ID: 901175581

View in Genome Browser
Species Human (GRCh38)
Location 1:7296452-7296474
Sequence CAGGAACTTCAGCAGTAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901175581 Original CRISPR CAGGAACTTCAGCAGTAGTG GGG Intronic
900756153 1:4436375-4436397 GAGGACCTTCATCAGGAGTGAGG + Intergenic
901175581 1:7296452-7296474 CAGGAACTTCAGCAGTAGTGGGG + Intronic
902242859 1:15100319-15100341 CAGGACCCTCAGCAGGAGGGTGG + Intronic
906375829 1:45295950-45295972 GAGGAAATTCAGCGTTAGTGTGG + Intronic
906964084 1:50439613-50439635 CAGGAACAGCAGCAGGGGTGTGG - Exonic
906987610 1:50702097-50702119 CAGAAGCTTCTGCAGTAGTAAGG + Intronic
907512351 1:54970970-54970992 CAGGAATAACAGCAGTTGTGGGG + Intergenic
911239340 1:95448709-95448731 AATGAACATCAGCAGTAGTCAGG - Intergenic
911887819 1:103326478-103326500 AGGGAACATCAGCAGTAGTCTGG - Intergenic
911967843 1:104390103-104390125 ACGGAACATCAGCAGTAGTCTGG + Intergenic
912598586 1:110903967-110903989 AAGGAACATTAGCAGTAGTCTGG + Intergenic
912693585 1:111823114-111823136 CAGGCCCCTCAGCAGTAATGGGG - Intronic
915693501 1:157715581-157715603 CAGGAACCACAGCACTACTGGGG - Intergenic
915712847 1:157917774-157917796 TAGGACCTCCAGCAGTACTGCGG + Intergenic
916207385 1:162328470-162328492 ATGGAACTAGAGCAGTAGTGTGG + Intronic
917143598 1:171863566-171863588 CAGGGATTTTAGCAGTAGAGTGG - Intronic
918580932 1:186128164-186128186 CAGGAAGTTCAGTAAAAGTGGGG - Exonic
920400936 1:205675951-205675973 CAGGAGCTGAAGCACTAGTGGGG - Intronic
921831735 1:219734826-219734848 CATGGACTTCAGCAGCAGTTTGG - Intronic
1063644442 10:7865136-7865158 CAGGAGCTTCAGGAGTGGAGAGG + Intronic
1066084548 10:31963449-31963471 AGGGAACATCAGCAGTAGTCTGG + Intergenic
1067272462 10:44804225-44804247 CATGAGCTTCACCAGCAGTGGGG + Intergenic
1068826480 10:61445764-61445786 CAGGAACTTCCAGGGTAGTGGGG + Intronic
1070736148 10:78865174-78865196 CAGGTACTTCCGCAGTTCTGAGG + Intergenic
1072034507 10:91552019-91552041 CAGGCTCTTGGGCAGTAGTGTGG + Intergenic
1072336611 10:94403285-94403307 CAGCAGCTGCAGCAGTAGCGAGG + Exonic
1074313355 10:112341294-112341316 CAGGAACTTCACCTCTAGGGAGG - Intergenic
1074808138 10:117074723-117074745 CAGGAAATGCAGCAGTAGGCAGG + Intronic
1075263407 10:120981461-120981483 CAGATACCGCAGCAGTAGTGTGG + Intergenic
1083040499 11:59680735-59680757 CAGCCACTTCAGCACTAGAGGGG - Intergenic
1083627837 11:64080920-64080942 GAGGGACTTCAGGAGCAGTGGGG - Intronic
1084942411 11:72620069-72620091 CAGGAGCTCCAGCAGAGGTGGGG - Intronic
1085881576 11:80473623-80473645 TAGGAACTTGAGATGTAGTGAGG + Intergenic
1086141238 11:83502865-83502887 GAGTAACTTCAGAAGTACTGGGG - Intronic
1086980079 11:93186939-93186961 CAGCAACATCAGCAGCACTGGGG - Intronic
1087408513 11:97760541-97760563 CAGGGACTTCAGGAGGATTGTGG + Intergenic
1088045799 11:105449248-105449270 AGGGAACATCAGCAGTAGTCTGG + Intergenic
1088409105 11:109513869-109513891 CAGGAACATCAGCAGCTCTGGGG - Intergenic
