ID: 901171317

View in Genome Browser
Species Human (GRCh38)
Location 1:7259820-7259842
Sequence TTCCCTCAGCCTTTGTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 1, 2: 4, 3: 46, 4: 374}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901171317 Original CRISPR TTCCCTCAGCCTTTGTTCTC TGG Intronic
900298741 1:1966056-1966078 TTCCCTCAGCCTTTCAGCTTTGG + Intronic
901171317 1:7259820-7259842 TTCCCTCAGCCTTTGTTCTCTGG + Intronic
901654717 1:10762736-10762758 TTCCCTTAACCTTTTTTCTGGGG - Intronic
901819613 1:11819269-11819291 TACTCTCTGCCTTTGTTCTTTGG + Intronic
902336723 1:15758583-15758605 TTCCCCCTCCCTTTGTTCCCTGG - Intronic
902542833 1:17166648-17166670 CTCCCTAAGCCTCTGGTCTCAGG + Intergenic
903813962 1:26051072-26051094 TTGCCTCAGGCTCTGTTTTCTGG + Intergenic
904397148 1:30229610-30229632 TTCCCTCTCCCTGTGCTCTCTGG - Intergenic
905002760 1:34686039-34686061 TCCCCTCACCCTCTGTTCCCTGG - Intergenic
906415364 1:45617619-45617641 TTGCCTCATTCCTTGTTCTCAGG + Intronic
906712064 1:47938094-47938116 TTCCCTCAGGCCTTGTTCTGTGG - Intronic
906782629 1:48586074-48586096 TTCCTTGATCCTTTGTTTTCGGG - Intronic
906809421 1:48811025-48811047 TTCCCCCATCCCTGGTTCTCTGG + Intronic
907185698 1:52607525-52607547 TTCCCTCAGGCCTTCTCCTCTGG + Intronic
907270606 1:53288735-53288757 TTGCCTGAGCCTTTTGTCTCGGG + Intronic
907637079 1:56146020-56146042 ATCACTCAGCCTGTGTTTTCTGG - Intergenic
910939259 1:92515626-92515648 TACCCTCATCCTTGTTTCTCAGG + Intronic
911024459 1:93422114-93422136 TTCCCTCAAGCTTTGTTCGTGGG - Intergenic
911881913 1:103250761-103250783 TGCCTTCTCCCTTTGTTCTCTGG + Intergenic
912597601 1:110894823-110894845 TCCCCTCACCCTTAGTTCTGAGG + Intronic
912899049 1:113628615-113628637 ATCCCTTAGCTTTTGTTGTCTGG + Intronic
913096339 1:115520254-115520276 TTCCCTCATCCTTTATTTTCTGG + Intergenic
916027193 1:160843389-160843411 TTCCATTCACCTTTGTTCTCAGG - Intronic
916045026 1:160993298-160993320 TTCCCTGAGTCTTTATTATCTGG + Intergenic
916593343 1:166215775-166215797 TTCTCTCAGTTTTTGTTATCTGG + Intergenic
917045741 1:170858172-170858194 TTGCCTCAGGCTTTGCTCTTTGG + Intergenic
917246524 1:173008159-173008181 CTCTCACAGCTTTTGTTCTCTGG + Intergenic
917665507 1:177221796-177221818 TTCCTACAGCCTCTGTTCCCTGG - Intronic
918942133 1:191014524-191014546 TTCCCCCATCCTTAGTTTTCTGG - Intergenic
919645455 1:200090275-200090297 TTCCCACACCTTTTGGTCTCAGG + Intronic
919843856 1:201628720-201628742 CTCCCACAGCCTTTGTTCCTGGG + Intronic
920287827 1:204893918-204893940 TTCCTTCAGCCTCTGCTATCTGG - Intronic
920454705 1:206091073-206091095 GTTCATCAGCCTTTGTGCTCAGG - Intronic
921730263 1:218570185-218570207 TTGTCTCAGCCAGTGTTCTCTGG - Intergenic
1062930615 10:1350011-1350033 CTCCCTTAGCCTATGTTCTCAGG + Intronic
1063168876 10:3487950-3487972 TTCTCTCAGCTTCTGCTCTCAGG - Intergenic
1063378855 10:5571694-5571716 TGATCACAGCCTTTGTTCTCTGG + Intergenic
1063824133 10:9875347-9875369 TTCCTTCTGCCTTTGATCTTAGG - Intergenic
1063955662 10:11263445-11263467 TCCCCCCAGCCTTGTTTCTCCGG + Intronic
1065163947 10:22954957-22954979 TTACATCAGCTTTGGTTCTCTGG - Intronic
1066034196 10:31464813-31464835 ATCCCTCAGCTTTTGTTTTTGGG - Intronic
1066318731 10:34277842-34277864 TTCCATAAGCCTTTGTGCTTAGG + Intronic
1067327607 10:45284625-45284647 TTCTCTCAGTCTTTGCACTCAGG - Intergenic
1068372963 10:56142763-56142785 TTCCCTCAGATTTTGTTTTCTGG + Intergenic
1070668277 10:78360668-78360690 TTTCCTCTGCCTTGCTTCTCTGG + Intergenic
1070916403 10:80157894-80157916 TGCCCTCAGCCCTTGGTCCCAGG + Intronic
1073045692 10:100637058-100637080 TTTTCTCTGCCTTTGTTATCAGG + Intergenic
1073307669 10:102515848-102515870 GTCCCTCTGCCTTTCCTCTCAGG + Intronic
1073479637 10:103778331-103778353 TTCCCCCCGCCTTTTTTTTCTGG - Intronic
1073638791 10:105228550-105228572 TTCCCTCAGCTTTGCTTGTCTGG + Intronic
