ID: 901157685

View in Genome Browser
Species Human (GRCh38)
Location 1:7151416-7151438
Sequence CCCTTGGGTGTCTGTGTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 446}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901157677_901157685 -5 Left 901157677 1:7151398-7151420 CCCAGCGAGGCTGCCTGGCCCTT 0: 1
1: 0
2: 3
3: 19
4: 215
Right 901157685 1:7151416-7151438 CCCTTGGGTGTCTGTGTCTGGGG 0: 1
1: 0
2: 4
3: 33
4: 446
901157678_901157685 -6 Left 901157678 1:7151399-7151421 CCAGCGAGGCTGCCTGGCCCTTG 0: 1
1: 0
2: 2
3: 24
4: 230
Right 901157685 1:7151416-7151438 CCCTTGGGTGTCTGTGTCTGGGG 0: 1
1: 0
2: 4
3: 33
4: 446
901157669_901157685 25 Left 901157669 1:7151368-7151390 CCCCTCTTTGCAGCGGGCAACCC 0: 1
1: 0
2: 0
3: 4
4: 53
Right 901157685 1:7151416-7151438 CCCTTGGGTGTCTGTGTCTGGGG 0: 1
1: 0
2: 4
3: 33
4: 446
901157675_901157685 4 Left 901157675 1:7151389-7151411 CCTGGATTGCCCAGCGAGGCTGC 0: 1
1: 0
2: 1
3: 10
4: 127
Right 901157685 1:7151416-7151438 CCCTTGGGTGTCTGTGTCTGGGG 0: 1
1: 0
2: 4
3: 33
4: 446
901157670_901157685 24 Left 901157670 1:7151369-7151391 CCCTCTTTGCAGCGGGCAACCCT 0: 1
1: 0
2: 0
3: 2
4: 68
Right 901157685 1:7151416-7151438 CCCTTGGGTGTCTGTGTCTGGGG 0: 1
1: 0
2: 4
3: 33
4: 446
901157674_901157685 5 Left 901157674 1:7151388-7151410 CCCTGGATTGCCCAGCGAGGCTG 0: 1
1: 0
2: 1
3: 11
4: 108
Right 901157685 1:7151416-7151438 CCCTTGGGTGTCTGTGTCTGGGG 0: 1
1: 0
2: 4
3: 33
4: 446
901157671_901157685 23 Left 901157671 1:7151370-7151392 CCTCTTTGCAGCGGGCAACCCTG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 901157685 1:7151416-7151438 CCCTTGGGTGTCTGTGTCTGGGG 0: 1
1: 0
2: 4
3: 33
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901157685 Original CRISPR CCCTTGGGTGTCTGTGTCTG GGG Intronic
900161421 1:1225791-1225813 CTCGTGTGTGTCTGTGTCTGTGG - Intronic
900317746 1:2067907-2067929 GCTTTGCCTGTCTGTGTCTGGGG + Intronic
900370164 1:2328738-2328760 CCCATCTGTGTCTGTGCCTGGGG - Intronic
900465892 1:2825261-2825283 TCCATGGGTGTCTCTGACTGGGG + Intergenic
900499036 1:2990692-2990714 CACTTGAGTTTCTGTTTCTGTGG + Intergenic
901157685 1:7151416-7151438 CCCTTGGGTGTCTGTGTCTGGGG + Intronic
901573464 1:10180873-10180895 CCCTTGGGTGTGTGAGTTTGAGG + Exonic
901737957 1:11324198-11324220 CCATTAGATGTCTGTGACTGAGG + Intergenic
902623153 1:17661973-17661995 CCCTTGGGTGTCTTTGTGCAAGG + Intronic
902899842 1:19507425-19507447 CCCATGGGTGTATGTAGCTGGGG - Intergenic
903138792 1:21326362-21326384 CCGTGGGGTGTGTGTGTCGGGGG + Intronic
903759400 1:25687310-25687332 GCCTTGGGAGTCTCTCTCTGTGG + Intronic
904449392 1:30601266-30601288 CCCCTGTGTGGCTGGGTCTGGGG - Intergenic
905640827 1:39588652-39588674 CATTTTGGTGTCTGTTTCTGAGG + Intergenic
906384122 1:45352728-45352750 CACTTGTGTGTGTGTGTGTGTGG + Intronic
906864317 1:49399875-49399897 GCTTTGGTTGTCTGTGCCTGTGG + Intronic
907121249 1:52009982-52010004 AGCTTGCTTGTCTGTGTCTGCGG + Intergenic
907248857 1:53124631-53124653 CCCATGTGTGTTTGTGTGTGTGG - Intronic
907287544 1:53391456-53391478 CCTCTGGCTGTGTGTGTCTGAGG - Intergenic
907542879 1:55232693-55232715 CCCTCTGCTGTCTGTCTCTGTGG + Intergenic
908574118 1:65441239-65441261 CACTTGAGTGTCTGTCCCTGGGG + Intronic
908911143 1:69073249-69073271 GCATTGAGTGTCAGTGTCTGTGG + Intergenic
909100786 1:71345290-71345312 CTCTTGGGTGTGTGTGTGTGAGG - Intergenic
911565187 1:99455894-99455916 CCCTGGGGTGTGTGTTTGTGGGG - Intergenic
912263218 1:108129853-108129875 ACATGGAGTGTCTGTGTCTGGGG - Intergenic
912407437 1:109452421-109452443 CCCCTGTGTGGCTGGGTCTGGGG + Intergenic
912411130 1:109481392-109481414 CCCTTTGTTCTCTGTGTCTCTGG - Exonic
912483982 1:110009344-110009366 CCCCTGGCTGTCTGTGTGTGTGG + Intronic
912601582 1:110939948-110939970 GCTTTGGTTGTCTGTGTTTGTGG - Intergenic
912975756 1:114328769-114328791 GCCTTGGGTGGCAGTGTCAGTGG - Intergenic
915101993 1:153507391-153507413 TCCTTGGGTGTGTGTGTGGGGGG - Intergenic
915584369 1:156836254-156836276 CCCTTTGATGTCTGTGGGTGTGG - Intronic
915734777 1:158077848-158077870 GCATCAGGTGTCTGTGTCTGGGG + Intronic
917060941 1:171038509-171038531 CCCATGTGTGACTGTATCTGAGG - Intronic
917137681 1:171803293-171803315 ATCTTGGGTGTGTGTGTGTGTGG + Intronic
918870554 1:189968500-189968522 ACCTTGGCTGGCTGTGTCAGAGG - Intergenic
922610481 1:226923490-226923512 CCCTTGGCTTTCTGCCTCTGGGG - Intronic
922831527 1:228556767-228556789 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
922832005 1:228608721-228608743 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
922832566 1:228610962-228610984 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
