ID: 901167154

View in Genome Browser
Species Human (GRCh38)
Location 1:7229171-7229193
Sequence CTGAGAGAGCTCTAGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901167144_901167154 19 Left 901167144 1:7229129-7229151 CCTGGGGCAGAGGAGGGAGAGTG 0: 1
1: 1
2: 8
3: 116
4: 1081
Right 901167154 1:7229171-7229193 CTGAGAGAGCTCTAGGGGACAGG 0: 1
1: 0
2: 1
3: 20
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901167154 Original CRISPR CTGAGAGAGCTCTAGGGGAC AGG Intronic
900743373 1:4343811-4343833 ATGAGAGAGCTCTGGGGAAGGGG + Intergenic
901167154 1:7229171-7229193 CTGAGAGAGCTCTAGGGGACAGG + Intronic
901660159 1:10794261-10794283 GTGAGAGCGCACGAGGGGACTGG - Intronic
903215743 1:21842454-21842476 CCGAGAGAACTCTTGGGTACCGG - Intronic
906150643 1:43585552-43585574 CAGGGAGAGCTCTAGGGGCTAGG - Intronic
906200732 1:43958596-43958618 GTGAGTGAGCTCTGGGGGCCAGG + Intronic
906745518 1:48219530-48219552 CTGAGAAAGCTTTATGGGAAGGG - Intergenic
912812567 1:112805041-112805063 CTGGGAGTGCTCTATTGGACTGG + Intergenic
913024585 1:114824337-114824359 CTGGGAGAGCTACAGGAGACTGG - Intergenic
913142250 1:115953225-115953247 CTGAGACAGCACTAGGGGTATGG - Intergenic
913198249 1:116475643-116475665 CTGAGAGAACTGTGGGGGCCAGG + Intergenic
914789803 1:150867762-150867784 ATGAGAGAGCATTAGGGGAATGG - Intronic
916426961 1:164689855-164689877 CTGAAAAAGCTCAAGGGGAGGGG - Intronic
917758062 1:178123577-178123599 CTGGAAGAGCTCTAGGAGAGAGG - Intronic
917821165 1:178765665-178765687 CTGAGAGCGCTATGGGAGACAGG + Intronic
921248783 1:213276874-213276896 CTGAGAAAGGTCTAGGAAACAGG - Intergenic
921678145 1:218000358-218000380 CTGAGAGAGTGGTAGGGGATGGG - Intergenic
923269781 1:232345278-232345300 ATGAGAGAGCACTAGGGGGATGG + Intergenic
1064427862 10:15245760-15245782 CTGGGAGGGCTACAGGGGACAGG + Intronic
1064867622 10:19899179-19899201 CTGAGAGGCCTCAATGGGACTGG - Intronic
1073547004 10:104358567-104358589 CTGAGAGAGCTTAAGGGCAGTGG - Exonic
1076115904 10:127899847-127899869 CTGAGAGATTTCTGGGGGAGAGG - Intergenic
1076319462 10:129567215-129567237 CTGTGAGAGGTGGAGGGGACGGG - Intronic
1076474608 10:130743490-130743512 CGGGGAGAGCTGGAGGGGACAGG + Intergenic
1077233262 11:1468146-1468168 CTGAGAGTGCTGTAGGGCACAGG - Intergenic
1077304025 11:1859919-1859941 CTGAGAGAGCCCATGGGGACAGG - Intronic
1077496348 11:2888360-2888382 CTGAGAGAGCAGTAGAGGAAAGG + Exonic
1078714879 11:13830396-13830418 CTGGGAGTGCTATAGGAGACTGG + Intergenic
1081864936 11:46354158-46354180 CCCAGGGAGCTCTAGGGGGCTGG + Intronic
1082919196 11:58473863-58473885 CTGGGAGTGCTATAGGAGACTGG - Intergenic