1074277892 10:112022342-112022364 CTCTCTCAGCCTTTGCTCTTTGG + Intergenic
1078528367 11:12117915-12117937 TTCACTCAGCCTTTTTCTTCAGG + Intronic
1081499873 11:43655881-43655903 CTCCGTCAGCCTTTGGTATCAGG + Intronic
1083801207 11:65047552-65047574 TTCCCGCAGCTTGGGTTCTCTGG - Exonic
1084060079 11:66666232-66666254 TTCCCCCAGCCATTGGTGTCTGG - Intronic
1084955225 11:72687648-72687670 TTTCCTCAGCCTGGGATCTCAGG + Intronic
1085482468 11:76834127-76834149 TCCCCTCAGCCTAGGTTCACTGG + Intergenic
1085687395 11:78635864-78635886 TTCCCTCAGTTTTTCTTGTCTGG - Intergenic
1085811859 11:79690363-79690385 TACCCTCAGTCTTTGATCTGAGG + Intergenic
1085972845 11:81613665-81613687 GTCCCTCAACTTTTGTTTTCTGG - Intergenic
1086582594 11:88416169-88416191 TCCACTCAGCCTGTGTTCTCTGG + Intergenic
1088805497 11:113348471-113348493 GTCCCTTAGCCTTTATTATCTGG + Intronic
1089113139 11:116072670-116072692 TTCCTTCTCCCTTTGTTCTGGGG - Intergenic
1089653666 11:119931841-119931863 TTGCCTCAGCCTTTGCTTTCTGG - Intergenic
1089683095 11:120130370-120130392 TTCCATCAGACCTTGTCCTCGGG - Intronic
1093308308 12:17545888-17545910 CTCCCTCAGCCTTTTTTGTAAGG + Intergenic
1095259445 12:40082005-40082027 GGCCCACAGCCTTTTTTCTCTGG + Intronic
1095652173 12:44624492-44624514 TTCCCCCAACCTCTTTTCTCTGG + Intronic
1096566544 12:52486874-52486896 TTCCCTCTGCCTTGGTTTCCAGG - Intergenic
1099588352 12:84550966-84550988 ATCTCTCTGCCTTTGTTCTCTGG + Intergenic
1101025940 12:100607126-100607148 ATCCCTCAGTTTTTGTTGTCTGG + Intronic
1101855988 12:108443451-108443473 TTCCCATAGTCTTTGCTCTCTGG - Intergenic
1103353506 12:120302515-120302537 TCCCCTGACCCTTTGGTCTCGGG + Intronic
1103613375 12:122137537-122137559 TTCCCTGAGCAGTTGTTCTGGGG - Exonic
1104992481 12:132633953-132633975 TCCCTCCAGCCTTTGCTCTCAGG - Intronic
1106484577 13:30160937-30160959 TTTCCACAGCCTTTGAACTCAGG - Intergenic
1106582616 13:31031234-31031256 TTCCTTCAGCATTTCTTATCTGG - Intergenic
1107100799 13:36588873-36588895 TTCCCTCTGCTTTTGGTATCTGG + Intergenic
1108738478 13:53309978-53310000 TTCCCCAAGTCTTTGCTCTCCGG - Intergenic
1108925029 13:55731648-55731670 TTTCTTCAGCATTTGTACTCAGG + Intergenic
1109112560 13:58340738-58340760 ATCCCTCAGCTTTTGTTCACTGG + Intergenic
1110491979 13:76119905-76119927 TTCCCTTAGCATTTTTTATCTGG - Intergenic
1110578417 13:77088439-77088461 TTCTCTGGGCCTTTGGTCTCTGG - Intronic
1110660972 13:78059276-78059298 ATCCCTCACCCTGTGCTCTCAGG - Intergenic
1110728648 13:78854583-78854605 CTCCCTCAGCCTTTGTTCTCTGG - Intergenic
1111531121 13:89539297-89539319 TTCCCTTAGCATTTGCTGTCTGG + Intergenic
1112027159 13:95421648-95421670 TTCTCTCAGCTTTCTTTCTCAGG + Intergenic
1113059144 13:106302209-106302231 TTTCCTCAACCTTTGTGCTCAGG + Intergenic
1113461670 13:110486241-110486263 TTCACTCAGCCTTTGTTCAGCGG + Intronic
1114326080 14:21590180-21590202 TTCTCTCATCTTTTGTTGTCTGG - Intergenic
1114560951 14:23589932-23589954 TTCCCTCATCCTCTGCTCCCTGG - Intergenic
1114826000 14:26080452-26080474 TTCCTTCTGCCTTTATTTTCTGG - Intergenic
1115541274 14:34423769-34423791 TTGCCCCAGACTTTCTTCTCAGG - Intronic
1115562876 14:34598964-34598986 TTCCCTCAGCCTCTTTTATAAGG - Intronic
1115719258 14:36142513-36142535 TTCCCTCTGCTTCTGTTTTCTGG + Intergenic
1116715496 14:48420431-48420453 TTCCCTCAGCCCTTGGTTTGTGG + Intergenic
1118790740 14:69090034-69090056 TTCCCTCAGCCTCTGGTTTCTGG + Intronic
1119406300 14:74401687-74401709 TTCTCTCAGCCTTCCTTCCCCGG - Intergenic
1121227702 14:92333616-92333638 TTCTCCCAGCCTTTCTTCTGTGG - Intronic
1121615105 14:95308539-95308561 CTCACTCAGCCTTAGTTCTCAGG + Intronic
1121672343 14:95721902-95721924 CTCCCTCAGCTTTTCTTTTCTGG + Intergenic
1122269832 14:100563912-100563934 TTCCTTCAGCCTGTGTTTTGGGG - Intronic
1122853616 14:104549344-104549366 TCCCCACAGCCTTTGATCCCAGG + Intronic