922833126 1:228613203-228613225 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
922833687 1:228615444-228615466 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
922834246 1:228617685-228617707 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
922834804 1:228619926-228619948 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
922835355 1:228622141-228622163 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
922835914 1:228624361-228624383 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
922836473 1:228626603-228626625 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
922837031 1:228628842-228628864 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
922837590 1:228631084-228631106 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
922838149 1:228633325-228633347 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
922838708 1:228635564-228635586 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
922839266 1:228637790-228637812 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
922839825 1:228640031-228640053 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
922840388 1:228642262-228642284 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
922840948 1:228644503-228644525 CCCGGGTGTGTCTGTGTGTGGGG - Intergenic
923520910 1:234734460-234734482 CTCTGGGGTGTCTGAGCCTGCGG + Intergenic
923622093 1:235587689-235587711 GTGTTGGGTGTCTGTGTGTGAGG + Intronic
924522987 1:244821579-244821601 CCCTCGGGCGGCTCTGTCTGTGG + Intergenic
924691586 1:246356318-246356340 CATTTGGGTGACTGTGTCAGAGG - Intronic
1063116359 10:3074586-3074608 CCCTTGGCGGGATGTGTCTGTGG - Intronic
1063441633 10:6077734-6077756 CCCTGGGGGGTCTGTGTCCCTGG + Intergenic
1064445259 10:15387293-15387315 CCCTTGTGGGGCTCTGTCTGTGG - Intergenic
1064602561 10:17008333-17008355 CCCGTGTGTGTGTGTGTGTGTGG + Intronic
1067278177 10:44852362-44852384 CCCTTCCCTGTCTGTGCCTGTGG - Intergenic
1067679917 10:48427337-48427359 CACTAATGTGTCTGTGTCTGGGG - Intronic
1067738262 10:48876071-48876093 CCCCTGGGTGTCTGTGACCCTGG + Intronic
1067740896 10:48895439-48895461 CCCTTGGCTCTCTGGGCCTGTGG + Intronic
1069146523 10:64898172-64898194 GCTTTGGGTGCCTGTGTTTGTGG + Intergenic
1069945111 10:71980175-71980197 TGTGTGGGTGTCTGTGTCTGAGG - Intronic
1070161443 10:73868932-73868954 GATTGGGGTGTCTGTGTCTGAGG - Intronic
1070420595 10:76232831-76232853 CCCCTGTGTGTCTGGGCCTGGGG + Intronic
1070462365 10:76682765-76682787 CTCAGTGGTGTCTGTGTCTGTGG - Intergenic
1071567768 10:86680527-86680549 CCGCTGGGTGACTGTGGCTGAGG + Intronic
1072539542 10:96387822-96387844 CGCTTGGGTTAATGTGTCTGGGG - Intronic
1075704269 10:124490143-124490165 CCTGTGAGTGTCTCTGTCTGTGG + Intronic
1076321403 10:129584673-129584695 CACTAGTCTGTCTGTGTCTGTGG + Intronic
1076729305 10:132430276-132430298 GTCCTGGGTGTGTGTGTCTGAGG + Intergenic
1076896611 10:133316373-133316395 CCTTTCCGTCTCTGTGTCTGGGG - Intronic
1076900982 10:133337306-133337328 GTCTGGGGTGTGTGTGTCTGGGG - Intronic
1077131074 11:973009-973031 CCCTGGGGTGTCTGTGCCACAGG + Intronic
1079318235 11:19428282-19428304 CCTTTGTCTGTCAGTGTCTGTGG + Intronic
1080636779 11:34131149-34131171 CCCTTGTGTGTCCTTGTCTCAGG + Intronic
1081440181 11:43072248-43072270 CCCTTGGGGTTCTTTATCTGAGG - Intergenic
1081660100 11:44882821-44882843 CCCTTGGGTCTGGGGGTCTGGGG - Intronic
1081961084 11:47138011-47138033 CTCTAGGGTGTGTGTGTGTGGGG - Intronic
1082160733 11:48885373-48885395 CCCTGGGGTCCCTGTTTCTGTGG + Intergenic
1082161633 11:48895033-48895055 CCCTGGGGTCCCTGTTTCTGTGG - Intergenic
1082236363 11:49823237-49823259 CCCTGGGGTCCCTGTTTCTGTGG + Intergenic
1082242338 11:49886606-49886628 CCCTGGGGTCCCTGTTTCTGTGG - Intergenic
1083868253 11:65470485-65470507 CTCTCGGGTGTCTGTGTCCTTGG - Intergenic
1084570822 11:69958834-69958856 CTGTGGGGTGTCTGAGTCTGAGG - Intergenic
1084981292 11:72830101-72830123 CCTCTGTGTGTCTGTGCCTGGGG + Intronic
1088599674 11:111463231-111463253 GCCTTGGGAGTCTCTTTCTGAGG - Intergenic
1089057176 11:115595162-115595184 GGCTTGGGTGGCTGTGGCTGTGG - Intergenic
1090424422 11:126597173-126597195 CCCTTGGCTCTCTGTGGCAGGGG + Intronic
1090427158 11:126615948-126615970 GCCCTGGGTGTGTGTGTGTGGGG + Intronic
1090645211 11:128761601-128761623 CCCATGGGTATTTGTGTCTCTGG + Intronic
1091565082 12:1642236-1642258 TCTTTGGGTGTCTGGGCCTGAGG + Intronic
1091600974 12:1917571-1917593 CTCTGGGGTGTCTGTGTTTTAGG - Intronic
1092833374 12:12465806-12465828 CCTCAGGGTGTCGGTGTCTGGGG - Exonic