1083234233 11:61341645-61341667 CTGGGGGAGCTCCTGGGGACTGG + Intronic
1083236465 11:61354022-61354044 CTGGGTGAGCTCGAGGGGAGAGG - Intronic
1083310413 11:61780904-61780926 CTGGGAGAGCTTGAGGGGAGAGG - Intronic
1084455936 11:69268193-69268215 CTTAGAGAGCTCCAGGGACCAGG - Intergenic
1084547678 11:69822511-69822533 CTGGGGGTGCTCTGGGGGACAGG - Intergenic
1085444067 11:76589174-76589196 CTGAGCGGGCACTAGGGAACAGG - Intergenic
1085771123 11:79326748-79326770 ATGAAAAAGCTCTAGGGAACGGG - Intronic
1087298017 11:96399897-96399919 GTGAGACAGCTTTAGGGCACAGG + Intronic
1089184816 11:116607585-116607607 AACAGAGAGCTCTAGGGGAGGGG + Intergenic
1089505310 11:118958358-118958380 AGGAGAGGGCTCTAGGGGAGAGG - Exonic
1094328699 12:29269136-29269158 CTGGGAGTGCTATAGGAGACTGG + Intronic
1094662705 12:32485838-32485860 CTGAGAGAGCTCTAGAATACCGG - Intronic
1094864965 12:34521712-34521734 CTGGGAGTGCTATAGGAGACTGG - Intergenic
1097225967 12:57476953-57476975 CTGAGTGAACCCTAGGGGAGAGG + Exonic
1099487636 12:83248311-83248333 ATGAGAGAGCACTAGGGGGATGG - Intergenic
1099507334 12:83495593-83495615 CTGAGAGAGTTTTAGTGGCCTGG - Intergenic
1099740259 12:86625606-86625628 CTCAGAGACCTCTGGGGCACTGG + Intronic
1102525169 12:113507411-113507433 CTGAGAGAGTTCTGATGGACAGG - Intergenic
1102588217 12:113938161-113938183 CAGAGAGAGCTTTTGGTGACTGG + Intronic
1102898571 12:116618245-116618267 CTCAGAGAGATGTAGGGGCCTGG - Intergenic
1103150650 12:118635751-118635773 CTGAGAGAGCTATAGGAGTATGG + Intergenic
1103182507 12:118925940-118925962 CTGAAAGTGCTCTAGGAGACAGG - Intergenic
1103780345 12:123394666-123394688 CTGGGACAGCATTAGGGGACAGG - Intronic
1104031934 12:125071092-125071114 GTGAGTGAGCTCTTGGGGACGGG - Intronic
1104911808 12:132243379-132243401 CAGAGAGAGCTCCGGAGGACGGG - Intronic
1106249333 13:27971914-27971936 CTGACAGAACTCTAGGAGCCTGG + Intergenic
1106582904 13:31032904-31032926 CTGAGTCAGATCTTGGGGACTGG - Intergenic
1108086219 13:46796525-46796547 CTCAGAGCGCTGTGGGGGACTGG - Intronic
1110687619 13:78393881-78393903 CTGATACAGCACTAGAGGACTGG + Intergenic
1113320795 13:109230161-109230183 ATGAGAGAGCACTAGGGGAATGG + Intergenic
1113420326 13:110165991-110166013 CTGAGGGAACTCCAGGGGAGGGG - Intronic
1114064848 14:19052493-19052515 CTGAGAGAGGTCAAGGTGAGAGG + Intergenic
1114097413 14:19347509-19347531 CTGAGAGAGGTCAAGGTGAGAGG - Intergenic
1114484529 14:23055006-23055028 GTGAGAGAGCTCCAGAAGACGGG + Intronic
1120502205 14:85310765-85310787 ATGAGACAGCACTAGGGGAATGG + Intergenic
1120881744 14:89419020-89419042 CTGAGAAAGCAGGAGGGGACTGG - Intronic