1088411542 11:109539738-109539760 AATGAACATCAGCAGTACTGAGG - Intergenic
1089937126 11:122375806-122375828 AGGGAACCTCAGCAGTAGTCTGG + Intergenic
1090575159 11:128094446-128094468 CAGGAAGTGTAGCAGGAGTGGGG - Intergenic
1091223337 11:133943835-133943857 CAGGAACTCCACCAGAATTGGGG + Intronic
1093817549 12:23568232-23568254 CAGGACTGTCAGCAGTATTGAGG + Intronic
1094658150 12:32440953-32440975 AAGGAACATCAGTAGTAGTCTGG - Intronic
1095659966 12:44720957-44720979 CTGTAAATTTAGCAGTAGTGAGG + Intronic
1098915744 12:76255158-76255180 CAGGAACTTTATGTGTAGTGAGG - Intergenic
1100355975 12:93830049-93830071 CAGGAAATTGACCAGTGGTGGGG + Intronic
1102653576 12:114461353-114461375 CAGGAAATATAGCAGTGGTGTGG - Intergenic
1103315157 12:120048085-120048107 CAGGAATTTCAGTAATAATGAGG - Intronic
1105773872 13:23638683-23638705 CAGGAACATCAGCAGAAGGGAGG - Intronic
1109327600 13:60887616-60887638 CAGGTAATGCAGAAGTAGTGGGG + Intergenic
1109452752 13:62539702-62539724 CAGAAACTTCTTCAGGAGTGAGG + Intergenic
1112731161 13:102364414-102364436 CAGTAACTCCAACAGTAGTGGGG + Intronic
1113244990 13:108385334-108385356 CAGGTAATTCAGAAGTAGTAAGG + Intergenic
1115050596 14:29057058-29057080 CAGGAACTACAGCAGTCAGGTGG - Intergenic
1115180588 14:30621647-30621669 AAGGAAGTCAAGCAGTAGTGGGG - Intergenic
1115831344 14:37345709-37345731 CAGGAAATTCAGTAGCAATGAGG - Intronic
1125537053 15:40447188-40447210 CAGGGCCTTCCTCAGTAGTGAGG + Intronic
1126709407 15:51440936-51440958 AAGGAACATCAGCAGTAGTCTGG - Intergenic
1126830155 15:52594012-52594034 CTGCAACTTCAGCATTAGTTAGG + Intronic
1128822245 15:70669001-70669023 AAGGTGCTTCAGCAGAAGTGGGG - Exonic
1129070702 15:72947888-72947910 CAAGAACTTCAGCAATAGACTGG + Intergenic
1129388510 15:75208726-75208748 CAGTAACTTCAGCATGCGTGAGG - Exonic
1129750469 15:78059356-78059378 CTGGGATTTCAGCAGTATTGAGG - Intronic
1130768151 15:86894344-86894366 CAATAACTTCAGCAATAGTAGGG - Intronic
1132861575 16:2074363-2074385 CAGGAACTCCAGCAGTGGGACGG - Exonic
1135194685 16:20384713-20384735 AAGGAGCTTCAGCAGGAGTTTGG - Exonic
1138638256 16:58361585-58361607 AGGGAACATCAGCAGTAGTCTGG - Intronic
1138651273 16:58463096-58463118 GAGGAACTTGTGCAGGAGTGAGG - Intronic
1140158094 16:72455094-72455116 AGGGAACATCAGCAGTAGTCTGG - Intergenic
1140708154 16:77650299-77650321 CAGGAACTGAATCAGTTGTGGGG - Intergenic
1142941128 17:3380536-3380558 CAGGTACTTGAGCACTGGTGGGG - Intergenic
1143098692 17:4492732-4492754 CAGGAACTTCTGTGTTAGTGGGG + Intergenic
1145310685 17:21699692-21699714 GAGGAACGTCAACAGAAGTGGGG + Intronic
1145971993 17:28961578-28961600 CAGGAACGGCAGTGGTAGTGAGG - Intronic
1146262944 17:31433581-31433603 CAGGAACTGCAGCTGTCCTGCGG + Intronic
1146610558 17:34301361-34301383 TAGGAACTTCAGAAGAAGTATGG - Intergenic
1146707357 17:35010941-35010963 CAGGAACTTCAACAGCAGTCTGG + Exonic
1147343257 17:39768234-39768256 CAGAAACTTCAGAAGTACTTGGG + Intronic
