ID: 901163301

View in Genome Browser
Species Human (GRCh38)
Location 1:7197218-7197240
Sequence GTGTGTGTCAAATGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901163298_901163301 1 Left 901163298 1:7197194-7197216 CCTCTGAGAACACTGAAGCCACA 0: 1
1: 0
2: 4
3: 29
4: 287
Right 901163301 1:7197218-7197240 GTGTGTGTCAAATGTGAGGATGG 0: 1
1: 0
2: 5
3: 32
4: 262
901163297_901163301 2 Left 901163297 1:7197193-7197215 CCCTCTGAGAACACTGAAGCCAC 0: 1
1: 0
2: 0
3: 24
4: 283
Right 901163301 1:7197218-7197240 GTGTGTGTCAAATGTGAGGATGG 0: 1
1: 0
2: 5
3: 32
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901163301 Original CRISPR GTGTGTGTCAAATGTGAGGA TGG Intronic
900327866 1:2118747-2118769 GTGTGTGTGAGATGAGGGGAGGG + Intronic
901163301 1:7197218-7197240 GTGTGTGTCAAATGTGAGGATGG + Intronic
901681724 1:10916583-10916605 GTCTGGGTCAATTGTGAGGTGGG + Intergenic
901776229 1:11562167-11562189 GTTTGTGTACAGTGTGAGGAAGG - Intergenic
902959574 1:19953431-19953453 GTGTGGGTCAAATGGGAGGAGGG + Intergenic
903969073 1:27107382-27107404 GTGTGTGTGTAGTGTGTGGAGGG - Intronic
904442635 1:30541556-30541578 GTGAGTGTTAAATGGGAGCAGGG + Intergenic
905459869 1:38115575-38115597 GTGTGTGTAAAATGAGAGTCTGG + Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
908641779 1:66231877-66231899 GTGTGGGTCAAGTGTGAGTGAGG + Intronic
909149772 1:71987312-71987334 TTGTGTGTCAGATGTGAAGCTGG - Intronic
911172441 1:94783732-94783754 TTGTGTGTGAATTGTGGGGACGG - Intergenic
911867156 1:103043320-103043342 ATGTGTGTCACATGTCAGGAAGG + Intronic
915097599 1:153474404-153474426 AGGTCTGTCAAAGGTGAGGAAGG - Intergenic
915951832 1:160194742-160194764 GTGTGTGTGATGTGTGTGGATGG - Intronic
916866997 1:168870731-168870753 TTGTGTGTGTAATGTAAGGAAGG - Intergenic
918956621 1:191216945-191216967 TTGTGTTTGAAATGTGAGAAAGG - Intergenic
919030464 1:192235662-192235684 GAGAGTCTCAAATGTGAGTAGGG + Intergenic
919566601 1:199196810-199196832 TTGTGTGTGTAATGTGAGGTAGG - Intergenic
919884500 1:201923276-201923298 CTGTGTGTCAAATTCCAGGATGG - Intronic
920191274 1:204195702-204195724 GTGTGTGTGATATGTGTGTATGG - Intronic
920711931 1:208303346-208303368 GTGTTTGACAAATGTGAGAGAGG - Intergenic
921424964 1:214990846-214990868 GTGTGCGTACATTGTGAGGAGGG - Intergenic
924901327 1:248404206-248404228 GTGTGTATAAAATGGGAGTAAGG + Intergenic
1062989276 10:1800286-1800308 GTGTGTCTGAGATGTGAGGGAGG + Intergenic
1062989287 10:1800366-1800388 GTGTGTCTGAGATGTGAGGGAGG + Intergenic
1062989298 10:1800446-1800468 GTGTGTCTGAGATGTGAGGGAGG + Intergenic
1062989309 10:1800526-1800548 GTGTGTCTGAGATGTGAGGGAGG + Intergenic
1063868979 10:10397878-10397900 TTGTGTGTAAAATGTGAATAAGG - Intergenic
1064064800 10:12172738-12172760 GTGTGTGTCGGCTGTGATGAAGG - Intronic