1121464006 14:94102522-94102544 CTGGGACAGCTCTTGGGGCCTGG + Exonic
1124618575 15:31260900-31260922 CAGAGGGAGCTCTAGGGTGCTGG + Intergenic
1125888856 15:43250821-43250843 CTGATTGAGCTACAGGGGACTGG + Intronic
1127258300 15:57309315-57309337 GTTAGAGAGCCCTAGGGGATGGG - Intergenic
1127336037 15:57985354-57985376 GGGAGAGAGCTCTAGGGGTTGGG - Intronic
1128242382 15:66109802-66109824 CTGAGAGACCTCTTAGGGAGAGG - Intronic
1129888475 15:79055295-79055317 CTGAGTGGGCTCTAGGAGAATGG - Intronic
1130540461 15:84817691-84817713 CTGAGAGGGCTCGAGGGCGCAGG - Intronic
1131810147 15:96164673-96164695 ATGTTAGAGCTCTAGAGGACCGG + Intergenic
1133162067 16:3918646-3918668 CTGAGAGCGCTATGGGAGACTGG - Intergenic
1136566948 16:31076377-31076399 CCGAGAGAGCTCTGGGAGGCTGG - Exonic
1137377587 16:47966413-47966435 CTGAGAGGAATCTAGGAGACAGG + Intergenic
1139701092 16:68708466-68708488 CCGAGAGAAATCTAGGGGAATGG - Intronic
1141659727 16:85435470-85435492 CTGTGACAGATCTAGGGCACAGG - Intergenic
1142294523 16:89211627-89211649 CAGAGAGAGCTGCAGGGGAGGGG + Intergenic
1145974984 17:28978701-28978723 CTTAGAGAGGTGTAGGGGGCAGG + Intronic
1146394809 17:32456336-32456358 CTGAGTGAGCTCTAGGTTATGGG - Intronic
1146467158 17:33095396-33095418 CTGAGAGATCTCTTGGGGACAGG + Intronic
1147889137 17:43704759-43704781 ACGAGAGGGCTCTAGGGGCCTGG - Intergenic
1149267807 17:54946668-54946690 CAGACAGAGCTCTAGGAGAAGGG - Intronic
1151366083 17:73617266-73617288 GTGAGAGGGCTCCAGGGGAGGGG + Intronic
1152626187 17:81388894-81388916 GTGAGAGGGCCCTAGGGGAAGGG - Intergenic
1152791732 17:82283712-82283734 CTGGCAGAGCTCTAGAGGTCAGG + Intergenic
1154099846 18:11462488-11462510 ATGAGACAGCACTAGGGGAAGGG - Intergenic
1155356557 18:24959214-24959236 CTGAGACAGCTCGAGGGCTCAGG - Intergenic
1159868240 18:73730997-73731019 CTGAGAGAGCTATAAAGGATAGG - Intergenic
1160071781 18:75635351-75635373 CTGGGAGAGCTCCAGAGGAAAGG - Intergenic
1160564234 18:79777110-79777132 CTGAGACAGCTCTAGGATAGAGG + Intergenic
1163596409 19:18223674-18223696 CTCAAAGAGCTCTCGGGGATGGG - Intronic
1164340214 19:24387113-24387135 CTGGGAGAGCTACAGGAGACTGG + Intergenic
1164401170 19:27903293-27903315 CTGAGAGGTCTCCAGGGGGCTGG + Intergenic
1168290643 19:55355365-55355387 CAGAGAGAGCTTTGGGGGACAGG + Intronic
925049150 2:797695-797717 CTGAGAGAGCTCTGTGACACGGG - Intergenic
925885495 2:8390967-8390989 TGGAGGGAGTTCTAGGGGACAGG + Intergenic
928399783 2:30969450-30969472 CTTTGAGAGCTTTTGGGGACAGG + Intronic
929913036 2:46108503-46108525 CTCAGAGAGGTCAAGGGGAATGG + Intronic
930520622 2:52462058-52462080 CTGAGGGAGCGCTAGGGGCTTGG + Intergenic