1149396085 17:56245412-56245434 CAAGAAGTCCAGCAGAAGTGTGG - Intronic
1149419679 17:56497282-56497304 CAGGAAGTTCAGCAGTAGGCAGG - Intronic
1151514711 17:74585626-74585648 CAGCAACTTAAACTGTAGTGGGG - Intronic
1153608294 18:6855885-6855907 CAGGCACGTCAGCTGCAGTGGGG - Intronic
1155533893 18:26795486-26795508 CAGGATCTTCAGCAGTAGCCAGG + Intergenic
1157687016 18:49650881-49650903 CAGGAAGCTCAGCAGGAGTGAGG - Intergenic
1158431325 18:57389931-57389953 AGGGAACATCAGCAGTAGTCTGG + Intergenic
1158888924 18:61855378-61855400 CAGGGACGCCAGCTGTAGTGGGG + Intronic
1160046742 18:75393268-75393290 CAGGAACGGCTGCAGTAGTCAGG - Intergenic
1160174501 18:76581485-76581507 CAGGAGCTCCCGCAGTGGTGGGG - Intergenic
1163263357 19:16204372-16204394 CAGGCCCTTCCGCAGTAGTGTGG - Intronic
1163374633 19:16922656-16922678 CAGGGACCTCAGATGTAGTGTGG - Intronic
1163742202 19:19022301-19022323 CAGGAACATAAGCAGCGGTGGGG + Intronic
1164491120 19:28715014-28715036 CAGGAACATCAGCAATAGTCTGG + Intergenic
1164715145 19:30385460-30385482 CAGGAACTCCAGGAGAAGAGAGG - Intronic
1164821542 19:31254950-31254972 CAGGTGCCTCAGCAGGAGTGGGG + Intergenic
1165247404 19:34505291-34505313 CAGGAAACTCAGGAGGAGTGTGG + Exonic
1166867959 19:45852485-45852507 CAGGAAGTTGTCCAGTAGTGTGG + Exonic
1167621709 19:50564413-50564435 CAGGAACAGCAGCAGAGGTGAGG + Intronic
1168125244 19:54279182-54279204 CAGGAAGATCAGCAGTGGTGAGG - Intronic
1168137423 19:54360728-54360750 CAGGAACCTAAGCAGGTGTGAGG + Intronic
1168172014 19:54595543-54595565 CAGGAAGATCAGCAGTGGTGAGG + Intronic
1168176739 19:54632368-54632390 CAGGAAGATCAGCAGTGATGTGG + Intronic
925171715 2:1754245-1754267 CAGTTACTTCCGCAGGAGTGGGG - Intergenic
926938034 2:18105646-18105668 CAGGAGCATCAGCAGTACTTGGG - Intronic
927375679 2:22410711-22410733 CAGGAAGTTCATCTGTAGTAAGG - Intergenic
928169133 2:28992146-28992168 CAGGAAGTCCAGCACAAGTGTGG - Intronic
928432437 2:31232110-31232132 CAGGAGCTTCAAGAGGAGTGTGG - Intronic
929564179 2:42974581-42974603 CAGGAATTTAAGCAGTGGTGTGG + Intergenic
930032326 2:47066014-47066036 CAGGCACCCCAGCAGTAGTGGGG + Exonic
930589935 2:53315405-53315427 CAGGGACTACAACAATAGTGAGG + Intergenic
930727443 2:54695567-54695589 AGGGAACTTCAGCAGTAGTCTGG + Intergenic
931169359 2:59786551-59786573 CAAGAATTTCAGCAGTTCTGAGG + Intergenic
932331885 2:70902359-70902381 CAGGAATTCCAGCAGGTGTGTGG + Intronic
933748099 2:85585222-85585244 CAGGATCTGCAGCAGGAGTGGGG - Intronic
934564301 2:95329978-95330000 CAGGATCTGCAGCAGAAATGGGG - Intronic
938141649 2:128799423-128799445 CAGGCTCTTCAGGAGTAGTGAGG + Intergenic
942396468 2:175555253-175555275 CAGGAAGTTCAGCAAAAATGTGG - Intergenic
944463176 2:199973705-199973727 TAGGAAGTTCAACAGAAGTGAGG - Intronic
946077764 2:217089278-217089300 CAGTAGCTTCATCAGTAGTCTGG + Intergenic
948871044 2:240798281-240798303 TAGCCACATCAGCAGTAGTGTGG + Intronic