1064859355 10:19810387-19810409 TTTTGTATAAAATGTGAGGAAGG - Intergenic
1067464777 10:46489594-46489616 GTGTGTGGCACATGTGAGTATGG + Intergenic
1067622417 10:47895059-47895081 GTGTGTGGCACATGTGAGTATGG - Intergenic
1068634298 10:59331425-59331447 GTGAGAGTCAAAGGTGGGGATGG + Intronic
1069316793 10:67114738-67114760 GTGTGTGTAGCATGTGGGGAAGG + Intronic
1071544449 10:86518177-86518199 GTGAGTGTCAAAAGTCATGAGGG - Intronic
1072573487 10:96678626-96678648 GTGTGAGTCAAAAGGGAGCATGG + Intronic
1074826333 10:117217649-117217671 GTGCCTGGCAAATGGGAGGACGG + Intergenic
1076901023 10:133337577-133337599 GTGTGTGTCAAATGTGTGCCTGG - Intronic
1077734495 11:4774798-4774820 TTTTGTGTAAGATGTGAGGAAGG + Intronic
1081159985 11:39738519-39738541 ATATGTGTCAGATGTGGGGAAGG - Intergenic
1082303641 11:50543564-50543586 GTGTTTGTCCAATTTGTGGATGG - Intergenic
1082785583 11:57314511-57314533 GTGTCTGCCATATGTGAGGGAGG - Intronic
1087692363 11:101336353-101336375 GAGTGAGTCATTTGTGAGGAGGG + Intergenic
1088146209 11:106682876-106682898 GTTTGGATCAAGTGTGAGGAAGG + Intronic
1090759340 11:129822393-129822415 GTGTGCGTCATCTGTGAGCATGG + Intronic
1090961172 11:131558281-131558303 GAGTGTGTCAGGTATGAGGAGGG - Intronic
1093643238 12:21552582-21552604 GTATGTAGCAAATGTCAGGAAGG + Intronic
1094053759 12:26247584-26247606 GTGTGTGTCACATGTGTGAGTGG - Intronic
1095214929 12:39537140-39537162 GTGTGTGTCTAGAGTGCGGAGGG - Intergenic
1095862620 12:46934861-46934883 GTGTGTTGCAATTGTCAGGACGG + Intergenic
1097022142 12:56027952-56027974 GTGTCTGTCCAGTGGGAGGAGGG + Intronic
1098251890 12:68578979-68579001 GTGTATTTCAAATGTGGGGCAGG - Intergenic
1098302385 12:69067405-69067427 GTGAGTGTAAAATGCAAGGACGG + Intergenic
1098525563 12:71482904-71482926 GTGTGTGTGATATATGAAGATGG - Intronic
1098784627 12:74735920-74735942 GTGGGAGTAAACTGTGAGGATGG - Intergenic
1099696030 12:86020556-86020578 GTTTGTGTAAAGTGTAAGGAAGG - Intronic
1100389609 12:94136960-94136982 GTGTGTGTGAAATTTGATTAAGG - Intergenic
1101135503 12:101739339-101739361 GTGTGTTTCAGGTGTGAGCAGGG - Exonic
1101347936 12:103903752-103903774 GTGTGTGGAAAATGTGTGTAAGG - Intergenic
1101714544 12:107299107-107299129 GTGTGTGTCAAATGTCATAAGGG + Intergenic
1101949622 12:109164531-109164553 CTGTGTGTGAAATGCTAGGAAGG - Intronic
1102511755 12:113420815-113420837 ATGTGTGTCTAAAGCGAGGATGG + Intronic
1107391739 13:39972096-39972118 CTCTGTGTAAAATGTAAGGAAGG - Intergenic
1107568883 13:41635242-41635264 GTGTGTATCATATGTAGGGATGG + Intronic
1108142728 13:47442338-47442360 GTGTATATCAAATGTATGGATGG + Intergenic
1109259548 13:60127706-60127728 GTGTTTGTCAAAAGCCAGGATGG + Intronic
1109874593 13:68383943-68383965 GTGTGTGTCAGATTTCAGCAGGG + Intergenic
