ID: 901174468

View in Genome Browser
Species Human (GRCh38)
Location 1:7288889-7288911
Sequence TACAGAGAAATGCCTGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3623
Summary {0: 1, 1: 2, 2: 39, 3: 470, 4: 3111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901174468 Original CRISPR TACAGAGAAATGCCTGAGAT TGG Intronic
Too many off-targets to display for this crispr