1169701387 20:8451036-8451058 CAAGAACTATAACAGTAGTGGGG + Intronic
1170831767 20:19848886-19848908 GAGGAAATTCAACAGTAGTAAGG + Intergenic
1173098964 20:40065684-40065706 AGGGAACATCAGCAGTAGTCTGG + Intergenic
1174500597 20:50981285-50981307 CAGGAACGTCTGCAGGATTGAGG - Intergenic
1178001999 21:28171871-28171893 CAGGTAGTTCATCAATAGTGTGG + Intergenic
1179011925 21:37563141-37563163 CAGGGACTTCAGCTGTAATGAGG - Intergenic
1181017083 22:20076994-20077016 GAGGAATTTCATCAGTATTGAGG + Intergenic
1182178443 22:28318229-28318251 CAGGCAAGTCAGCAGTAATGGGG - Intronic
1184016801 22:41792299-41792321 CAGAATCTTCAGCAGTTGGGTGG + Intronic
950650832 3:14405586-14405608 CATGACCTTCTGCAGAAGTGGGG - Intronic
951032196 3:17895214-17895236 AAGGAACATCAGCAGTAGTCTGG - Intronic
952234421 3:31464141-31464163 CAGCAACTTCCACAGTTGTGAGG - Intergenic
953279463 3:41539771-41539793 CAGGAGCTTAAGCAGTTGAGAGG - Intronic
955056286 3:55458629-55458651 TAGGCACTCCAGCAGTAGTAGGG - Intergenic
956739393 3:72263470-72263492 CAGGAAGCTCAGAAGGAGTGGGG - Intergenic
958072879 3:88637219-88637241 AAGGAACTTCAGCAGTATCAGGG - Intergenic
958078398 3:88713034-88713056 AGGGAACATCAGCAGTAGTCTGG + Intergenic
959409019 3:105997548-105997570 AAGGAACATCAGCAGTAGACTGG - Intergenic
960106293 3:113801302-113801324 CTCGAACTTCAACAGAAGTGTGG + Intronic
960397171 3:117151701-117151723 CCTGAACTCCATCAGTAGTGTGG + Intergenic
960628980 3:119709469-119709491 CAGGAACTTGAGAAGTTGTTGGG + Intronic
960681312 3:120250033-120250055 AGGGAACATCAGCAGTAGTCTGG + Intronic
961057291 3:123799899-123799921 CAGGAACCTCTGCAGTACGGTGG - Intronic
961153825 3:124662099-124662121 TAGGAAGTCCAGCAGTAGGGAGG + Intronic
962230718 3:133663138-133663160 AAGGAACTTCAGGAGTAAAGGGG - Intergenic
964686804 3:159404474-159404496 AATGAACTTCAGTAGTAGTCAGG + Intronic
967150281 3:186642205-186642227 CAGGAAGGTGAGCAGAAGTGAGG - Intronic
967956462 3:194881116-194881138 CATTTACTGCAGCAGTAGTGGGG - Intergenic
969661569 4:8532656-8532678 CAGGAACATCAGCACTGGGGTGG + Intergenic
972440822 4:39089710-39089732 CAGGAAGATCAGCACTACTGGGG + Intronic
975095608 4:70453436-70453458 AGGGAACATCAGCAGTAGTCAGG - Intronic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
978067813 4:104427311-104427333 CATAAGCTTCAGCATTAGTGAGG + Intergenic
978205547 4:106076396-106076418 CAGCAACAGCAGCAGTATTGTGG + Intronic
978815153 4:112896043-112896065 CTGGAACTGAAGCAGTAGGGTGG - Intronic
979055447 4:115987492-115987514 CAGGAACAGAACCAGTAGTGAGG + Intergenic
981329249 4:143488889-143488911 AAGGAACATCAGCGGTAGTCTGG + Intergenic
982020499 4:151198917-151198939 CAGAAACTTCAGCAGTGGGTAGG + Intronic
982147438 4:152411353-152411375 CACGAACTCCAGTAGTATTGTGG - Exonic
983469678 4:168141384-168141406 TAGGAATTTCAGCATTAGTCTGG - Intronic
984664590 4:182411934-182411956 CAGGAACTGAAGCTGAAGTGAGG + Intronic
986899318 5:12412720-12412742 AGGGAACATCAGCAGTAGTATGG - Intergenic