1110046363 13:70837734-70837756 GTGTGTATCACATATGTGGAAGG - Intergenic
1110183010 13:72639433-72639455 GTGTGTGTCAAAGGAGACCAAGG + Intergenic
1111017019 13:82394468-82394490 GTGTTTGTCGAGTGGGAGGAAGG - Intergenic
1111770259 13:92587450-92587472 GTCTGTCTCCAAAGTGAGGATGG + Intronic
1113756494 13:112815246-112815268 GTGTGTCTGAAGGGTGAGGAAGG - Intronic
1113756512 13:112815368-112815390 GTGTGTCTGAAGGGTGAGGAAGG - Intronic
1113756528 13:112815488-112815510 GTGTGTCTGAAGGGTGAGGAAGG - Intronic
1113939731 13:114012324-114012346 GTGTGTGTGGAGTGTGTGGACGG - Intronic
1113939744 13:114012393-114012415 GTGTGTGTGGAGTGTGTGGACGG - Intronic
1114854193 14:26417804-26417826 GTGTGAGTTAAATGAAAGGAAGG - Intergenic
1115071865 14:29333198-29333220 GTGTGTGTGTAGTGTGAGGTTGG - Intergenic
1115385520 14:32791791-32791813 TTTTGTGTAAAATGTAAGGAAGG + Intronic
1116521510 14:45853226-45853248 GTGTGTATCATATGTGGGTATGG - Intergenic
1116699506 14:48221620-48221642 GTTTCTTTGAAATGTGAGGAAGG + Intergenic
1117218637 14:53578782-53578804 GTGTGAGTGAACTTTGAGGATGG + Intergenic
1118227758 14:63918838-63918860 GTGTTTCTCAAATTTGAGAAGGG - Intronic
1118898509 14:69967010-69967032 TCTTGTGTCCAATGTGAGGAAGG - Intronic
1119110235 14:71965776-71965798 GTCTGTGTGAAAGGTAAGGAGGG + Intronic
1120652609 14:87152139-87152161 GTGTTTAGCAAATGTGAAGAGGG + Intergenic
1120763857 14:88310490-88310512 GTGTGTGTCAGCTGTGGAGAGGG + Intronic
1122858082 14:104569557-104569579 CTGTCTGGCAAATGTGGGGAGGG - Intronic
1127419549 15:58791666-58791688 GTGTGTGTGTAATGTGACCAAGG + Intronic
1127878518 15:63133988-63134010 AGTTGTGTCAAATGTTAGGAGGG + Intronic
1130650274 15:85758501-85758523 GTGTGTCTCAGAGGTGAGTATGG - Intergenic
1132639570 16:971406-971428 GTGAGTGTCAGCTGTGAGGCAGG - Intronic
1134202576 16:12211050-12211072 GTCTGTGTAAAAAGTGAGGGAGG - Intronic
1139219051 16:65160303-65160325 GTATTTGTCAACTGTGTGGAAGG + Intergenic
1139622133 16:68154093-68154115 GTGTGTGTGTAATGTGGAGATGG + Intronic
1140215277 16:73001999-73002021 GTCTCTGTCATCTGTGAGGATGG - Intronic
1141880015 16:86851615-86851637 GTGTGTGCCATGTGTGGGGAAGG + Intergenic
1142475188 17:184488-184510 GTGTGAGTTAAAGGTGAGGATGG + Intergenic
1143017539 17:3898911-3898933 GTGAGTGTCCAGTGTGAGGGTGG - Intronic
1144738460 17:17568006-17568028 GTGTGTGTCAGAAGTTAGGATGG - Intronic
1144759168 17:17697671-17697693 GTGTGTGTAAAAAGTGAGTTGGG + Intronic
1144821053 17:18074789-18074811 CTGTGTGTCAAATGTGGGGGTGG + Intergenic
1145177126 17:20710674-20710696 TTTTGTGTCAAAAGGGAGGAAGG - Intergenic
1145975840 17:28983934-28983956 GTGTCAGACAAATGGGAGGAGGG + Intronic