1123625945 15:22226860-22226882 TTCCCTCAGCAATTGGTCTTGGG - Intergenic
1124509807 15:30314137-30314159 TTCCATCAGCAATTGTTCTGTGG - Intergenic
1124733084 15:32216417-32216439 TTCCATCAGCAATTGTTCTGTGG + Intergenic
1125967188 15:43883948-43883970 TTCTCTTTGCCTTTGGTCTCTGG + Intronic
1127005182 15:54561103-54561125 ATCCTTAAGGCTTTGTTCTCTGG + Intronic
1127011578 15:54636389-54636411 TTCTCTCATTCTTGGTTCTCTGG + Intergenic
1129198650 15:73985638-73985660 TGCCCTCTGCCTGTGTTCCCAGG - Intronic
1129358919 15:75012299-75012321 TCCACTCAGCATTTGTGCTCTGG - Intronic
1129680423 15:77655743-77655765 TACCCCAAGCCTGTGTTCTCAGG + Intronic
1130014030 15:80173770-80173792 TTCCCTCACCCCTTGGTTTCTGG + Intronic
1130913803 15:88289551-88289573 CTCCCTGAGCTTTTGTCCTCAGG - Intergenic
1131071754 15:89470605-89470627 TTCCCTCACCCCTTCTTCCCAGG + Intergenic
1131238884 15:90721239-90721261 TTCCCTGAACATTTGTTCACTGG + Intronic
1131684039 15:94752028-94752050 CTCCCTTAGCCTGTGTTCTTAGG + Intergenic
1132904554 16:2275885-2275907 TCCCCTCAGCATTTATTTTCTGG + Exonic
1133755709 16:8761108-8761130 ATCCCTGGGCCTTTGTTTTCTGG - Intronic
1133778637 16:8918977-8918999 TCCGCTCACCCTTTCTTCTCAGG - Intronic
1133894375 16:9911791-9911813 TTCACTCAACCTTTATACTCAGG - Intronic
1137016030 16:35376373-35376395 TTCCCTCTGCCACTGGTCTCTGG + Intergenic
1138999356 16:62490441-62490463 TAGCTTCAGCCTTTGTACTCTGG + Intergenic
1139169456 16:64613763-64613785 ATCCCTCAGCATTTGTTATCTGG + Intergenic
1141860989 16:86716158-86716180 TGCCATCAGCCTTTGGTCTCTGG - Intergenic
1142693712 17:1621869-1621891 TTCTCTCAGCATTTTCTCTCTGG - Intronic
1143335202 17:6166985-6167007 TTTCCTTAGGCTGTGTTCTCCGG - Intergenic
1143364910 17:6400760-6400782 TTTCTTCAGCCTTTGGACTCTGG + Intronic
1144625539 17:16842672-16842694 TACCCTCTGCCTTTATTCTGTGG + Intergenic
1144880888 17:18430048-18430070 TACCCTCTGCCTTTATTCTGTGG - Intergenic
1145151344 17:20514339-20514361 TACCCTCTGCCTTTATTCTGTGG + Intergenic
1146162693 17:30568589-30568611 TACCCTCTGCCTTTATTCTGTGG + Intergenic
1146309160 17:31753827-31753849 TGTCCTCAGCCTGTGTTCCCAGG + Intergenic
1146681789 17:34813623-34813645 CTGCCTCAGCCTCTTTTCTCTGG - Intergenic
1146722358 17:35132353-35132375 CCATCTCAGCCTTTGTTCTCTGG + Exonic
1147579697 17:41621368-41621390 TACCCTCTGCCTTTATTCTGAGG + Intronic
1147952255 17:44113780-44113802 TCCCCACAGCCTTTGGGCTCAGG - Intronic
1148544103 17:48503774-48503796 TTATCTCAGCCTCTCTTCTCAGG - Intergenic
1150007938 17:61481054-61481076 TTCCCTCAGCCCTGGTCCTAGGG + Intronic
1150528826 17:65955298-65955320 TTCTCTCCGCATTTGTTTTCTGG - Intronic
1151372155 17:73654943-73654965 TTAACTCAGCCTTTATTCTTAGG + Intergenic
1151970585 17:77455536-77455558 ATCTCTCAGCCTTTGTTCCAGGG + Intronic
1152685062 17:81689872-81689894 CTCCCTCACCCTCTGCTCTCTGG - Intronic
1153408693 18:4769596-4769618 TTGCCTCAGGCTCTGTTTTCTGG - Intergenic
1155347181 18:24869327-24869349 CTCCCTCAGCCTTTGTTGTTGGG + Intergenic
1156662277 18:39359609-39359631 TTCCCTCCCCCTGTGCTCTCAGG + Intergenic
1157160823 18:45312915-45312937 TTCCCTGAGCCTTTGGTCTTGGG - Intronic
1157298354 18:46462079-46462101 CTCCCTCTGCCTTTGCTCCCTGG + Exonic
1157722906 18:49939004-49939026 TCTCCTCAGCCCTTGTTCTCAGG - Intronic
1158122781 18:54068508-54068530 TTGCCCCAGCTTTTGTTCTCAGG - Intergenic
1158829190 18:61259209-61259231 TTTCCTCAGCCTTTTTCCTAAGG - Intergenic
1160013437 18:75123816-75123838 TTCCCTCCTCCTTTGCCCTCTGG + Intergenic
1160122442 18:76142929-76142951 TTCTTTCAGCCTCTGCTCTCTGG + Intergenic
1160563625 18:79773619-79773641 TTTCCTCAGCCTGCTTTCTCTGG - Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1160946604 19:1646718-1646740 TTCCCCCTGCCTTTGCTCTGGGG + Intronic
1161520868 19:4723004-4723026 TTCTCTCAGCCTCCCTTCTCAGG - Intronic