1094818326 12:34206868-34206890 CCCATGTGTGTCTGTGTGTAGGG + Intergenic
1095317350 12:40781332-40781354 CACTTGGGTCTCTGTCTCTTTGG + Intronic
1095962651 12:47845080-47845102 CCGTTGAGTGTCTGTGTGGGTGG - Intronic
1096519399 12:52175714-52175736 CCCTTGGGTGTCTCCTGCTGGGG + Intronic
1097040354 12:56152610-56152632 CCCTGCGGGGTCCGTGTCTGGGG - Exonic
1097107023 12:56631979-56632001 CCCTTAGCCTTCTGTGTCTGTGG - Intronic
1097261934 12:57725366-57725388 CCTTGGGCTGTCTGTGTCAGTGG - Intronic
1098917794 12:76275389-76275411 CCCTAGGGTGTGTGAGTCTATGG - Intergenic
1099167413 12:79323381-79323403 CCATTGGGAGTTTGTGCCTGTGG - Intronic
1101083085 12:101208984-101209006 CACTTGGGTGCCTGTTTCAGTGG + Intronic
1101569362 12:105938842-105938864 CAATTGGTTGCCTGTGTCTGTGG - Intergenic
1102545331 12:113650397-113650419 CTCTTGGATGTGTGTGTGTGGGG + Intergenic
1102935621 12:116894255-116894277 CTCTTGGGTGTGTGTGTGTATGG + Intergenic
1103015215 12:117489145-117489167 CCCTTGTGTGTGTGTGTGTGTGG + Intronic
1103723978 12:122988911-122988933 CCCTTCGGGGTCCCTGTCTGGGG - Intronic
1103985534 12:124764946-124764968 CCCTGTGGTCTCTCTGTCTGTGG - Intergenic
1104777974 12:131402426-131402448 CCCCTGGGTGTATGTCCCTGAGG - Intergenic
1107484476 13:40813138-40813160 CCCCAGGGTGTGTGTGTGTGTGG - Intergenic
1107771911 13:43796130-43796152 CCCTTGGGGGTCAGTGACAGTGG - Intergenic
1109331744 13:60939661-60939683 CCCTTGGCTCTCCGTCTCTGTGG - Intergenic
1109944886 13:69420526-69420548 CCCATGTCTGTCTGAGTCTGGGG + Intergenic
1111914406 13:94346071-94346093 TCCCTGCATGTCTGTGTCTGTGG + Intronic
1112005209 13:95247587-95247609 AGCGTGGGTGTCTGTGTGTGGGG - Intronic
1113472352 13:110555934-110555956 GCCTTGGGTGCCTGTCACTGAGG - Intronic
1113856973 13:113452115-113452137 CCCACAGGTGTCTGTGTGTGGGG + Intronic
1113956994 13:114104371-114104393 CCAGTGGGTGTCTGTGGCTGGGG - Intronic
1116003873 14:39271933-39271955 CCCCTGTGTGGCTGGGTCTGCGG + Intronic
1116117336 14:40671742-40671764 TCCTTGAGTCTCTGTGTCTTTGG - Intergenic
1116427233 14:44806268-44806290 CCTTTGTGTGTGTGTGTGTGTGG - Intergenic
1119674530 14:76544041-76544063 TCCTTGGGTGGCTCTGTCTCAGG + Intergenic
1121373659 14:93384729-93384751 GCCTTGGTTGCCTGTGCCTGTGG + Intronic
1121548805 14:94782636-94782658 CGCATGTGTGTCTGTGTGTGGGG + Intergenic
1122264855 14:100541771-100541793 CCCTGGGCTGTCCATGTCTGAGG + Intronic
1122370634 14:101227195-101227217 CCCCTGGGTGCGTCTGTCTGTGG - Intergenic
1122690716 14:103530999-103531021 CCCTGGGGTGTCTGGGTGGGAGG + Intronic
1122796197 14:104207404-104207426 AGCTTGGGTGTCTGTGGGTGTGG + Intergenic
1122971309 14:105153381-105153403 AGCCTGGGTCTCTGTGTCTGTGG - Intronic
1123066957 14:105623676-105623698 CTCGTGGGGGCCTGTGTCTGAGG + Intergenic
1123070978 14:105642403-105642425 CTCGTGGGGGCCTGTGTCTGAGG + Intergenic
1123425180 15:20164839-20164861 GCTTTGGGTGTCTTTGTCAGGGG + Intergenic
1123534405 15:21171372-21171394 GCTTTGGGTGTCTTTGTCAGGGG + Intergenic
1123755296 15:23393173-23393195 CCCCTGAGTGTGTGTGTGTGTGG + Intergenic
1124049969 15:26187848-26187870 ACCTTGGGTTGATGTGTCTGTGG - Intergenic
1124270793 15:28278560-28278582 CAGTTGGCTCTCTGTGTCTGTGG - Intronic
1125454247 15:39841481-39841503 CCTGTGTGTGTCTGTCTCTGCGG - Intronic
1125920874 15:43524952-43524974 CTCTTGGTTGGCAGTGTCTGGGG - Exonic
1126503650 15:49377887-49377909 CCTTTGATTGTCTGTGTTTGTGG + Intronic
1126737430 15:51745655-51745677 CCATTGTGTGTGTGTGTGTGTGG - Intronic
1127956423 15:63857746-63857768 TGCTGGAGTGTCTGTGTCTGGGG - Intergenic
1128079095 15:64845556-64845578 CCCCTGGGTGGCTGTTTCTGTGG + Intronic
1128079674 15:64848891-64848913 CTCTTGGGTCTCTGTATATGGGG + Intronic
1128099781 15:64989491-64989513 CCCTTGTGAGTGTGTGTCTGGGG - Intronic
1129244105 15:74269377-74269399 CCCTTGGGTCTCAGTGTCCCTGG - Intronic
1130719272 15:86370942-86370964 CTCTTGGGTCTATGGGTCTGGGG + Intronic
1130848308 15:87768106-87768128 CCCTTGGCTGTGTGTGTGTGTGG - Intergenic
1130893210 15:88150607-88150629 CACTGGGTTGTCTGTGTCTGTGG - Intronic
1131243967 15:90773981-90774003 CTCTTGGGTTGCTGGGTCTGTGG + Intronic
1132299152 15:100765867-100765889 CCCTTGGGTGTCGCTGTCACAGG - Intergenic
1132359204 15:101198394-101198416 CTCTCGGGTGTCTGTGACGGTGG + Intronic
1132694774 16:1197032-1197054 GCCTTGGGGGTCTGTGACTTTGG - Intronic
1133303556 16:4797044-4797066 TCCTAGGGTGGCTCTGTCTGTGG + Exonic
1133559335 16:6935904-6935926 CCCTTGGGTTTGTGTGACTGGGG + Intronic
1133726391 16:8541765-8541787 TCCTTGCCTGTCTGTGTATGGGG + Intergenic
1133905634 16:10019932-10019954 ATTTTGGGTGTCTGTGTATGTGG - Intronic