988463506 5:31464970-31464992 AAGGAACTTAATCAATAGTGGGG - Intronic
990202759 5:53396956-53396978 AATGAACATCAGCAGTAGTCAGG - Intergenic
993137874 5:83992975-83992997 CAGGTACTTCAGCAGTATCTTGG - Intronic
993905558 5:93620292-93620314 AAGGATTTTCAGCAGTAATGCGG + Exonic
993973987 5:94454725-94454747 AAATAACTTTAGCAGTAGTGAGG + Intronic
995421837 5:111976480-111976502 CAGTACCTTCAGCAGTGCTGAGG + Intronic
997701322 5:135902074-135902096 CAGCCACTTCTGCAGTAGTCAGG - Intergenic
998505139 5:142666408-142666430 CATGAAATCCAGCAGCAGTGTGG + Intronic
999512774 5:152270110-152270132 CAGGAACTTGCCTAGTAGTGAGG - Intergenic
1000113010 5:158127154-158127176 CAGGCACTGCAGCAGCTGTGCGG + Intergenic
1001200755 5:169714117-169714139 CAGGAGCTCCAGCAGTGTTGGGG + Exonic
1001592293 5:172873758-172873780 AAGGAACCTCAGGAGTAGTAGGG + Intronic
1002014896 5:176313175-176313197 CTGGAAGTTCATCAGTAGAGTGG + Intronic
1004885746 6:20050157-20050179 GATGAATTTCATCAGTAGTGGGG - Intergenic
1005697283 6:28363418-28363440 CAGGAAGCTCAATAGTAGTGAGG - Intronic
1005774689 6:29118106-29118128 CAAAAAGTTCAGCAGTAGTGTGG + Intergenic
1006432659 6:34007492-34007514 GAGGGTCTTCAGCAGCAGTGTGG + Intergenic
1007411067 6:41661907-41661929 CAGGAAGTTCACAGGTAGTGTGG - Intergenic
1008727550 6:54441072-54441094 AGGGAACATCAGCAGTAGTGTGG - Intergenic
1009494711 6:64332507-64332529 CTGCAACTTCAACAGCAGTGAGG - Intronic
1010895844 6:81362379-81362401 CTGCAAATTCAGTAGTAGTGAGG + Intergenic
1010926610 6:81752661-81752683 CTGGAGCTTTAGCAGTTGTGCGG + Exonic
1011048487 6:83115093-83115115 TAGGAACTTCAGCAGTGGGATGG + Intronic
1012813695 6:103994454-103994476 CAGTACCTACATCAGTAGTGTGG + Intergenic
1013427191 6:110023470-110023492 CAGACTCTTCTGCAGTAGTGAGG + Intergenic
1016627073 6:146183928-146183950 CAGGAACTACAGCAATAATCAGG + Intronic
1018463470 6:164020908-164020930 CACCAAGTTCAGCAGGAGTGAGG + Intergenic
1018715184 6:166526894-166526916 GAGTGACTTGAGCAGTAGTGAGG - Intronic
1021082988 7:16385789-16385811 CAGGACCTGCAACAGGAGTGTGG + Intronic
1022582438 7:31569296-31569318 CAGGAAGTTGTGAAGTAGTGTGG - Intronic
1022751949 7:33238254-33238276 CCTGAACTTCAGGAATAGTGGGG + Intronic
1023102849 7:36736545-36736567 CAGGCACTTCATCATTAGGGTGG + Intergenic
1023240960 7:38146825-38146847 CAGAAACTTCAGCAGTAGACAGG + Intergenic
1024043147 7:45570318-45570340 CAGGACCTTCAACAGTTATGGGG + Intergenic
1024716037 7:52080196-52080218 CAGGAACTGGAGCAGAACTGTGG + Intergenic
1024767066 7:52672074-52672096 CAAGATCTTCAGGAGTGGTGAGG - Intergenic
1026735077 7:72944187-72944209 CAGGAGCTAAAGCAGTGGTGTGG + Intronic
1026785419 7:73299113-73299135 CAGGAGCTAAAGCAGTGGTGTGG + Intergenic
1027108655 7:75420820-75420842 CAGGAGCTAAAGCAGTGGTGTGG - Intronic
1027989768 7:85343191-85343213 CAGGAAATCCAGCAGGATTGTGG + Intergenic
1028135604 7:87220272-87220294 CCGGAACTGCAGCAGGAGTACGG + Intronic