1164643194 19:29841292-29841314 TTCCCTGAGCCTGTGCTCTCTGG - Intergenic
1164728592 19:30483859-30483881 TCCCCACAGTCTTTGTTCTGGGG + Intronic
1164780156 19:30885296-30885318 TGCCCACAGCCTTAGGTCTCTGG + Intergenic
1165167811 19:33869375-33869397 TTCCCTCACCCCATGTCCTCAGG - Intergenic
1166348541 19:42182323-42182345 CTCCCTCTGCCTGTGTCCTCAGG - Intronic
1167169526 19:47821935-47821957 TTCCTTCAGCCTCTGCTGTCTGG + Exonic
1167846817 19:52171543-52171565 GTCTCTCAGTCTTTTTTCTCAGG - Intronic
1168570537 19:57464839-57464861 TTCCCTCAGCTTTTGTTTGCTGG + Intronic
925255564 2:2483910-2483932 CTCCCTCAGCCATTGTGCTCAGG + Intergenic
925332504 2:3069688-3069710 TTTCCTGAGCCTGTGGTCTCTGG + Intergenic
925841424 2:7995523-7995545 TTTCCTCAGAGTTTGTTTTCTGG + Intergenic
926140172 2:10363815-10363837 ATCTCTGAGCCTTGGTTCTCTGG + Intronic
926457761 2:13089545-13089567 TTCCCTCTTTCTTTGTGCTCAGG + Intergenic
927779147 2:25925503-25925525 TTCCCTTATCCTCTCTTCTCAGG - Intergenic
929116552 2:38449253-38449275 TTCCTTCAACCTGTGTTCCCAGG - Intergenic
930116933 2:47726127-47726149 TTCCCTCAGCCACAGTTCCCTGG + Intronic
930441279 2:51410077-51410099 TTCCATCAGCCCCTGTTCCCTGG + Intergenic
931721717 2:65071841-65071863 TCACCACAGCCTGTGTTCTCTGG + Exonic
932137787 2:69245667-69245689 TTGCCTCATCATTTGTTTTCTGG - Exonic
932565907 2:72908956-72908978 TTGCCTCATCCTTTTTTCTCTGG - Intergenic
933067541 2:77816646-77816668 TTCCCTCAGCCTGTCTACCCAGG - Intergenic
933163009 2:79046284-79046306 ATCCCTCAGCTTTTGTTAACTGG - Intergenic
933832362 2:86221422-86221444 TTCCCTCAGCTTATTTACTCTGG + Intronic
935408287 2:102732822-102732844 TTTACTGAGCCTTTCTTCTCAGG - Intronic
936608885 2:113982339-113982361 TTCCCTTATCTTTTCTTCTCAGG + Intergenic
936701825 2:115019950-115019972 TTCTCTCAGCATTTGTTTACTGG - Intronic
938066616 2:128285072-128285094 CTCCATCAGCGTGTGTTCTCTGG - Intronic
938134044 2:128739206-128739228 GTCCCTCAGCCTGAGATCTCAGG - Intergenic
938141715 2:128799913-128799935 TTGCCTCAGGCTATGTACTCTGG - Intergenic
939184534 2:138844799-138844821 TTCCCTCAGCCCTTGGTGACTGG + Intergenic
939525500 2:143288782-143288804 TTGCTGCTGCCTTTGTTCTCGGG + Intronic
940168378 2:150800208-150800230 GTTCCTCAGCCTTTGGACTCTGG + Intergenic
940259798 2:151767625-151767647 TCCCCTCAGCGTTTCTACTCAGG - Intergenic
940658350 2:156516511-156516533 TTCCCACAGCCTCTAATCTCCGG + Intronic
941219617 2:162759757-162759779 TTCCAAAAGCTTTTGTTCTCTGG - Intronic
942927489 2:181451210-181451232 CTCTCTCAGCCTTTGGTATCAGG + Intergenic
943184431 2:184588363-184588385 TTCCTTAAGCTTTTGTTGTCTGG + Intergenic
943632684 2:190272021-190272043 TACTCTCAGCTTTTCTTCTCTGG + Intronic
944078848 2:195761775-195761797 ATCCCTCAGCTTTTGTTGTTTGG - Intronic
944561769 2:200946831-200946853 TTACATCAGCATTTCTTCTCTGG + Intronic
944648363 2:201803444-201803466 TTCCTTCAGGCTCTGTTTTCAGG - Intronic
945195099 2:207230194-207230216 TTCTCTAAACCCTTGTTCTCAGG - Intergenic
945461238 2:210111467-210111489 TTCCTTCAGGCTCTTTTCTCTGG - Intronic
946429008 2:219614757-219614779 TACCCAGAGCCTTTGCTCTCGGG + Intronic
947263465 2:228251393-228251415 CTGCCTCTGGCTTTGTTCTCTGG + Intergenic
947429568 2:230014323-230014345 TCACCTCAGCCTTAGTTCTGGGG - Intergenic
948051502 2:234982597-234982619 TCCCCGCAGCCTGTGTTCCCAGG - Intronic
1168734353 20:117066-117088 TTACCTCTTCCTTTATTCTCTGG - Intergenic
1168768354 20:397379-397401 GTCCCTCAACCTTGGTGCTCAGG - Exonic
1169289867 20:4340260-4340282 CTCACTGAGCCTTTATTCTCTGG + Intergenic
1169480394 20:5974917-5974939 TACCCTGAGCCTCTGTTGTCAGG - Intronic
1169511940 20:6274166-6274188 TGGCCTCAGTCTCTGTTCTCTGG - Intergenic
1170297121 20:14839946-14839968 TTCCCTCTTCCTTTGTTCTCAGG + Intronic
1170575684 20:17659835-17659857 TTCCCTCTGCCTTTCTGCCCTGG + Intronic