1133909425 16:10051574-10051596 GCCTTGCATGTGTGTGTCTGAGG + Intronic
1135977517 16:27118815-27118837 CCATTATGGGTCTGTGTCTGTGG - Intergenic
1136271440 16:29151142-29151164 GCCTTGGTTGCCTGTGTGTGGGG + Intergenic
1136923657 16:34351325-34351347 CCCTTGGGTCTTTCTGACTGTGG - Intergenic
1136980916 16:35060481-35060503 CCCTTGGGTCTTTCTGACTGTGG + Intergenic
1137591916 16:49698975-49698997 CCCTTTGGGGACTCTGTCTGGGG - Intronic
1137603608 16:49772765-49772787 CCCTCGGGTGTTGGTCTCTGTGG - Intronic
1138305342 16:55969530-55969552 GCCTTGTGTGTGTGTGTGTGTGG - Intergenic
1138336341 16:56256372-56256394 CCCTAGTGTGTGTGTGTATGTGG - Intronic
1140027539 16:71304212-71304234 CACTGGGGTGTCAGTATCTGTGG + Intergenic
1140036103 16:71372402-71372424 TCCTTGGGTGTCTGGGATTGAGG + Intronic
1140046696 16:71444275-71444297 TCCATGTGTGTCTGTGTATGTGG + Intergenic
1141614890 16:85204818-85204840 CCCTTGGCTGGCTGGGTGTGGGG - Intergenic
1141880800 16:86857557-86857579 CCCATGGGTGTCTCTGGCTGAGG - Intergenic
1142032895 16:87847218-87847240 ACCTTGGCTGTCTGTGGCTCTGG - Intronic
1142126315 16:88412270-88412292 GCACTGGGTGGCTGTGTCTGAGG - Intergenic
1142214773 16:88825106-88825128 CGCCTGGGTGTCTGGGGCTGGGG + Intronic
1142214814 16:88825217-88825239 CGCCTGGGTGTCTGGGGCTGGGG + Intronic
1142899388 17:3002891-3002913 TGCTTGGGTGTGTGTGTGTGTGG + Intronic
1142904820 17:3034533-3034555 CCCTTGGGCAGCTGCGTCTGGGG + Exonic
1143469239 17:7161402-7161424 CCCGTGTGTGTGTGTGTGTGGGG - Intergenic
1143784248 17:9244940-9244962 GCCTTGGGGGTCTGGCTCTGCGG + Intergenic
1144932958 17:18874859-18874881 CTCCTTGGTTTCTGTGTCTGTGG + Intronic
1147165654 17:38591860-38591882 CCCTTTGGTGTCTGGAGCTGGGG - Intronic
1147966084 17:44194911-44194933 CCCTTCCCTGTCTGTGCCTGTGG - Intronic
1148152659 17:45405505-45405527 CCCTGGGGTCCCTGGGTCTGTGG + Intronic
1151952663 17:77363825-77363847 CCCTGGAGTGTCTGTAACTGGGG - Intronic
1152322764 17:79617412-79617434 CCCTGGGGTGTCCGTGGGTGTGG - Intergenic
1152780006 17:82222955-82222977 CCATCTGCTGTCTGTGTCTGTGG - Intergenic
1152898843 17:82928570-82928592 CCCTTGCGGGTCTCTGTCGGGGG + Intronic
1153647130 18:7205293-7205315 CCCAAGGCTGTGTGTGTCTGGGG + Intergenic
1154355314 18:13619970-13619992 CCCTAGGGTGTGGGGGTCTGAGG + Intronic
1155077035 18:22367784-22367806 CCAGTGTGTGTCTGTGTGTGTGG + Intergenic
1155280910 18:24238703-24238725 CCCTTTAGTGTGTGTTTCTGAGG + Intronic
1155834572 18:30564649-30564671 CCCTTGGGTTTATGAATCTGTGG + Intergenic
1156187628 18:34681731-34681753 CCATAGGGTGTGTGTGTGTGGGG - Intronic
1156858067 18:41806032-41806054 CCTATGGGTGTATGTGTGTGTGG + Intergenic
1157605505 18:48923571-48923593 GCTCTGGGTGTGTGTGTCTGTGG - Intronic
1157682138 18:49615458-49615480 CCCTCTGCTTTCTGTGTCTGTGG + Intergenic
1159408120 18:68033031-68033053 CAGTTGGGTATCTGAGTCTGAGG + Intergenic
1159889460 18:73940279-73940301 CCCTTGGGTGTCTGAGTGTGGGG - Intergenic
1160102550 18:75936667-75936689 CCCTTGGGGTGCTCTGTCTGTGG - Intergenic
1160134896 18:76263606-76263628 TTCTTGGGTCTCTGGGTCTGGGG - Intergenic
1160517836 18:79488245-79488267 CCCTGGTGTGTGTGTGTTTGCGG + Intronic
1160537079 18:79600404-79600426 CAGAGGGGTGTCTGTGTCTGAGG + Intergenic
1161142782 19:2658496-2658518 CACTTGGGTGTCTCTGCCTTTGG - Intronic
1161627273 19:5334610-5334632 CCCTGGGGTGTGTGTGTGCGGGG + Intronic
1162145440 19:8610338-8610360 CTCTTGTGTGTCTGTGTGTTTGG - Intronic
1162842091 19:13364099-13364121 CCCTTCAGTGGCTGGGTCTGGGG - Intronic
1163497416 19:17654987-17655009 CCCTGGGCTGTGTGTGTATGTGG + Intronic
1164139748 19:22448490-22448512 CCTTTGGGTGTCTGTTTCAGGGG + Intronic
1165070119 19:33250949-33250971 CCTGTGTGTGTCTGTGTGTGTGG - Intergenic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1165376015 19:35442650-35442672 CCATTGGTTGTATGTGTGTGTGG - Intergenic
1165816104 19:38643275-38643297 CCCTAGGGACTCAGTGTCTGGGG + Intergenic
1165961241 19:39536409-39536431 GTCTTGGGTGTGTGTGTGTGTGG - Intergenic
1166531748 19:43546995-43547017 CCCTTGGGCCTGTTTGTCTGAGG - Intronic
1166720063 19:44991455-44991477 CCCTAGGTTGTCCCTGTCTGGGG - Intronic
1167022484 19:46888433-46888455 CCCTTGGGTAACGGTGGCTGTGG + Intergenic
1167368828 19:49068734-49068756 CCTTTGGGTCTCTGTCTCTCTGG + Exonic
1167421872 19:49408833-49408855 CCCTAGGCAGTATGTGTCTGGGG + Intronic
925057896 2:869496-869518 CCGGTGGGTGTCTGGGACTGTGG + Intergenic
925809851 2:7688647-7688669 ACTTTGGGTGTCTGTGAGTGTGG + Intergenic
928416140 2:31093515-31093537 CCCTTGAGAGGCAGTGTCTGGGG + Intronic
931794074 2:65692828-65692850 TCCTTGTGAGTCTATGTCTGTGG - Intergenic