1146853254 17:36241538-36241560 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1146869162 17:36365428-36365450 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1147058623 17:37855370-37855392 TTTTGTGTCAAAAGGGAGGAAGG - Intergenic
1147072036 17:37966059-37966081 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1147083562 17:38045591-38045613 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1147099508 17:38169558-38169580 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1148682053 17:49479759-49479781 CTGTGTTGCAAATGTGGGGAAGG + Intergenic
1149001653 17:51763783-51763805 GTGTATGTCAGAGGTGAAGAAGG - Intronic
1149295561 17:55259299-55259321 GTGTGTTTCAAATCAGAGGATGG - Intergenic
1149607467 17:57935364-57935386 GTGTGTGTCTAATGGAAGGGAGG - Intronic
1150082521 17:62252848-62252870 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1156842090 18:41620865-41620887 CTGTTTGTCAAATGTGATAATGG - Intergenic
1157049014 18:44138061-44138083 ATGTGTGTCATATCTGAGGCTGG - Intergenic
1157086681 18:44587356-44587378 GGCTCAGTCAAATGTGAGGATGG + Intergenic
1158635302 18:59150897-59150919 GTGTCTGTGAGATTTGAGGAGGG - Intronic
1159757438 18:72383070-72383092 GTTGGTGTGAAATGTGAGAAAGG + Intergenic
1159990479 18:74901008-74901030 GTGTGTGTATAATGTGAACAGGG + Intronic
1160513681 18:79466766-79466788 GTGTTTGTCACATTTGACGATGG - Intronic
1161917445 19:7239462-7239484 GTATATGTCAAATGTGGGCAAGG - Intronic
1165707372 19:37986115-37986137 CTTTGTGTCAAAGGTGGGGAAGG + Intronic
1166158421 19:40933191-40933213 GTGTGTGTCAAGGCTGAGGAAGG + Intergenic
1167049562 19:47070088-47070110 GTGTGTGACACATGTGAGCATGG + Intronic
1167520429 19:49951487-49951509 GTTGGTGTCAGAAGTGAGGATGG + Intronic
1168068049 19:53930804-53930826 GTGTGTTTAAAAAGTGAGGTGGG - Intronic
925363560 2:3295923-3295945 GTGTGTGTGCAAGGAGAGGATGG - Intronic
925519021 2:4720303-4720325 GTGTTTGTCAAGGGTCAGGAAGG + Intergenic
927140488 2:20126964-20126986 GTGTGTATGCAATGTGATGAGGG + Intergenic
928432587 2:31233418-31233440 TTGTGTGGCTAATTTGAGGAAGG - Intronic
928858584 2:35828715-35828737 GCATGTGGCATATGTGAGGATGG - Intergenic
929578224 2:43066071-43066093 GTGTGTGGCATATGGGAGGATGG - Intergenic
930627355 2:53712731-53712753 GTGTGTGTTCAATATGATGATGG - Intronic
931092903 2:58905629-58905651 GTGTGGGTCAAATGGGAGGATGG + Intergenic
931794240 2:65694069-65694091 TTGTGTGTCAAAATAGAGGAGGG + Intergenic
932822639 2:74914684-74914706 ATCTGTGTCAAATGTGGGCAGGG + Intergenic
932875676 2:75448757-75448779 GTCTGTGGAAAATGAGAGGAAGG + Intergenic
940185734 2:150983245-150983267 ATCTGTGTCAAATCTGAGTATGG + Intergenic
940852253 2:158699643-158699665 GTGTGTGTGACGTGTGAGGCCGG + Intergenic
942748366 2:179262187-179262209 GTGGTTGTCAAATATGGGGAAGG + Intronic
942970645 2:181954072-181954094 GTGTTTCTCAAATGAGAGAAAGG + Intergenic
