ID: 901167154

View in Genome Browser
Species Human (GRCh38)
Location 1:7229171-7229193
Sequence CTGAGAGAGCTCTAGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901167144_901167154 19 Left 901167144 1:7229129-7229151 CCTGGGGCAGAGGAGGGAGAGTG 0: 1
1: 1
2: 8
3: 116
4: 1081
Right 901167154 1:7229171-7229193 CTGAGAGAGCTCTAGGGGACAGG 0: 1
1: 0
2: 1
3: 20
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901167154 Original CRISPR CTGAGAGAGCTCTAGGGGAC AGG Intronic