1170962211 20:21035545-21035567 TTCCCGCTGCTTTTCTTCTCTGG + Intergenic
1171087684 20:22252909-22252931 TTCCCTCAGCCCTTGTCATTTGG - Intergenic
1176198260 20:63847870-63847892 CTCCCCCAGCCTTTGTTCCGTGG + Intergenic
1176664329 21:9670599-9670621 TTCCCTCTTCCTTCCTTCTCTGG + Intergenic
1178021959 21:28418811-28418833 TTCCAATAGCCTTTATTCTCTGG + Intergenic
1179149231 21:38795952-38795974 TTCCCTCAGCCCTCATCCTCTGG - Intergenic
1179236650 21:39553440-39553462 TTCCCTAAGCCTTGTTTCTTGGG + Intergenic
1179950917 21:44708430-44708452 TGCCCTCAACCTCTGTCCTCTGG - Intronic
1180756459 22:18165313-18165335 TTCTCTCTGCTTTTGTCCTCTGG + Intronic
1181075310 22:20372121-20372143 TTCTCTCTGCTTTTGTCCTCTGG - Intronic
1181805825 22:25373918-25373940 TACCCTCCGCCTTGGTCCTCAGG - Intronic
1182845912 22:33430803-33430825 GTCCCTTCTCCTTTGTTCTCTGG + Intronic
1183004960 22:34893630-34893652 TACTCTCAGCCTTTGTTCTAGGG - Intergenic
1183843441 22:40519744-40519766 TTCACTCAGACTTTGCTCTTAGG - Intronic
1184368662 22:44068755-44068777 CTCCCACTGCCTTTGCTCTCTGG - Intronic
950092920 3:10309810-10309832 TTTCCTGAGCCTTTCTTATCAGG - Intronic
951826368 3:26873641-26873663 TTCCCTTCTCCATTGTTCTCTGG - Intergenic
952095748 3:29950963-29950985 TTCCCTTAGCCTTGGTTATCAGG + Intronic
952657118 3:35800245-35800267 TTCCCTGAGCTTCTGTTGTCAGG - Intergenic
952853893 3:37751900-37751922 TGCCCACAGCCTTTGATCACAGG - Intronic
952993257 3:38851960-38851982 ATTCCTCATCCTCTGTTCTCTGG - Intronic
954775275 3:53011556-53011578 AGCCCACAGCCTTTGATCTCTGG - Intronic
954951174 3:54475151-54475173 CACCCTCAGCCTTTAGTCTCAGG - Intronic
955794173 3:62618234-62618256 TTCCCTCAGCTGTTTTCCTCTGG - Intronic
956399977 3:68867370-68867392 TTCCCCCAGCTCTTGTTGTCTGG - Intronic
956426100 3:69137053-69137075 TGCCCTTTGCCTTTGTCCTCTGG - Intergenic
957635751 3:82781631-82781653 TTGCGTGATCCTTTGTTCTCGGG + Intergenic
957705675 3:83779178-83779200 TTCCCTAATCATTTGTTCTCTGG + Intergenic
957895077 3:86411773-86411795 TTCCCTCCCTCTGTGTTCTCAGG - Intergenic
958653594 3:96972653-96972675 TTCCCTCTCCCTTTTCTCTCTGG + Intronic
958728370 3:97933708-97933730 CTCCATCAGCCTTTTTGCTCTGG + Exonic
959987549 3:112592615-112592637 CTCCCTCAGCTTTTGTTCATTGG + Intergenic
960278162 3:115750560-115750582 TTCCCTCCCCCTGTGCTCTCAGG - Intergenic
960557263 3:119043273-119043295 TTCCCTCCCCCTGTGCTCTCAGG + Intronic
960612928 3:119571426-119571448 GTCCCTCATCCCTTGGTCTCTGG - Intergenic
960718611 3:120603306-120603328 TTCCCTCAGTCTCTGCTTTCTGG - Intergenic
962128851 3:132651205-132651227 TTCCCTCAGCTTTGAATCTCAGG + Intronic
962376303 3:134861553-134861575 TTTCCTCAGCTTTTCTTTTCTGG - Intronic
962504779 3:136035434-136035456 TTCTCTCAGCATTTGTTTTTCGG + Intronic
964939959 3:162146660-162146682 TTCCCTCTGCCTTATTTCTTAGG + Intergenic
966617817 3:181930936-181930958 TTCCCACAGCCTTACTTCTGTGG + Intergenic
966661138 3:182416222-182416244 TTCTTTCAGCCTTTATACTCAGG + Intergenic
966965686 3:184990096-184990118 TTCCCTCTGCTTCTGTTTTCTGG + Intronic
967035641 3:185646698-185646720 TTCCCTCACCCTCTCTCCTCAGG - Intronic
967414826 3:189204617-189204639 CTCCCTCAGGCTGTCTTCTCTGG - Intronic
967508749 3:190285644-190285666 TTCTCTCAGCTTTTGTTGTCTGG + Intergenic
967549395 3:190772866-190772888 CTCCCTCAGTTTTGGTTCTCTGG + Intergenic
967627759 3:191705416-191705438 TTCCCTCAGTTTTCCTTCTCTGG - Intergenic
969391114 4:6891983-6892005 CTCCCTCAGCTCTAGTTCTCTGG + Intergenic
969708974 4:8831888-8831910 TACCCTAAGCCTCAGTTCTCAGG - Intergenic
969848998 4:9942161-9942183 TTCCCTCAGCCTTTGTTCCTGGG - Intronic
970367586 4:15375597-15375619 TTGGATCAGCCTTTGTCCTCAGG + Intronic
970961607 4:21877988-21878010 TTCCATGGGCCTGTGTTCTCTGG - Intronic
972037809 4:34548720-34548742 TTCTCTTAGCCTTTGTGCTATGG + Intergenic