932303117 2:70681962-70681984 ACCTTGGGAGTCTGAGTCAGAGG - Intronic
932363352 2:71129027-71129049 CACTTGTGTGTGTGTGTGTGTGG - Intronic
933610096 2:84425011-84425033 CCCATGGGTTTCTGTTTCTAGGG - Intronic
933769698 2:85735134-85735156 CTCCTGGGTGACTGGGTCTGAGG + Intergenic
935128869 2:100246567-100246589 AACTTGGGAGTGTGTGTCTGTGG + Intergenic
935189888 2:100768621-100768643 GTCTTGGGTGGCTGTGGCTGGGG - Intergenic
937133971 2:119536308-119536330 CCCCTGCGTGTCTGGGTCTAAGG + Intergenic
937753229 2:125503355-125503377 TCCTTGGTTGACTGTGTGTGGGG + Intergenic
938293398 2:130162174-130162196 CCTCTGGGTGTGTGTGGCTGTGG - Intronic
938463155 2:131510787-131510809 CCTCTGGGTGTGTGTGGCTGTGG + Intergenic
940499826 2:154480021-154480043 CCATTGTGTGTGTGTGTGTGTGG - Intergenic
940835722 2:158519384-158519406 CCCCTGGGTGTCAGTGTCTGAGG + Intronic
942545669 2:177061211-177061233 CCCCTGGCTGTCTGGGTCTCTGG - Intergenic
944200026 2:197096864-197096886 CCTTTGTGTGTTTGTGTGTGTGG - Intronic
946565341 2:220958020-220958042 TCCCTGGGGCTCTGTGTCTGGGG + Intergenic
948058906 2:235029392-235029414 CAGGTGGGTGTCTGAGTCTGAGG + Intronic
948146149 2:235709533-235709555 CCCATGGGGGTGTGTGTGTGTGG - Intronic
948624749 2:239262008-239262030 ACCTAGGGCCTCTGTGTCTGGGG - Intronic
948793606 2:240391438-240391460 CCCTGGGGGGTCTGTGTCCAGGG - Intergenic
948931921 2:241137480-241137502 CCCTGGGGTTGCTGTGCCTGGGG - Intronic
948988567 2:241540587-241540609 GCTTCGGGTGTCTGAGTCTGAGG + Intergenic
949036303 2:241817073-241817095 CCCTTGGGTGCCTGGGGCAGAGG + Exonic
1169501455 20:6164623-6164645 CCCTTGGCTGCCTGAGTCTCCGG + Intergenic
1169569911 20:6894968-6894990 AACAAGGGTGTCTGTGTCTGGGG + Intergenic
1171316540 20:24200446-24200468 CCCTTGGGTGCCGGTGTCCTAGG + Intergenic
1171779812 20:29408798-29408820 CCCGTGTGTGTCTGTGTGTTTGG + Intergenic
1171823796 20:29877080-29877102 CCCATGTGTGTCTGTGTGTTTGG + Intergenic
1171846797 20:30282311-30282333 CCCTTGTGCGTGTGTGTCTTTGG + Intergenic
1172632476 20:36388316-36388338 CCTTTGTGTGTGTCTGTCTGGGG + Intronic
1172853429 20:37983145-37983167 CTCTTGTGTGTGTGTGTGTGTGG + Exonic
1172979748 20:38931974-38931996 TCCCTGGGTGGCTGTGCCTGGGG + Intronic
1173155548 20:40605613-40605635 CCCATGTGTGTCTGTGTATGTGG + Intergenic
1173423736 20:42925698-42925720 CCCTTGGGTTTCTGATTCAGTGG + Intronic
1173479803 20:43390011-43390033 CCTGTGGGTGGCTGTGGCTGTGG - Intergenic
1175384184 20:58583748-58583770 CCCTTGGAGTGCTGTGTCTGGGG + Intergenic
1175444970 20:59013607-59013629 CCCCTGGATGTAGGTGTCTGAGG + Intergenic
1175503666 20:59467450-59467472 CCCTGAGGTGCGTGTGTCTGAGG + Intergenic
1175723016 20:61298848-61298870 CACTAGTGTGTCTGTGTATGCGG + Intronic
1175819273 20:61899939-61899961 CCCTGGGGTCTGTGGGTCTGTGG + Intronic
1176233917 20:64045433-64045455 CCCCAGGCTGTCTGTGTCTGTGG + Intronic
1176266771 20:64213459-64213481 GTCCTGGGTGTCTGTGTGTGTGG - Intronic
1176305894 21:5122978-5123000 CCCATGGGTGACTGTCTCAGAGG + Intronic
1176868493 21:14070099-14070121 CCCATGTGTGTCTGTGGGTGTGG + Intergenic
1177036481 21:16049839-16049861 GCTTTGGTTGTCTGTGTTTGTGG - Intergenic
1178353947 21:31894847-31894869 CCATTGGGTGCTTTTGTCTGAGG + Intronic
1178395662 21:32240744-32240766 CTTTTGGGCGTCAGTGTCTGTGG - Intergenic
1179084324 21:38203757-38203779 CCAGTGGGGGTCTGTGTTTGGGG + Intronic
1179282076 21:39942314-39942336 CCCTTGGATGACTATGTCTTTGG + Intergenic
1179360487 21:40703542-40703564 CTGTTGGGTGTGTGTGTGTGTGG - Intronic
1179851163 21:44139053-44139075 CCCATGGGTGACTGTCTCAGAGG - Intronic
1180185845 21:46138835-46138857 ACCGTGGGCCTCTGTGTCTGGGG - Intronic
1180324863 22:11361270-11361292 CCCGTGTGTGTCTGTGTGTTTGG + Intergenic
1180616500 22:17131730-17131752 CCCTTGGGTGGCAGCTTCTGTGG - Exonic
1180785177 22:18543230-18543252 CTCCTGGGTGCCTGTGGCTGTGG - Intergenic
1181112765 22:20611605-20611627 CCTCTGGGTGTGTGTGGCTGTGG - Intergenic
1181128758 22:20717271-20717293 CTCCTGGGTGCCTGTGGCTGTGG - Intronic
1181242080 22:21482583-21482605 CTCCTGGGTGCCTGTGGCTGTGG - Intergenic
1181479822 22:23191676-23191698 CCCATGGAGGTCTGTGTCTCGGG + Intronic
1181591027 22:23884679-23884701 TTCCTTGGTGTCTGTGTCTGTGG + Exonic
1181977466 22:26741038-26741060 CCCTTCTGTGGCTGTCTCTGTGG - Intergenic
1182042393 22:27248631-27248653 CCCTTGAGTGTCTTTATCTGGGG - Intergenic
1182108190 22:27704236-27704258 CCCCTGGGTTTCTGGGTCTGAGG - Intergenic
1182418364 22:30235971-30235993 CCATTGCTCGTCTGTGTCTGCGG + Intergenic
1182506923 22:30790125-30790147 CCATTGGGTGTGGGTGTCTTGGG + Intronic
1182686912 22:32128191-32128213 GCCTTGGCTCTCTGGGTCTGTGG + Intergenic