943202771 2:184850083-184850105 GTGGGGGTAAAAAGTGAGGATGG + Intronic
943570713 2:189571004-189571026 CTGTGTGTCATATGAGGGGACGG + Intronic
944643467 2:201753210-201753232 TTGTGTGTAAAATGTCTGGATGG - Exonic
944702278 2:202256880-202256902 ATTTGTGTCAAATTTGAGGAAGG + Intergenic
946187678 2:217990380-217990402 GTGTGTGGCCTATGTGTGGATGG - Intronic
948176653 2:235948790-235948812 CTGTGTGGCAAGTGGGAGGATGG - Intronic
948274689 2:236699371-236699393 GTGTGTGTGAAATCTCAAGAAGG + Intergenic
1168930216 20:1616529-1616551 TTGTGTGTCATGTGAGAGGAAGG - Intronic
1169767969 20:9169196-9169218 TTGTGTGTTAAGTGAGAGGAAGG - Intronic
1170898503 20:20437574-20437596 GTGTGTGTGAAGTGTGGGAAGGG - Intronic
1172083128 20:32358316-32358338 GTGTGTGTGAAGAGTGAGGAGGG - Intergenic
1173124432 20:40323664-40323686 GTGTGTGACTCATGTGTGGAGGG + Intergenic
1174845698 20:53941120-53941142 GTGTGTGTGAAGTGGGAGGAGGG + Intronic
1175060448 20:56237265-56237287 GTGTTTGTAAAATGAGAAGAAGG + Intergenic
1176666875 21:9695901-9695923 GTGGGTGTGCAATGGGAGGAAGG + Intergenic
1176672385 21:9746597-9746619 GTGTGTGTGTAATGTGATGTGGG + Intergenic
1177234618 21:18372132-18372154 GTGTGTGTCTACAGTGAGGGAGG + Intronic
1177656694 21:24025944-24025966 TTGTGTGTGATATGTGGGGAGGG - Intergenic
1178275992 21:31237333-31237355 GTGTGTGTCAGACTTGAGGAAGG - Intronic
1178914358 21:36698603-36698625 GTGTGTGTGTAATGGGGGGAGGG + Intergenic
1180085569 21:45506596-45506618 TCGTGTGGCAAAGGTGAGGACGG + Intronic
1182388991 22:29974266-29974288 GTGAGTTTCATAGGTGAGGAAGG - Intronic
1183975605 22:41510285-41510307 GTCTGTGTTAAGTGTGAGGAAGG - Intronic
1184347162 22:43920887-43920909 GTCTGTGTCTGATGTGAGCAGGG + Intergenic
1184391137 22:44204345-44204367 ATGTGCGTCCAATGTGATGACGG - Intronic
1185271856 22:49933569-49933591 GTGTGGGACACACGTGAGGAGGG - Intergenic
950101753 3:10361467-10361489 CTGTGTGTCTAATGTGTGAAGGG - Intronic
950268585 3:11594480-11594502 GGATGTGTCACCTGTGAGGAAGG - Intronic
950666947 3:14503489-14503511 GTGTGTGTGCAATGGGAGGAAGG - Intronic
950825879 3:15820596-15820618 GTGTGTGTCAGATGTCTTGAAGG - Intronic
951138152 3:19128918-19128940 GTGTGTGTCATGTGTGATAAAGG + Intergenic
951413919 3:22399526-22399548 TTTTGTATCTAATGTGAGGAAGG + Intergenic
951807227 3:26659291-26659313 GTGAGTTTCATATGTGAGCATGG - Intronic
955476678 3:59343449-59343471 CTGGGTGTCAAATGGCAGGAAGG - Intergenic
955787898 3:62559144-62559166 AAGTGTGTCAAATGCAAGGAAGG - Intronic
955863316 3:63355484-63355506 GTGAGTGTGAAATGTGAAGTAGG - Intronic
956025763 3:64981556-64981578 TTTTGTGTAAGATGTGAGGAAGG - Intergenic
956470931 3:69566207-69566229 GTGTGTGGGCAAGGTGAGGAGGG - Intergenic
956588658 3:70889927-70889949 GTGTGTGACAAATGTGACTCTGG - Intergenic