972722112 4:41710384-41710406 GTTCATCAGCCTTTGTTATCAGG - Intergenic
973147880 4:46851056-46851078 CTCTCTAAGCCTTTGTTCCCCGG - Intronic
973647179 4:52961402-52961424 TTTCCTCAATCTTTGTCCTCAGG - Intronic
974581754 4:63813010-63813032 TTCCCTCAGCATTTCTTGCCTGG + Intergenic
974944273 4:68507694-68507716 TTACCTCTGCCTTTGTCCTTTGG + Intergenic
975319765 4:72996659-72996681 TTCTCTCACTCTTTTTTCTCAGG + Intergenic
977642682 4:99375115-99375137 ATCCCCCAGCTTTTGTTGTCTGG + Intergenic
977738013 4:100442094-100442116 TTCCTTCAGCTTTTCTTGTCTGG + Intronic
978204417 4:106063554-106063576 TTCCTCTAGCCTTTGGTCTCAGG - Intronic
979009823 4:115353833-115353855 TTCCCTCAGCATTTGTTTGTTGG + Intergenic
979162477 4:117481095-117481117 TTCTCTCAGGCTTTTTTCTTTGG - Intergenic
981139467 4:141251826-141251848 TTCACTCAGCATTTGCTGTCTGG + Intergenic
981396816 4:144259998-144260020 TTCCCTCAGCGTTGTTTGTCTGG - Intergenic
982136719 4:152279587-152279609 TGTCCTCAGCCTGTGCTCTCAGG - Intergenic
982931195 4:161409346-161409368 TTCCCTCAGCATTTGCTCTCAGG - Intronic
983579942 4:169298956-169298978 TTCCCTCATCCTCTATTTTCTGG - Intergenic
983648606 4:170016899-170016921 TACCCTGAGCCTCTGTTCACAGG - Intronic
984223941 4:177012516-177012538 CTTCCTCACCCTTTGTTTTCTGG + Intergenic
984390624 4:179126910-179126932 TTCACTAAGCCTTTGTTGCCAGG + Intergenic
985409793 4:189671278-189671300 TTCCCTCTTCCTTCCTTCTCTGG + Intergenic
985550382 5:530382-530404 GTCACACAGCCTGTGTTCTCTGG - Intergenic
987802672 5:22719146-22719168 TTCCCTCAGCCTTTGCAGTTTGG + Intronic
987846533 5:23294628-23294650 TACTCTCAGCATTTGTTTTCTGG + Intergenic
988000324 5:25339752-25339774 TTACTTCAGCCTCTGTTTTCAGG + Intergenic
988126277 5:27042284-27042306 TTCCCTCTGATTTTGTCCTCTGG - Intronic
988126950 5:27053164-27053186 TTCCCTCTGATTTTGTCCTCTGG - Intronic
988238947 5:28583004-28583026 TTCCCCCATCCTTTGTCTTCTGG - Intergenic
990977351 5:61571489-61571511 TTCCCTCTGCCTGGGTTTTCAGG + Intergenic
991480151 5:67069380-67069402 TTCTTTCACCCTGTGTTCTCAGG + Intronic
992136505 5:73751476-73751498 TTCCCTCTGCCCTTTTGCTCTGG + Intronic
992181431 5:74201741-74201763 TGCCCTCAGCCTCTATTCTCTGG - Intergenic
992296056 5:75327873-75327895 TTTACTCAGTCTTTGTTCTGGGG + Intergenic
992370846 5:76142811-76142833 TTCCCTGGGCCTGTGTTGTCTGG - Intronic
993274948 5:85845069-85845091 CTCCCTCAGCTTTTGTTATATGG + Intergenic
994227787 5:97273927-97273949 TTGGCTCTGACTTTGTTCTCTGG + Intergenic
996046015 5:118874017-118874039 TGCACCCAGACTTTGTTCTCTGG - Intronic
996191460 5:120548017-120548039 TTTCCTCAGCCTCTGTTTGCTGG + Intronic
998205966 5:140157148-140157170 TTCCCTCACCCTTTACTCTGAGG - Intergenic
998341973 5:141426343-141426365 TTCCTGCTGCCTTTGTTCTGCGG + Intronic
998788874 5:145744267-145744289 TTTCCTCAGACTTAGTTCTGAGG + Intronic
998971544 5:147597876-147597898 GTCCTTCAGCCTTTGGACTCTGG + Intronic
999826540 5:155278780-155278802 TTCCATAAGCTTCTGTTCTCAGG - Intergenic
999980081 5:156949602-156949624 CTCCCTCACCCTTTGTACTGAGG - Intronic
1000667096 5:164012142-164012164 TTAACTCAACCTTTGTCCTCTGG - Intergenic
1001260363 5:170223208-170223230 GTCCCTAAGCCTAGGTTCTCAGG - Intergenic
1001622574 5:173100823-173100845 CTCCCTCAGCTTTTGTTTTCTGG + Intronic
1001722255 5:173866548-173866570 TGCCCTCAGCCTTCCTTGTCTGG - Intergenic
1001761122 5:174209207-174209229 TTCCCTCAGCCTCTGGCCTGGGG - Intronic
1004023834 6:11799657-11799679 TTCCCTCAGCCACAGTTCCCTGG + Intronic
1004460491 6:15830859-15830881 ATCCCTCAGCCCTTCTTCTTTGG + Intergenic
1007998510 6:46334502-46334524 TTACCTCAGCCTCCCTTCTCAGG - Intronic
1008340259 6:50355870-50355892 TTCCCTCTGTCTTTGTTGTTTGG - Intergenic
1008433499 6:51448000-51448022 TTCCATCAACCTTGGTTCTATGG + Intergenic
1008707397 6:54179997-54180019 ATCCTTCAGCTTTTGTTTTCTGG + Intronic