932378204 2:71257009-71257031 CTGAGAGAGCTTCAGGGACCTGG - Intergenic
932758787 2:74426332-74426354 CCGAGCGAGCCCTAGGGGAGTGG + Exonic
932881766 2:75508433-75508455 CTGGGAGTGCTATAGGAGACTGG - Intronic
932986405 2:76731133-76731155 ATGAGAGAGTTGTAGGGGAGAGG - Intergenic
942662071 2:178276173-178276195 ATGAGAGAGGCCTAGGGGATTGG - Intronic
943715777 2:191150939-191150961 CTGAGAGAGCGCTAGGTAAGTGG - Exonic
944296083 2:198064119-198064141 CTCAGGGAGCTCTGGGAGACAGG + Intronic
945881307 2:215327791-215327813 CTGAGAGAGCGATGGGGGAGGGG + Intronic
945991598 2:216399981-216400003 ATGATAGAGCTTTGGGGGACTGG + Intergenic
946428513 2:219612722-219612744 CTGAGAGGACTCTGGGGGGCCGG + Intronic
946935922 2:224720723-224720745 ATGAGACAGCACTAGGGGAATGG - Intergenic
947293159 2:228599909-228599931 ATGAGACAGCACTAGGGGAATGG + Intergenic
948916333 2:241036503-241036525 CTGAGAGGGATGGAGGGGACGGG + Intronic
1168990885 20:2095060-2095082 CTGAGACTGCTCCAGGGGGCTGG - Intergenic
1173834186 20:46114374-46114396 CTGAGAGAGCACAGGGGGATAGG + Intergenic
1175924475 20:62465174-62465196 CAGAGCCAGCTCTAGGGGAAGGG + Intronic
1176014917 20:62926168-62926190 CTGCGTGAGGTCGAGGGGACTGG - Intronic
1178261675 21:31105755-31105777 TTGGGAGAGCTCTTGGGGATAGG + Intergenic
1180483336 22:15775115-15775137 CTGAGAGAGGTCAAGGTGAGAGG + Intergenic
1180843106 22:18968382-18968404 CAGAGGGAGCGCTGGGGGACCGG - Intergenic
1181170713 22:21008164-21008186 CTGAGATAGCTTTAGGTGTCTGG - Intergenic
1181874223 22:25927411-25927433 CTGGGAGAGCTATGGGAGACTGG - Intronic
1181959679 22:26613994-26614016 CTGGGAGAGCTATGGGAGACTGG - Intronic
1182300836 22:29335976-29335998 CTGAGAGAGGGCCAGGGGAAAGG - Intronic
1183616854 22:38950861-38950883 GTGAGTGAGCCCCAGGGGACAGG + Intergenic
1183663651 22:39235333-39235355 CTGAGTGAGCTCTGGGGCACGGG + Intronic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
1184646381 22:45897543-45897565 CTGAGAGAGCTTTAGTGGCCTGG - Intergenic
1185245201 22:49769648-49769670 CTGAGAGAGCCTCAGGGGAGGGG + Intergenic
1185266113 22:49905119-49905141 CTGAGTGAACTCTCTGGGACAGG + Intronic
949437319 3:4043463-4043485 CTGAGAGAGGAATTGGGGACAGG - Intronic
949988006 3:9554355-9554377 CGGAGTGAGTACTAGGGGACAGG + Intergenic
950064092 3:10097329-10097351 CTGGGAGCGCTATAGGAGACTGG + Intronic
950140433 3:10611438-10611460 AAGAGAGAGCTCAAGGGGAGAGG - Intronic
950720845 3:14881606-14881628 CAGAGAGAGCTCAAGGGAGCAGG - Intronic
950770653 3:15308170-15308192 CTGAGAGCTCTCTGGGGCACTGG + Intronic
953140874 3:40228148-40228170 CTGACAGAGCCCTGAGGGACAGG + Intronic