959585137 3:108018767-108018789 GTGTGAGGCAACAGTGAGGAAGG - Intergenic
960737831 3:120799840-120799862 GTGAGAGTCAAATCTAAGGAGGG + Intergenic
961054079 3:123772423-123772445 TTCTGTGTGTAATGTGAGGAAGG - Intronic
962378953 3:134881254-134881276 GTGTGTGTTTCATGTGTGGATGG + Intronic
963724044 3:148899314-148899336 CAATGTGTCAAATGTGGGGAAGG - Intergenic
964223735 3:154373095-154373117 GTTTGTGTGAAATGAGAAGAGGG + Intronic
965870411 3:173257891-173257913 GTCTGAGTCAAAGGGGAGGAAGG - Intergenic
966278644 3:178205364-178205386 GTGTGTGTCAAGTGTGTGTATGG + Intergenic
967376546 3:188809851-188809873 TTTTGTGTAAGATGTGAGGAAGG + Intronic
968955085 4:3714495-3714517 GTGTGTGTCATGTCTGTGGAGGG + Intergenic
968955104 4:3714875-3714897 GTGTGTGTCATGTCTGTGGAGGG + Intergenic
970868458 4:20785100-20785122 CTGTTTCTCAAATGTGAGGCAGG + Intronic
970936758 4:21580680-21580702 GTGTGCGTTAAATGTGTGCATGG - Intronic
970984684 4:22142789-22142811 TTTTGTGTAAAATGTGAGGTAGG + Intergenic
972843111 4:42954713-42954735 TTGTGGTCCAAATGTGAGGAGGG + Intronic
973226996 4:47797278-47797300 GTATATGTAAAATTTGAGGAAGG + Intronic
973588250 4:52413721-52413743 GTGTGTGACGAAAGGGAGGATGG - Intergenic
975322779 4:73027031-73027053 TTTTGTGTAAAGTGTGAGGAAGG - Intergenic
976028849 4:80725866-80725888 CTGTGTGCCAAAGCTGAGGAGGG + Intronic
976351566 4:84065952-84065974 TTGTTTTTCAAATGAGAGGATGG + Intergenic
977005548 4:91565070-91565092 GTGTGTGTGTGATGTGAAGAAGG + Intronic
979894521 4:126143217-126143239 GTGTGTTTCATATGAGAGAAGGG - Intergenic
982964047 4:161879577-161879599 GTGTGGGACAAGAGTGAGGAAGG - Intronic
983028566 4:162769377-162769399 ATGTATGTTAAATTTGAGGAGGG + Intergenic
984359195 4:178706952-178706974 TTGTGTGTCCAATGTGAACAGGG + Intergenic
984538330 4:181004635-181004657 GCGTCTGGCCAATGTGAGGAAGG + Intergenic
985035243 4:185832482-185832504 ATTTGTGTCAAATGAGAGTATGG + Intronic
985402344 4:189605233-189605255 GTGTGTGTGTAATGTGATGTGGG - Intergenic
985408134 4:189656447-189656469 GTGGGTGTGCAATGGGAGGAAGG - Intergenic
986906592 5:12501838-12501860 GTGTCTGTCACATGTCAGGGAGG + Intergenic
987290381 5:16503041-16503063 CTGTTTGTAAAATGTGATGAAGG - Intronic
987886641 5:23822056-23822078 GTGTGTGTCCATTGTGACTAAGG - Intergenic
988484107 5:31654224-31654246 GTGTGTGTCAAATGCTTTGAGGG - Intronic
989850875 5:46208313-46208335 GTGTTTGTCAAATGTGAGAATGG + Intergenic
990450727 5:55929680-55929702 GTGTCTATGAAATGTGGGGAGGG - Intergenic
990550487 5:56872244-56872266 GTGTGTGACATATGTGATAATGG + Intronic
991670923 5:69046845-69046867 GTGGGTCTCAAATGTGAGCATGG + Intergenic
992401633 5:76417147-76417169 GTGTGTGTCTACAGTGGGGAGGG + Intronic
995487979 5:112658172-112658194 GTGAGTGGAAAAAGTGAGGAAGG - Intergenic