1183031290 22:35108367-35108389 ACCTTGGGTGTCAGTGTGGGGGG - Intergenic
1184839817 22:47046123-47046145 CCTGTGGGTGTCTGTGTGTGTGG + Intronic
1185004802 22:48269652-48269674 TCCCTGTGTGTCTGTGTGTGTGG - Intergenic
1185231825 22:49688054-49688076 CTCTTGGGTGTCCGAATCTGGGG - Intergenic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
949242349 3:1888006-1888028 GCCATGGGTGCCTGTGTTTGTGG - Intergenic
949822791 3:8134326-8134348 GTCTTGGGTGTCTGTCTCTTGGG - Intergenic
950083170 3:10238268-10238290 CCATTGTGTCTCTCTGTCTGTGG + Intronic
950261294 3:11544706-11544728 CCCTTGACTGTGTGTGTCTCAGG + Intronic
951455957 3:22892429-22892451 CCCTGGGGTGTCTGATTCAGTGG + Intergenic
951477959 3:23128786-23128808 CCCATGGGTGTCTGAATCTGAGG - Intergenic
951995126 3:28719079-28719101 GCTTTGGGTGTGTGTGTATGTGG + Intergenic
952109581 3:30107309-30107331 GCCTTGGTTGCCTGTGTTTGTGG + Intergenic
952847810 3:37702900-37702922 CCTTTGGGTTTCTGGGTCTCTGG - Intronic
954082058 3:48218206-48218228 CCCTTGGGAGTCCCTGTCTGAGG + Intergenic
954226895 3:49187961-49187983 CCCTTACATGTCTGTTTCTGAGG + Intronic
954325227 3:49859777-49859799 CCCGGGGGTGGCAGTGTCTGTGG + Exonic
954413701 3:50382517-50382539 CCCTTCGCTGTCTGTTCCTGTGG + Intronic
954906961 3:54071189-54071211 CCCTTGAGTGTGTGTGTGTGTGG - Intergenic
955232424 3:57110882-57110904 CCCTTGGGTGTCTGCCTTTCAGG - Intronic
957717964 3:83956542-83956564 CCCTTGTGTGTCTGTGTTGCTGG + Intergenic
960163069 3:114371436-114371458 CCGGTGGGTCTCTGTGTATGGGG + Intronic
960589541 3:119352300-119352322 CCTCTGGGTGTGTGTGTTTGGGG - Intronic
961062915 3:123847257-123847279 CCCTTGGGTGTCAAAATCTGTGG - Intronic
962283423 3:134068505-134068527 TCCTTGGGAGTCTTTGACTGGGG - Intronic
962399549 3:135046561-135046583 CCCCTTGGTGTCTGTGTGTTTGG + Intronic
965320569 3:167248118-167248140 CCCTGAGCTGTGTGTGTCTGTGG - Intronic
965886898 3:173457113-173457135 CCCTTCTGTGTCTTTCTCTGTGG - Intronic
967092065 3:186143307-186143329 CCCTTGGTTTTCTGTGTCCCTGG + Intronic
968462990 4:735070-735092 CCCCTGGGCGTCTCTGTGTGTGG + Intronic
968774994 4:2535510-2535532 CCTTTGTGCCTCTGTGTCTGTGG + Intronic
968994537 4:3937359-3937381 CCCCTGGGTGTCTGTGTGGTTGG + Intergenic
969267641 4:6075284-6075306 CACTTGGCTTTCTGTATCTGTGG - Intronic
969600054 4:8170891-8170913 CCCATGGGTCACTGTGCCTGTGG - Intergenic
969703538 4:8780415-8780437 CCCTTGGGGGTGTGGGCCTGGGG + Intergenic
972406807 4:38754088-38754110 TATTTGGGAGTCTGTGTCTGTGG - Intergenic
973619380 4:52712246-52712268 CCATTGGCTGTCGGTGTCCGGGG - Intergenic
973857031 4:55021994-55022016 TACTTGGTTTTCTGTGTCTGAGG - Intergenic
973917839 4:55654581-55654603 CCCTTGTGTGGCTGGGTCTGGGG + Intergenic
973971255 4:56216048-56216070 CCCTTGCTTGTCTGTAGCTGTGG + Intronic
977845969 4:101767376-101767398 GCCTTGGTTGTCTGTGCTTGTGG + Intronic
979565713 4:122152378-122152400 CCCTTGGGTGTCGGTGGCTGCGG + Exonic
981196166 4:141923224-141923246 ACATTGTGTGCCTGTGTCTGTGG + Intergenic
982260163 4:153487821-153487843 CCCTTGTGGGCCTGTGGCTGAGG + Intronic
982340283 4:154290901-154290923 GCTTTGGTTGTCTGTGTTTGTGG - Intronic
983118493 4:163850272-163850294 CCCTGAGGTATCTGTATCTGGGG + Intronic
983567826 4:169173565-169173587 ACCTTAAGTGTTTGTGTCTGAGG + Intronic
985445645 4:190019886-190019908 CCCGTGTGTGTCTGTGTGTTTGG + Intergenic
985789597 5:1918510-1918532 CCCTCGGGGCTCTGTGTCCGGGG - Intergenic
986297342 5:6449873-6449895 GCCTTGTGTGTGTGTGTGTGGGG - Intronic
986770903 5:10972449-10972471 TGCTTGTGTGTCTGTGTGTGTGG - Exonic
988935558 5:36079148-36079170 CCCTTGGGGGTGTATGACTGTGG + Intergenic
990002293 5:50908422-50908444 CCCTTACATGTCTGTGTCTCTGG - Intergenic
990023978 5:51162492-51162514 CCAATGGGTGTCATTGTCTGTGG - Intergenic
990865895 5:60379509-60379531 CCTTTAGATGTCTGTGGCTGAGG - Intronic
990957781 5:61361049-61361071 TCCTTGTGTGTGTGTGTTTGTGG + Intronic
995962410 5:117858456-117858478 CCCTTGTGTATGTGTGTGTGTGG - Intergenic
996249477 5:121311283-121311305 TACGTGTGTGTCTGTGTCTGTGG + Intergenic
996978666 5:129462596-129462618 CCTTTGTGTGTGTGTGTGTGTGG + Intronic
997419904 5:133757720-133757742 GCCTCGGGTGTCTTTGTCTGAGG - Intergenic
999450340 5:151673069-151673091 CCCTTGGCTGCCTGGGCCTGGGG - Intronic
1000234133 5:159341979-159342001 CCCTTGACTGTCTCTGCCTGTGG + Intergenic
1000582690 5:163053337-163053359 GCTTTGGTTGCCTGTGTCTGTGG - Intergenic
1001210538 5:169806767-169806789 ACCTTGTGTGACTGGGTCTGGGG - Intronic
1001964527 5:175900902-175900924 CCCATGGGTGTCTGCCCCTGGGG + Intergenic
1002305922 5:178282830-178282852 CCCTTGGCAGTCTATCTCTGGGG + Intronic