954290023 3:49644761-49644783 CTGGGAGGTCTCTTGGGGACAGG - Intronic
954304332 3:49717520-49717542 CTGAGACAGCTCTCGAGGAGTGG - Exonic
958121866 3:89300857-89300879 CTCAGAGATCTCTAGAGAACAGG - Intronic
960142886 3:114167980-114168002 CTGAGAGAACTGTAGGGAAATGG + Intronic
960212301 3:114984788-114984810 GTGAGAGTGCTCTTGGGAACAGG - Intronic
962470064 3:135698931-135698953 TTGAGGGAGTTCTAGGGCACTGG - Intergenic
963350073 3:144140629-144140651 CTGAGAGTGCTCTAAGGGAGGGG + Intergenic
965865212 3:173197400-173197422 ATGAGAGAGCACTAGAGGAATGG + Intergenic
966489069 3:180506162-180506184 CTGAGATAGGTCTGGGTGACTGG - Intergenic
966886118 3:184379072-184379094 CTGAGGAAGTTCTGGGGGACAGG - Intronic
968192898 3:196683486-196683508 CTGAGAGCGCTATGGGAGACTGG + Intronic
969963730 4:10973319-10973341 CTGAGGGAGCTCGAGGGGAATGG - Intergenic
972211064 4:36838124-36838146 CTGTGAGGGCTCTGGGGGACTGG - Intergenic
973257179 4:48125320-48125342 CTGAATGAGTTCTAGGGAACTGG - Intronic
976023642 4:80661940-80661962 CTGAGAGCGCTATGGGAGACTGG - Intronic
977140564 4:93366379-93366401 CTGGGAGTGCTATAGGAGACTGG - Intronic
979027818 4:115598700-115598722 CTGAGAGAGATGTAAGGGAAAGG - Intergenic
979899457 4:126200027-126200049 CTGAGAGATGGCTAGGGGCCAGG - Intergenic
981756317 4:148144701-148144723 CAGAGTGAACTCTAGGGGAAGGG - Intronic
982069424 4:151682605-151682627 CTGAATGAGCTCTGAGGGACTGG - Intronic
982972396 4:162005578-162005600 CTGAAAGAGATCAAGGGGAAGGG + Intronic
985304750 4:188527171-188527193 CTGAGAGAACTCTATAGGCCGGG + Intergenic
986621617 5:9681602-9681624 CTGAGAGAGATCTAGGATAATGG - Intronic
992429440 5:76693745-76693767 TTGAGAGAGTTCTAGCTGACAGG + Intronic
993893182 5:93499848-93499870 CAGAGAAAGCTTTAGGGGCCTGG + Intergenic
994771597 5:103988613-103988635 ATGAGACAGCACTAGGGGAATGG + Intergenic
996324353 5:122255858-122255880 ATGAGACAGCACTAGGGGAATGG + Intergenic
997698581 5:135880531-135880553 CTGCCAGAGCCCTAGAGGACAGG + Intronic
997814461 5:137002772-137002794 CTGAGAGAGCCATGGGGGAAGGG + Intronic
1000162350 5:158611218-158611240 CTGAGAGAGCTGTAGCTGAGTGG + Intergenic
1001603955 5:172946853-172946875 CTGAGAGAACTCTAGTGGCCAGG - Intronic
1003472616 6:6451448-6451470 CTGAGAGAGCTCTCATGGGCTGG + Intergenic
1006572850 6:35019600-35019622 GTGAGATAGCTCTGGGGGAGGGG + Intronic
1006891843 6:37435373-37435395 CTGAGAGAGCCCTGGGCCACTGG - Intronic
1007358731 6:41340844-41340866 CAGAGAGTGTTCTATGGGACAGG + Intronic
1008849401 6:56006244-56006266 CTGAGACAGCACTAGGGGGATGG - Intergenic
1009269190 6:61597390-61597412 CTCACAGAGCCCTAGGGGTCAGG - Intergenic