995819468 5:116212516-116212538 GTGTGTGTAGAATGTGAGGGGGG + Intronic
996106829 5:119514900-119514922 TTGTGTATCAAATGTGAGTTTGG + Intronic
996340380 5:122431541-122431563 GTTTGGGACAAATGAGAGGAGGG + Intronic
997723462 5:136100008-136100030 GAGTCTGTCAAATGGGAGGGGGG - Intergenic
998208089 5:140173719-140173741 GTGTTTGGCAGATCTGAGGAGGG - Intergenic
998421277 5:141989090-141989112 GTGTGTGTCCAGAGTGAGCAAGG + Exonic
999379127 5:151108141-151108163 GTGTGTGTCAAGTGTGTGTGTGG + Intronic
999668912 5:153941225-153941247 GGGTGTGGCAAATGTGGGAAGGG - Intergenic
999745946 5:154591837-154591859 GTGTGTGTCCCATGTGAGTATGG - Intergenic
999987669 5:157020233-157020255 GTGTGTGTATTGTGTGAGGAAGG + Intergenic
1000052943 5:157577649-157577671 TTGTGTGAAAATTGTGAGGAAGG + Intergenic
1003333000 6:5145118-5145140 GTGTGTGTGAAATGCCAGGTTGG - Intronic
1004638324 6:17489718-17489740 GTGTTTGTTAAATGAGAGAATGG - Intronic
1004927255 6:20427726-20427748 GTGTGTGGCAGGTGTCAGGAAGG - Intronic
1005002234 6:21253559-21253581 GAGGGTGTGAGATGTGAGGAAGG - Intergenic
1005132892 6:22531706-22531728 GTGTGTGGCAAATCTGGGAAAGG + Intergenic
1006007658 6:31015567-31015589 CTATGAGTCAAATGTGAGGGTGG - Intronic
1008261326 6:49369522-49369544 ATGTGTCTCAAATTTGAGTAAGG - Intergenic
1012113840 6:95268450-95268472 ATGTGGGTTAAGTGTGAGGAAGG - Intergenic
1012208330 6:96489320-96489342 GTGTGTGTGATGAGTGAGGAAGG - Intergenic
1018299592 6:162387521-162387543 GTGTGTGTGTGTTGTGAGGAGGG - Intronic
1018539260 6:164860401-164860423 GTGTGTGTTAAATGAAAGTATGG + Intergenic
1020180085 7:5915638-5915660 GTGGGTGTCAGAAGTGAGGATGG - Intronic
1020302848 7:6809244-6809266 GTGGGTGTCAGAAGTGAGGATGG + Intronic
1020365663 7:7378252-7378274 GTGTTTATCAAATGTGGGGAAGG - Intronic
1020796412 7:12683037-12683059 GGCTGTGGCAAAGGTGAGGAAGG + Intergenic
1020810195 7:12841766-12841788 GTGTGTCTCATATGTGAGATGGG - Intergenic
1021231317 7:18088213-18088235 GTGTGTGTAAAATATGGGAAAGG + Intronic
1021835695 7:24671708-24671730 TTTTGTGTCAAATGTGAGGAGGG + Intronic
1022119672 7:27295787-27295809 GTGTGTGTTTAAAGAGAGGAAGG + Intergenic
1023289355 7:38653678-38653700 TTGTGTGTAAAATGAGAGGCAGG + Intergenic
1024299612 7:47877017-47877039 GTGAGGGTGAAATGAGAGGATGG - Intronic
1024402441 7:48940543-48940565 GCCTGTGTCCAATGTGAGGAAGG + Intergenic
1024483511 7:49890087-49890109 ATGGGTGTTAAATGTGAGGTGGG - Intronic
1025522850 7:61761644-61761666 GTGTTTGTCAAATCTGCGAAGGG - Intergenic
1025546603 7:62180671-62180693 GTGTTTGTCAAATCTGCGAAGGG - Intergenic
1025575184 7:62629514-62629536 GTTTGTGTCCACTGTGAGAATGG - Intergenic
1030139742 7:106292398-106292420 GTGTGTGTAAATTTTGAGGTAGG - Intergenic
1030623587 7:111818725-111818747 GTGTGGCTGAAATGTGGGGAGGG - Intronic