1002473055 5:179448716-179448738 TCCTTGGGTGGCTGTGCCTGTGG - Intergenic
1002481169 5:179501938-179501960 TCCTTGGGTGGCTGTGCCTGTGG + Intergenic
1002794733 6:463348-463370 CCCTGAGCTGTCTGTGTCAGGGG - Intergenic
1005304256 6:24498243-24498265 CAGTTGGGTGTATGAGTCTGAGG + Intronic
1006300350 6:33190725-33190747 CCCTTGTGTGTTGGTGTTTGCGG - Intronic
1006540614 6:34737006-34737028 CCCCTGTGTGGCTGGGTCTGGGG - Intergenic
1007340691 6:41189580-41189602 TCCTTGGGTATGTGTGTCAGAGG - Intergenic
1009602509 6:65820562-65820584 GCTTTGGTTGTCTGTGTTTGTGG - Intergenic
1010518651 6:76805680-76805702 GGCTTGTGTGTGTGTGTCTGAGG - Intergenic
1012541123 6:100363057-100363079 CCCTGGGATGTGTGTGTGTGGGG - Intergenic
1014051907 6:116964615-116964637 CACATGGATGTCTGTGTATGTGG + Intergenic
1014186454 6:118439820-118439842 GCCTTGGATGCCTGTGTCTGTGG + Intergenic
1015276081 6:131384632-131384654 TCCTTGTGTGTGTGTGTGTGTGG - Intergenic
1016947105 6:149545658-149545680 CCTTTGGGAGTGTGTGTGTGGGG - Intronic
1017006840 6:150033565-150033587 CCCTTGTGTGTGTGTGTGTGGGG + Intergenic
1017806265 6:157948150-157948172 GCCTTGGGAGTCTGTTTCAGAGG - Intergenic
1018501094 6:164411709-164411731 CTCTTGTGTGTCTGTGACTCCGG + Intergenic
1019865287 7:3703312-3703334 CACTTGGGTGAATGAGTCTGAGG + Intronic
1019936245 7:4260081-4260103 CTCTGGGGTCTCTGTGTGTGTGG + Intronic
1021560741 7:21966506-21966528 CCTCTGGGTGTTTGTGTGTGAGG - Intergenic
1021881312 7:25097773-25097795 CTCGTGGGTGTCTGTGTCCAGGG - Intergenic
1022766508 7:33418377-33418399 CCCTTGGGAGACTGAGTGTGTGG + Intronic
1024799672 7:53061413-53061435 CACATGTATGTCTGTGTCTGGGG + Intergenic
1025084057 7:56008461-56008483 CATTTGTGTGTGTGTGTCTGGGG - Intergenic
1025284435 7:57650720-57650742 CCCTTGTGCGTGTGTGTCTTTGG - Intergenic
1026334208 7:69379825-69379847 GCATTGGGTGCCTGTGCCTGGGG - Intergenic
1026564035 7:71474945-71474967 CCCTTCAGTCTCTGTCTCTGTGG - Intronic
1026773897 7:73219235-73219257 TCCTTGGGTGTGTGTGGATGAGG - Intergenic
1027014754 7:74772625-74772647 TCCTTGGGTGTGTGTGGATGAGG - Intergenic
1027073277 7:75173330-75173352 TCCTTGGGTGTGTGTGGATGAGG + Intergenic
1028213952 7:88108977-88108999 AACTTTGGTGTCTGTTTCTGTGG + Intronic
1028648066 7:93120228-93120250 CATTTGGGTGACTGTGTCAGGGG - Intergenic
1031967564 7:128038253-128038275 CACATGCGTGTCTGTGTATGTGG + Intronic
1032838561 7:135696166-135696188 TCCTTGGGTCTCTGTTTTTGGGG + Intronic
1033410215 7:141110755-141110777 CCCTAGTGTGGCTGTATCTGGGG + Intronic
1034126044 7:148672362-148672384 CCCTTGGATTTCTCTCTCTGAGG - Intergenic
1034133780 7:148746080-148746102 CCCTTGCCTGTGTGTGTGTGAGG + Intronic
1034346149 7:150386561-150386583 CCCTGGGGTGGGTGTTTCTGTGG + Intronic
1035196268 7:157223267-157223289 CCCGCCGCTGTCTGTGTCTGAGG + Exonic
1035284645 7:157798491-157798513 TCCGTGTGTGTCTGTGTGTGTGG - Intronic
1035983252 8:4396661-4396683 CCATTGGGTGTGTGTGTGTATGG - Intronic
1036680925 8:10873105-10873127 CCCTTGTTTTTCTGTGTCTTTGG - Intergenic
1037747708 8:21660226-21660248 CTATTGTGTGTGTGTGTCTGTGG - Intergenic
1038498560 8:28024633-28024655 CCCTTGGCTTTCTGTGCCCGAGG + Intronic
1038727379 8:30094056-30094078 CCCTTGGGTGGCTGTCTTTTTGG - Intergenic
1038779138 8:30556074-30556096 GCCGTGGGTGTCTGTGGATGCGG + Intronic
1039175798 8:34804655-34804677 TTCTTGGGTGTGTGTGTGTGTGG + Intergenic
1040284917 8:46094719-46094741 CCCCAGGGTGTCTGTGTCTCTGG + Intergenic
1040416248 8:47198372-47198394 CCCTTGGGGGTCTGAGCCAGAGG + Intergenic
1041321909 8:56622232-56622254 CCCTTTAGTGTCTGTGTTTGGGG - Intergenic
1041406217 8:57502141-57502163 GCCTTGTGTGTCTGTGTGTGTGG + Intergenic
1041434059 8:57817946-57817968 CGCTTGGGTGTCTTTGTCCTGGG - Intergenic
1046391521 8:113578818-113578840 CACTGGGGTGTTTGTGTGTGAGG + Intergenic
1046669340 8:117040983-117041005 CCCTTGGGTGACTGGTTCTTTGG - Intronic
1049300213 8:141865755-141865777 CCCCTGTGTGTGTGTGCCTGTGG - Intergenic
1049317616 8:141977604-141977626 GCCTGGGGTGGCTGGGTCTGTGG - Intergenic
1049516929 8:143064646-143064668 CAATTGGCTTTCTGTGTCTGTGG + Intergenic
1049546509 8:143234194-143234216 CCCTTGGGAGTGTGTGACGGTGG - Intergenic
1049617857 8:143583689-143583711 CCCCTAGGTGGCTGTGGCTGTGG + Intronic
1049699189 8:144000306-144000328 TCCCTGTGTGTGTGTGTCTGTGG - Intronic
1052080430 9:24199174-24199196 CCTTTGGTTGCCTGTGTTTGTGG + Intergenic
1052243871 9:26309762-26309784 CCCTGGGGTGGCGGTGGCTGAGG - Intergenic
1052271953 9:26636409-26636431 CCCTTGGGTGTCTGGTTATGTGG + Intergenic
1053000674 9:34575687-34575709 CCCCGGGGTGTGTGTGTGTGTGG - Intronic