1009496386 6:64353700-64353722 TTCCATCAGTTCTTGTTCTCAGG - Intronic
1011283156 6:85697261-85697283 CTCTGTCAGCCTTTGTTATCAGG + Intergenic
1011780978 6:90789124-90789146 ATCCCTCACCCCTGGTTCTCAGG - Intergenic
1012343301 6:98155643-98155665 ATCCCTCAGCATTTGTTGTCTGG + Intergenic
1012530189 6:100226380-100226402 TTCCCTCAAACTTTGCTCCCAGG + Intergenic
1013305275 6:108841815-108841837 CCCCTTCAGACTTTGTTCTCTGG + Intergenic
1014499786 6:122171897-122171919 TTTCCTCTGCCTGTGTTTTCTGG - Intergenic
1014515163 6:122368855-122368877 TTCCCTCAGCCTCTGTGCTGTGG - Intergenic
1015210354 6:130690385-130690407 TTCCTTCAGATTTTGTTCTCTGG + Intergenic
1016230113 6:141793122-141793144 TTCCCTCTGCCTTTATTTTTTGG - Intergenic
1016254191 6:142084129-142084151 TTCCATCAGTCTTTGTTCAGTGG - Intronic
1016373432 6:143397167-143397189 TTCCCTCTGCCTCTGTCCTGTGG - Intergenic
1016660434 6:146571679-146571701 TTCCCTCAGACTTGCTTGTCTGG - Intergenic
1016671028 6:146708417-146708439 TTCCCTCAGCTTTTTTTGTTTGG + Intronic
1017825463 6:158078415-158078437 TTCCATCATTCTTTGTTCTTTGG - Intronic
1017955432 6:159173854-159173876 TGCCCACATCCTTGGTTCTCGGG + Intronic
1018841623 6:167521594-167521616 TTTCCTGAGCCTGTGATCTCTGG - Intergenic
1019302315 7:312202-312224 TTCACTCATACTTTGTTCTCAGG + Intergenic
1021051736 7:15994033-15994055 ATCCCTCAGCATTTCTTGTCTGG + Intergenic
1021793770 7:24232536-24232558 TTCCCTCTTCTTTTGTTTTCTGG - Intergenic
1022609575 7:31855514-31855536 CTCCTGCAACCTTTGTTCTCTGG - Intronic
1022637523 7:32150919-32150941 TCCTCTCAGCATTAGTTCTCAGG - Intronic
1023919636 7:44617928-44617950 TTCCCTCATTCTTTGTGCCCTGG + Intronic
1024105330 7:46078828-46078850 TTCCATCAGGCTTGGTTGTCTGG + Intergenic
1024318677 7:48044413-48044435 GTCCCTCCCCCTTTGCTCTCAGG + Intronic
1024577442 7:50775987-50776009 TTCCCTGGGCCTTGGTACTCTGG + Intronic
1029705503 7:102273751-102273773 TTGCCTCTGCCTCTGCTCTCAGG - Intronic
1030174540 7:106638172-106638194 TTCCCTCTGCTTTTGTTTTCAGG - Intergenic
1030456915 7:109786097-109786119 TTGCCTCAGCCATTGTGCTTGGG + Intergenic
1030490997 7:110234327-110234349 TTCCCTCTGCCTTCATCCTCTGG - Intergenic
1030655284 7:112160850-112160872 TTTGCTCAGCCTTCATTCTCAGG - Intronic
1031231423 7:119112697-119112719 ATCTCTCAGCTTTTGTTGTCTGG + Intergenic
1036479627 8:9127283-9127305 TTCCCTCCCCTTTTGTTTTCAGG - Intergenic
1037083828 8:14821426-14821448 TTCCCTCATCTTTAGTTTTCTGG - Intronic
1037303230 8:17476422-17476444 TTCCATCAGTTTTTGTTGTCTGG + Intergenic
1037627925 8:20624291-20624313 TTCCCTCAGCCTTTAGGGTCTGG + Intergenic
1037713313 8:21373393-21373415 TTCCCTCTGTCTTTGTCCTGTGG + Intergenic
1038530018 8:28311106-28311128 TTCCCTCATCCTTTGTATTCAGG - Intergenic
1040385954 8:46915270-46915292 TGCTCTCAGCCTTACTTCTCAGG - Intergenic
1040387513 8:46923560-46923582 TTCCCACTGCCCTTGATCTCAGG - Intergenic
1042596086 8:70449708-70449730 TGCTCTCTGCCTTTGCTCTCTGG - Intergenic
1042673688 8:71293393-71293415 TTCCCTCTGCTTCTGTTTTCTGG - Intronic
1043288761 8:78569261-78569283 TTCCCTCTGCCTTGGTTCAGGGG + Intronic
1044765710 8:95572064-95572086 TTCCCTCAGCTTTCATTATCTGG + Intergenic
1045853444 8:106732908-106732930 TTCCCTCCGCTTCTGTTTTCTGG + Intronic
1045889721 8:107141036-107141058 TACCCTCAGGCTTTGTGCTTTGG - Intergenic
1046134411 8:110008343-110008365 ATCTCTCAGCTTTTGTTATCTGG + Intergenic
1046701868 8:117409941-117409963 TTCCCTTTGCCTTTCTTCTTTGG + Intergenic
1047014063 8:120703609-120703631 AGCCCTCAGCATTTTTTCTCTGG - Intronic
1047826117 8:128577861-128577883 TTCCCTCAGCCATTATTCTATGG + Intergenic
1048135339 8:131741998-131742020 CTCCCTTAGCCTGTGTTCTCAGG + Intergenic
1048393932 8:133995041-133995063 TTCCCTCAATTTTTGTTTTCTGG + Intergenic
1049406453 8:142453718-142453740 TTCCCGCAGCCTTAGTGCTTGGG - Intronic