1032777685 7:135131032-135131054 GTGTGTGTCCAGAGTGAGCAAGG + Intronic
1033291706 7:140090603-140090625 GTGTGTGTTACATGTGGGGAAGG - Exonic
1034062627 7:148107085-148107107 GTGTGTTTCACATGTTTGGAGGG - Intronic
1034475620 7:151279932-151279954 GTTAGTTTCAAAAGTGAGGAGGG + Intergenic
1034514048 7:151559907-151559929 GAGTGTGTGAAATGAGAGGAAGG + Intronic
1036632766 8:10526785-10526807 GTGTGGATGAAATGAGAGGATGG - Intronic
1037539479 8:19857419-19857441 GTGGGTGTCAAAAATGAGGGAGG - Intergenic
1042530454 8:69809746-69809768 GTGTGTGTGTTTTGTGAGGAGGG + Intronic
1043803119 8:84636788-84636810 ATATTTTTCAAATGTGAGGAGGG + Intronic
1043866517 8:85381354-85381376 TTTTGTGTAAGATGTGAGGAAGG + Intronic
1045278113 8:100724753-100724775 GTGTGTGACAAAAGAGAGGGAGG - Intergenic
1046097599 8:109579362-109579384 GGGTGTGTGAAAGGTGGGGAGGG - Intronic
1048094171 8:131273466-131273488 CTATGTGTCAAATGTAAGTAGGG + Intergenic
1048254164 8:132893104-132893126 GTGTGTGGTATATGTGTGGAGGG + Intronic
1048979008 8:139693085-139693107 GTGTTTGTCAGAGGTGTGGAAGG - Intronic
1051094990 9:13456407-13456429 GTGTGTGACAGATGTGTGGTAGG - Intergenic
1052143258 9:25015566-25015588 GAGGGTGTCAGATGTGATGACGG + Intergenic
1055255199 9:74361694-74361716 GTGTGTGTCAAATGTGACTCAGG - Intergenic
1056026647 9:82504498-82504520 GTGTATGTTTAATGTGAGAAAGG + Intergenic
1056091801 9:83213469-83213491 GTGTCTGTTAGATTTGAGGAGGG - Intergenic
1056186878 9:84143591-84143613 GTGTGTGGGAAATGGCAGGAGGG + Intergenic
1057706573 9:97399207-97399229 GTGTGAGTCAGACCTGAGGAAGG + Intergenic
1057817706 9:98307744-98307766 GTGTGGATGAAATGGGAGGATGG + Intronic
1058994378 9:110285372-110285394 GTGTGTGGGCAATGGGAGGAGGG + Intergenic
1059124632 9:111672630-111672652 GTGTGTGTAAAACATGAGGAGGG + Intergenic
1059471823 9:114510851-114510873 GTGTGCATCAAATGTGATGATGG + Intergenic
1060400645 9:123347367-123347389 GTGTGTGTGATGTGTGTGGAGGG + Intergenic
1060547473 9:124469763-124469785 ATGCGTGTCACATGTGGGGATGG + Intronic
1060707285 9:125815712-125815734 GTGTGTGGAAAATGTGAGGAGGG + Intronic
1060876155 9:127085009-127085031 GTGTCTGTGAACTGTGAGCATGG + Intronic
1061419854 9:130467138-130467160 GTGTGTGTCACTTGGGGGGATGG + Intronic
1203659222 Un_KI270753v1:25860-25882 GTGGGTGTGCAATGGGAGGAAGG - Intergenic
1189117373 X:38356827-38356849 GTATGTGGCAACAGTGAGGAGGG + Intronic
1190496608 X:51033168-51033190 GTTGGTGTCAGATGTGAGGGTGG + Intergenic
1190509364 X:51160769-51160791 GTTGGTGTCAGATGTGAGGGTGG - Intergenic
1192543476 X:71994322-71994344 GTGTGTGTAAAAGTTGAGGAAGG + Intergenic
1193367162 X:80648915-80648937 GTGTGTGTCTATTTTGAGGTGGG - Intergenic
1193651411 X:84138835-84138857 GTGTGTGTACATTCTGAGGAAGG + Intronic
1201891537 Y:18948308-18948330 GTATATGTCAGGTGTGAGGAAGG + Intergenic