1030370449 7:108693958-108693980 AGGGAACATCAGCAGTAGTCTGG - Intergenic
1030841661 7:114360550-114360572 CAGGAAATTCAGAAGTAATAGGG - Intronic
1031786705 7:126041732-126041754 CAGGCACACCAGCTGTAGTGGGG - Intergenic
1032017208 7:128387886-128387908 TAGGAGCTTCAGAAGCAGTGTGG - Intergenic
1032676503 7:134134491-134134513 CAGGAACATCAGGAGGTGTGAGG + Intronic
1034820977 7:154216044-154216066 CAGGAACCACAGCAGTGTTGAGG + Intronic
1035013726 7:155744630-155744652 CAGGAATGGCAGCAGTAGGGAGG - Intronic
1035095725 7:156353381-156353403 CAGGAACTGGAGCAGGAGTGGGG - Intergenic
1037640716 8:20740179-20740201 CTAGAACTTCAGCTGTAGTGTGG - Intergenic
1044616687 8:94149641-94149663 CAGGCATTTCAGCAGTGCTGGGG + Intronic
1045291712 8:100839070-100839092 GAGGGACTTCAGCAGGGGTGAGG - Intergenic
1048207938 8:132430628-132430650 GATGAACTTCTGCAGCAGTGAGG + Intronic
1048427023 8:134332451-134332473 AAGGATTTTCAGCAGTAGTCTGG + Intergenic
1051216673 9:14804979-14805001 CAGGAGCTTCATCATTTGTGGGG + Exonic
1051363406 9:16302486-16302508 CAGTTTCTTCAGCAGCAGTGTGG + Intergenic
1051434649 9:17018165-17018187 CAGGGACTGCAGGGGTAGTGAGG + Intergenic
1051437112 9:17044566-17044588 CAACAACTCTAGCAGTAGTGGGG + Intergenic
1052751940 9:32500863-32500885 CAGGAACTTGAGAAAAAGTGTGG + Exonic
1057423490 9:94930033-94930055 CAGGACCTTCAGCAGGAAGGTGG + Intronic
1060112267 9:120914699-120914721 CATGAACTTCAGGAGGAGGGAGG - Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1187604172 X:20865071-20865093 TAGGAACTTCAGAAGCAGTGTGG - Intergenic
1187618660 X:21026817-21026839 AGGGAACATCAGCAGTAGTCTGG - Intergenic
1188046205 X:25428407-25428429 AAGGAACATCAGCCGTAGTCTGG - Intergenic
1188424470 X:30030438-30030460 CAGGAACTTCTGCATCAATGAGG - Intergenic
1190416457 X:50184758-50184780 CAGGAACCTCTGCAGTAGAGTGG - Intergenic
1190717657 X:53117433-53117455 CAGGAATTTCAGGAGTGGAGTGG - Intergenic
1192027184 X:67466215-67466237 AAGGAACATCTGCAGTAGTCTGG + Intergenic
1194081023 X:89465419-89465441 CACCAGCTGCAGCAGTAGTGGGG - Intergenic
1194157838 X:90415377-90415399 CGGAAACATCAGCAGTAGTCTGG - Intergenic
1194476927 X:94369678-94369700 AGGGAACATCAGCAGTAGTCTGG + Intergenic
1194921926 X:99778135-99778157 AGGGAACATCAGCAGTAGTCTGG - Intergenic
1195821135 X:108946423-108946445 AAGAAACATCAGCAGTAGTCTGG - Intergenic
1197307707 X:124863457-124863479 AATGAACATCAGCAGTAGTCTGG + Intronic
1198567060 X:137915756-137915778 CAGCAACTTCAGCAGTGGCCTGG - Intergenic
1198685685 X:139225736-139225758 CAGGAACTGCAGCAGAAGCCAGG + Intergenic
1199754926 X:150855004-150855026 CAGGAACCTGAGCAATCGTGAGG + Intronic
1200433695 Y:3121622-3121644 CACCAGCTGCAGCAGTAGTGGGG - Intergenic
1200504167 Y:3992346-3992368 CGGAAACATCAGCAGTAGTCTGG - Intergenic
1200905677 Y:8479729-8479751 CAAGAACATCTGTAGTAGTGTGG - Intergenic
1201327479 Y:12779141-12779163 CAGTCACTTCAGCATTAGGGAGG + Intronic