGGG - Intergenic
1004746132 6:18510917-18510939 GGTCTGTGGGCACAAGCCCGAGG - Intergenic
1005561982 6:27050021-27050043 GGTCTGTGGGCACAGGCCCGGGG - Intergenic
1006780835 6:36631308-36631330 GCCCTGTGAGGACATTCCTCTGG + Intergenic
1007376753 6:41462187-41462209 GCTCTGTGGGCAGATTCCTGGGG + Intergenic
1008700042 6:54087919-54087941 TCCCTCTGGACACATTCCCCAGG - Intronic
1009795047 6:68456071-68456093 GCCCAGTTGGAACTTTCCCGAGG + Intergenic
1013180817 6:107715656-107715678 GCCCTGTGAACACATCCCCTTGG + Intronic
1014325335 6:119986504-119986526 GGTCTGTGGGCACAGGCCCGAGG - Intergenic
1018842972 6:167531856-167531878 GCTCTGTGGACACAGGCCCGAGG - Intergenic
1019366611 7:636453-636475 GCACAGTGGGCACAGTCCGGTGG - Intronic
1025057436 7:55776397-55776419 TCCCTGTGGCCACCTTCCCATGG + Intergenic
1027449508 7:78314601-78314623 GCCATGTGTGCACATGCCCCTGG - Intronic
1029187128 7:98747223-98747245 ACCCTGTAGGCACATCCCCTGGG + Intergenic
1033564709 7:142567305-142567327 GGTCTGTGGGCACAGGCCCGAGG - Intergenic
1036649728 8:10634674-10634696 GGCCTGTGGACTCATTCCTGGGG - Intronic
1037757301 8:21719264-21719286 GCCCTGTGGGAAGATCCACGTGG - Intronic
1039638609 8:39194200-39194222 GCCCTCTGTGCACACTCGCGTGG + Intronic
1044279366 8:90338368-90338390 TCTCTGTAGGCACATTCCCTCGG - Intergenic
1046232563 8:111376137-111376159 GCCCTTTGGGCAAATTCTCCTGG + Intergenic
1049710438 8:144060730-144060752 GCCCTGTAGGCTCCTCCCCGAGG - Intronic
1049804371 8:144532326-144532348 GGCCTGTGGGCACCTTCCACTGG + Exonic
1050043558 9:1520763-1520785 GGTCTGTGGGCACAGGCCCGAGG - Intergenic
1056588336 9:87944101-87944123 GCCCTGTTGGCACACTCAGGCGG - Intergenic
1057075012 9:92134127-92134149 GCCCCGTTGGCATCTTCCCGTGG + Intergenic
1061874450 9:133536889-133536911 GCCGTGTGGGCACGTGCCCCAGG + Intronic
1187606060 X:20884504-20884526 GCCCTGTGGGCACAGTCTCAAGG - Intergenic
1192784087 X:74321103-74321125 GATCTGTGGGCACAGGCCCGGGG - Intergenic
1193961003 X:87924632-87924654 GCACTGTGGGCCCATGCCAGGGG - Intergenic
1197034210 X:121854472-121854494 GTCCTCTGTGCACATTCACGTGG - Intergenic
1199461831 X:148093780-148093802 GCACTGTGTGCACACTCCGGTGG + Intergenic
1201063550 Y:10069137-10069159 GCCCTCAGGGCACATGCCCCGGG + Intergenic