1011066085 6:83327514-83327536 CTGAGAGCGCTATGGGAGACTGG - Intronic
1011253106 6:85393722-85393744 CTGGGAGAGGTCTAGGGAGCAGG - Intergenic
1011589736 6:88960714-88960736 GAGAGAGAGCTCTTGGAGACAGG - Intronic
1013657588 6:112261504-112261526 CTGAGAGAGCAGTAGGAGGCTGG - Intergenic
1017290064 6:152725950-152725972 CTGAGAGACCTCGAAGGGAAAGG + Intergenic
1018454723 6:163941602-163941624 CTTAGAGTGCTCTAGGGCGCTGG - Intergenic
1018473725 6:164120118-164120140 TTGAGAGAGCTCTAGAGGGCAGG + Intergenic
1019480559 7:1264803-1264825 CTGGGAGAGTTCCAGGGGGCAGG - Intergenic
1026095005 7:67340095-67340117 CTCAATGAGCTCTAGGGGACGGG - Intergenic
1026678952 7:72450939-72450961 TTGAGAGAACTCTAAGGGACTGG - Intergenic
1027263052 7:76478707-76478729 CTGAAAGAGGTCAAGGGGACTGG - Intronic
1027314435 7:76976812-76976834 CTGAAAGAGGTCAAGGGGACTGG - Intergenic
1029956868 7:104649496-104649518 CTGAGAGGTCACTATGGGACAGG - Intronic
1030417809 7:109267462-109267484 CTGGGAGTGCTATAGGAGACTGG - Intergenic
1032143766 7:129359369-129359391 ATGAGAAGGCTCTAGGGTACTGG + Intronic
1032333195 7:130999483-130999505 CTGAGAGGACGCCAGGGGACTGG + Intergenic
1036824236 8:11963908-11963930 CTGTGAGATCTCAAGGGAACAGG - Intergenic
1037989238 8:23308789-23308811 CTGACAGAGCTGGAAGGGACAGG + Intronic
1038354194 8:26811561-26811583 CTGAGTGGGCTCTAGTGGACTGG - Intronic
1039046587 8:33456048-33456070 CTGAGAGAGCTATTGGCAACAGG - Intronic
1039371317 8:36986699-36986721 CTGAGAAGGCTCTAAGGAACAGG - Intergenic
1041579339 8:59439354-59439376 ATGAGACAGCACTAGGGGAATGG - Intergenic
1042155527 8:65841371-65841393 CTGAGAGAGCTGCCGGGGATTGG + Exonic
1043977500 8:86599668-86599690 CTGGGAGTGCTATAGGAGACTGG - Intronic
1045432824 8:102129046-102129068 CTGAGAGCGCCCTGAGGGACTGG + Intergenic
1052750065 9:32481229-32481251 CTAAGTGAGCTCTTGAGGACAGG + Intronic
1057179141 9:93020446-93020468 CAGAGAGACCTCCAGGGGACGGG + Intronic
1057777841 9:98025351-98025373 CAGAAAGAGCTCTCGGGGCCAGG + Intergenic
1058648372 9:107152081-107152103 CTGGGAGAAATCTAGGAGACAGG + Intergenic
1059395762 9:114033111-114033133 TTGAGAGAGCTCTAAGAGGCCGG + Intronic
1059722242 9:116971465-116971487 CATAGAGTGCCCTAGGGGACTGG - Intronic
1060215958 9:121738276-121738298 CTGGGAGAGCGCGAGGGCACAGG - Intronic
1061238308 9:129354550-129354572 CTCAGGCAGCTCTAGGGGAAGGG + Intergenic
1188230639 X:27659005-27659027 ATCAGAGAGATCTAGGGGAAAGG - Intronic
1189422242 X:40866517-40866539 GGGAGAGAGCTTTAGGGGAGAGG - Intergenic
1193244482 X:79212165-79212187 CTGCAAGAGCTCTAAGGGAAAGG - Intergenic
1199324021 X:146476339-146476361 CTGAAGGAGCTGTTGGGGACAGG + Intergenic