1050013774 9:1211558-1211580 GTCACTCAGCCTTTCTTCTAAGG - Intergenic
1050502343 9:6312366-6312388 TTCCCTCACCCTTTGGCTTCAGG + Intergenic
1051082172 9:13306766-13306788 TTCCATTTGCCTGTGTTCTCTGG + Intergenic
1051097596 9:13484273-13484295 TTCCCTCAGCCACTTTTCTTTGG + Intergenic
1051339350 9:16096947-16096969 TTTTCTCAGCCTTTGGTATCAGG - Intergenic
1051469925 9:17426293-17426315 ATCCCTTAGCCTTTGCACTCTGG - Intronic
1051567123 9:18512990-18513012 TTCCACCAACCTTTGTTCTGTGG - Intronic
1053355843 9:37444830-37444852 TTCCCTTTGCCTGTCTTCTCTGG - Intronic
1053444117 9:38138360-38138382 TTCACTCAGCTTTCCTTCTCTGG + Intergenic
1055410133 9:76020319-76020341 TTCCCATAGCCTTTGGTCTCTGG + Intronic
1055846527 9:80570511-80570533 CTCTCACAGCCTTTGTTTTCTGG - Intergenic
1057413789 9:94843450-94843472 GTCTCTGAGCCTTGGTTCTCAGG + Intronic
1057904169 9:98971593-98971615 TTCCCTCAACCTCTGTTTCCTGG - Intronic
1058016634 9:100040129-100040151 TTCCCTCCTCCTTTGTTTTTTGG - Intronic
1058908914 9:109503320-109503342 TCCCCTGAGCCTGTGTTCTAAGG + Intergenic
1059348136 9:113646221-113646243 TCCCCTCAGACTTTCATCTCTGG - Intergenic
1060279565 9:122206775-122206797 TTCCATGATCCTTTGTTCTGTGG + Intronic
1061137092 9:128741276-128741298 TCTCCTCGGCCGTTGTTCTCAGG - Intronic
1062098631 9:134716314-134716336 TTCCCTGTGCCATTCTTCTCGGG + Intronic
1203661772 Un_KI270753v1:51153-51175 TTCCCTCTTCCTTCCTTCTCTGG - Intergenic
1203672963 Un_KI270755v1:34202-34224 TTCCCTCTTCCTTCCTTCTCTGG - Intergenic
1186253344 X:7692927-7692949 TTCCCTCAGCCTTTCTGCTCTGG - Intergenic
1187627166 X:21128512-21128534 TTCCCTGAGTCTTTGTTCTTGGG - Intergenic
1187833418 X:23406112-23406134 TTCCCTTAGCCTTTATTTTCCGG - Intergenic
1188422299 X:30005018-30005040 CTCCCTCAGCTTTTGATCTGAGG + Intergenic
1189191435 X:39111547-39111569 CTCCCTCAGCTTTTGTTTTCTGG + Intergenic
1189220822 X:39370258-39370280 TTCTCTGAGCCTTGGTTCTCTGG - Intergenic
1191006819 X:55718170-55718192 TTGCCTCCGCCTTTGTCCACTGG - Exonic
1192571949 X:72213358-72213380 TTCCCTCCCCCTGTGCTCTCGGG - Intronic
1193023232 X:76815233-76815255 CTCCCTCAGCCTTTCTTTCCAGG - Intergenic
1194016797 X:88631652-88631674 ATCCCTCAGCTTTTGTTTGCTGG - Intergenic
1194443980 X:93965469-93965491 TTCCTTCAGCCCATGTTCCCTGG + Intergenic
1194574764 X:95598220-95598242 ATCCCTCAGCTTTTGTTTGCTGG - Intergenic
1194937434 X:99968479-99968501 ATCCCTCAACTTTTGTTTTCTGG + Intergenic
1195032681 X:100941779-100941801 TTCCATCACTTTTTGTTCTCAGG - Intergenic
1196266813 X:113658677-113658699 TTCTCTCAGCCTTTTTTTTCTGG + Intergenic
1196326814 X:114415106-114415128 TTGCCTCAGACTTTGCTCTCTGG - Intergenic
1196654837 X:118207038-118207060 TTCCTTCAGCCTTTACTTTCAGG + Intergenic
1196814217 X:119652254-119652276 TTCCCACAGCCATCTTTCTCGGG + Intronic
1197611142 X:128639596-128639618 TAGCCTCAGCCTTAGTTCTTGGG + Intergenic
1198280319 X:135135352-135135374 TCCCCTCAGCGTGTGTTCTCGGG + Intergenic
1198290639 X:135237162-135237184 TCCCCTCAGCGTGTGTTCTCGGG - Intergenic
1200295382 X:154914107-154914129 AGCCCCCAGCCTTTGTTCTGTGG - Intronic
1200416003 Y:2910532-2910554 TTCCCTCCCCCTGTGCTCTCAGG + Intronic
1201470144 Y:14324249-14324271 TTCTCTCAGCCTTTCTGCTCTGG - Intergenic
1201685484 Y:16697282-16697304 CTGCCTCAGCCTTCTTTCTCAGG - Intergenic
1202112018 Y:21431098-21431120 TTTCCTCTGCCTTTGTTGACAGG + Intergenic
1202118646 Y:21501548-21501570 TTTCCTCCGCCTTTGTTGACAGG - Intergenic
1202121098 Y:21525088-21525110 TTTCCTCCGCCTTTGTTGACAGG - Intronic
1202123549 Y:21548628-21548650 TTTCCTCCGCCTTTGTTGACAGG - Intronic
1202155459 Y:21880752-21880774 TTTCCTCCGCCTTTGTTGACAGG + Intronic
1202157907 Y:21904294-21904316 TTTCCTCCGCCTTTGTTGACAGG + Intronic
1202184354 Y:22169218-22169240 TTTCCTCCGCCTTTGTTGACAGG + Intronic
1202207005 Y:22417183-22417205 TTTCCTCCGCCTTTGTTGACAGG - Intronic