1054254359 9:62799423-62799445 CCCGTGTGTGTCTGTGTGTTTGG - Intergenic
1054336939 9:63816172-63816194 CCCGTGTGTGTCTGTGTGTTTGG + Intergenic
1055661506 9:78508344-78508366 CCCTAGGGTGACTGTATTTGGGG + Intergenic
1056070777 9:82984536-82984558 CTGTCGGGTGTGTGTGTCTGGGG - Intronic
1058510276 9:105710850-105710872 CCTCTGGCTGTGTGTGTCTGAGG - Intronic
1059791868 9:117648993-117649015 GCCTTGCATGTCTGTGTCTATGG + Intergenic
1060416959 9:123437518-123437540 GCCTTGGGTCTGTGTTTCTGTGG - Intronic
1060560274 9:124536986-124537008 CTCTTGGGTCTGTGAGTCTGTGG - Intronic
1061206508 9:129167038-129167060 CCCTTGGATGGGTGTGTTTGTGG + Intergenic
1061779298 9:132986366-132986388 TCCCTGGGTGTCTGTGTCTCTGG + Intronic
1062036980 9:134386738-134386760 CCCCCGGGTGTCTGGGCCTGAGG + Intronic
1062089497 9:134667738-134667760 CCCATGACTGTCTGTGCCTGAGG - Intronic
1062176061 9:135163711-135163733 CTCTTGGTTGTGTGTGCCTGTGG - Intergenic
1062176651 9:135166966-135166988 CTCTTGGTTGTGTGTGCCTGTGG + Intergenic
1062530299 9:136996711-136996733 CCCCGGGGTGTCTGAGCCTGAGG + Exonic
1062648871 9:137565298-137565320 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062648901 9:137565444-137565466 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062648907 9:137565472-137565494 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062648988 9:137565858-137565880 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062649019 9:137566004-137566026 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062649031 9:137566062-137566084 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062649049 9:137566150-137566172 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062649080 9:137566296-137566318 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062649098 9:137566384-137566406 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062649205 9:137566890-137566912 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062649242 9:137567068-137567090 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062649280 9:137567244-137567266 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062649298 9:137567332-137567354 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062649335 9:137567508-137567530 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062649359 9:137567626-137567648 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062649445 9:137568014-137568036 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062649482 9:137568192-137568214 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062649506 9:137568306-137568328 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062649548 9:137568514-137568536 CCCCTGGGTGACTGTCTGTGAGG + Intronic
1062673017 9:137722880-137722902 CCGGGGTGTGTCTGTGTCTGTGG + Intronic
1062673026 9:137722917-137722939 CCGGGGTGTGTCTGTGTCTGTGG + Intronic
1062673043 9:137722991-137723013 CCGGGGTGTGTCTGTGTCTGTGG + Intronic
1062673052 9:137723028-137723050 CCGGGGTGTGTCTGTGTCTGTGG + Intronic
1062673172 9:137723474-137723496 CCGGGGTGTGTCTGTGTCTGTGG + Intronic
1203372513 Un_KI270442v1:321837-321859 CCCGTGTGTGTCTGTGTGTTTGG + Intergenic
1203376872 Un_KI270442v1:383596-383618 CCCATGTGTGTCTGTGTGTTTGG + Intergenic
1185609586 X:1386564-1386586 CCCTGGTGTGTGTGTGTGTGTGG + Exonic
1187028920 X:15465698-15465720 TCCTTGTGTGTTTGTGTTTGGGG + Intronic
1190264469 X:48819451-48819473 CCCTGGGGTATGTGTGTGTGAGG + Intronic
1191034128 X:56006918-56006940 TGCTTGGGTGTCAGTGTCAGTGG + Intergenic
1191192406 X:57680475-57680497 CTCTTGGGTGGCTGGGACTGTGG - Intergenic
1192178066 X:68898350-68898372 ACCTTGGGGGTATGTGTGTGTGG + Intergenic
1192451506 X:71247935-71247957 CCCTTGGGTATCTGTGTCTCTGG - Intronic
1193486978 X:82097410-82097432 GCTTTGGTTGTCTGTGCCTGGGG + Intergenic
1195279832 X:103320903-103320925 CCTTTGGCTGTCTGTGCTTGTGG + Intergenic
1195709152 X:107760177-107760199 CCCTTGCATGACTGTGGCTGTGG + Intronic
1198049024 X:132930675-132930697 CCCTTGGGTGTCTTTTGGTGGGG - Intronic
1198781343 X:140239327-140239349 GCTTTGGTTGTCTGTGTTTGTGG + Intergenic
1200547339 Y:4533517-4533539 CCCTTTGGGGTCTCTGTCTCAGG - Intergenic
1200631634 Y:5594480-5594502 CCCCTCGGTGTGTGTGTGTGGGG - Intronic
1200909278 Y:8516259-8516281 GGCTTGGGTGGCTGAGTCTGGGG - Intergenic
1201064871 Y:10088332-10088354 CCCGTGTGTGTCTGTGTGTTTGG - Intergenic
1201564082 Y:15347799-15347821 CCCTTGGGTGCCTGCGTGTAAGG - Intergenic
1201908350 Y:19107594-19107616 TTCTTGGGTGTGTGTGTGTGGGG - Intergenic
1202061841 Y:20897013-20897035 CCCTTGGGCTTGTTTGTCTGAGG - Intergenic