ID: 901176302

View in Genome Browser
Species Human (GRCh38)
Location 1:7301918-7301940
Sequence TTCCGTGTGCTGGATGACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901176302_901176312 26 Left 901176302 1:7301918-7301940 CCCCTGTCATCCAGCACACGGAA 0: 1
1: 0
2: 0
3: 13
4: 175
Right 901176312 1:7301967-7301989 GGCTTCGGGGGTAAACTTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 70
901176302_901176307 11 Left 901176302 1:7301918-7301940 CCCCTGTCATCCAGCACACGGAA 0: 1
1: 0
2: 0
3: 13
4: 175
Right 901176307 1:7301952-7301974 TGAGACCAGAGCTGTGGCTTCGG 0: 1
1: 0
2: 6
3: 31
4: 383
901176302_901176310 14 Left 901176302 1:7301918-7301940 CCCCTGTCATCCAGCACACGGAA 0: 1
1: 0
2: 0
3: 13
4: 175
Right 901176310 1:7301955-7301977 GACCAGAGCTGTGGCTTCGGGGG 0: 1
1: 0
2: 1
3: 16
4: 176
901176302_901176306 5 Left 901176302 1:7301918-7301940 CCCCTGTCATCCAGCACACGGAA 0: 1
1: 0
2: 0
3: 13
4: 175
Right 901176306 1:7301946-7301968 GAGTTGTGAGACCAGAGCTGTGG 0: 1
1: 0
2: 2
3: 23
4: 254
901176302_901176309 13 Left 901176302 1:7301918-7301940 CCCCTGTCATCCAGCACACGGAA 0: 1
1: 0
2: 0
3: 13
4: 175
Right 901176309 1:7301954-7301976 AGACCAGAGCTGTGGCTTCGGGG 0: 1
1: 0
2: 0
3: 11
4: 224
901176302_901176308 12 Left 901176302 1:7301918-7301940 CCCCTGTCATCCAGCACACGGAA 0: 1
1: 0
2: 0
3: 13
4: 175
Right 901176308 1:7301953-7301975 GAGACCAGAGCTGTGGCTTCGGG 0: 1
1: 0
2: 0
3: 46
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901176302 Original CRISPR TTCCGTGTGCTGGATGACAG GGG (reversed) Intronic
901176302 1:7301918-7301940 TTCCGTGTGCTGGATGACAGGGG - Intronic
902620430 1:17647587-17647609 TGCAGTGTGCTGGGTGTCAGGGG + Intronic
906260637 1:44386027-44386049 TCCCAAGTGCTGGATGACAGGGG + Intergenic
908882028 1:68743231-68743253 TTCCGGGGTCTGGAGGACAGTGG - Intergenic
910085707 1:83399869-83399891 TTTGGTGTGCAGGATGACAGTGG - Intergenic
912073187 1:105839633-105839655 TTCCGGGTTCTGGAGGACAGTGG - Intergenic
913174635 1:116262725-116262747 TTCCCTGGGCTGCAAGACAGAGG - Intergenic
913278030 1:117158152-117158174 TTCTGTGGTCTGGAGGACAGTGG + Intronic
913601160 1:120422149-120422171 AACTGTGTGCTGGAGGACAGGGG - Intergenic
914085884 1:144454452-144454474 AACTGTGTGCTGGAGGACAGGGG + Intronic
914191781 1:145418432-145418454 AACTGTGTGCTGGAGGACAGGGG + Intergenic
914589706 1:149096433-149096455 AACTGTGTGCTGGAGGACAGGGG + Intronic
918083481 1:181225133-181225155 TTCAGTGTGTTGAATGCCAGAGG + Intergenic
918485817 1:185027299-185027321 TTCTGGGTGCTGTAGGACAGTGG + Intergenic
919839012 1:201595706-201595728 TTCCCTTGGCTGGAAGACAGTGG - Intergenic
920096771 1:203491670-203491692 TCCTGTGTTTTGGATGACAGGGG - Intergenic
922620590 1:226985768-226985790 TTCCGCTTGCTGCTTGACAGTGG + Intronic
922636441 1:227177615-227177637 TTCCGTGGGGTGGAGGGCAGGGG + Intronic
923878336 1:238075270-238075292 TTCTGGGTTCTGGAGGACAGTGG + Intergenic
1063883206 10:10551832-10551854 TAGAGTGAGCTGGATGACAGAGG - Intergenic
1064468656 10:15612678-15612700 TTCCTTTTGCTGGATGATGGAGG - Intronic
1068243594 10:54336806-54336828 TTCTGGGTTCTGGAGGACAGTGG - Intronic
1068431214 10:56934797-56934819 TTCTGGGTTCTGGAGGACAGTGG - Intergenic
1068739439 10:60451895-60451917 TTCAGTGTCCTTGAAGACAGTGG - Intronic
1070315229 10:75303802-75303824 TTCGCTATGCTGGATGACAGTGG + Intergenic
1070529188 10:77321530-77321552 TTCTGTCTGCTGGATGACTTGGG - Intronic
1071112520 10:82176525-82176547 TTCAGTGTGCTCTGTGACAGAGG - Intronic
1073115988 10:101091918-101091940 TTGTGTGTGCTGAATGACTGGGG + Intronic
1074237441 10:111600035-111600057 TTCCATCTGCTTGATCACAGTGG + Intergenic
1079250792 11:18786048-18786070 TTCCATGTGCTGCAGCACAGTGG + Intronic
1080118672 11:28649035-28649057 TTCCATCAGCTGGAAGACAGTGG - Intergenic
1081737555 11:45414572-45414594 TGCTGTGTGCTGGTTGAAAGAGG - Intergenic
1085453857 11:76654990-76655012 TTCTGAGTCCTGGAAGACAGGGG + Intergenic
1085769925 11:79315538-79315560 ATCCTTGTGCTGGAGAACAGGGG + Intronic
1087511562 11:99101821-99101843 TTCTGGGTGCTGGAGGACGGTGG + Intronic
1087793680 11:102433147-102433169 TTCTGGGGGCTGGAGGACAGTGG - Intronic
1090447840 11:126779346-126779368 TGCCCTGTGCTGGGTCACAGAGG - Intronic
1090708991 11:129369171-129369193 TTCCCTGTGCTGCCTGACATGGG + Intergenic
1093350974 12:18103040-18103062 TTCTGGGTTCTGGAGGACAGTGG + Intronic
1095395366 12:41756756-41756778 TTCTGGGTTCTGGAGGACAGTGG + Intergenic
1098426970 12:70375597-70375619 TTCCCTAGGCTGGATTACAGTGG - Intronic
1100298774 12:93287743-93287765 TTCGGTGTGCAGGATAATAGAGG - Intergenic
1102260962 12:111443046-111443068 TTCTGTGTGCTGAGGGACAGGGG - Intronic
1103264620 12:119618395-119618417 TTCTGGGTTCTGGAGGACAGTGG - Intronic
1106614486 13:31314248-31314270 TTCTGTGGTCTGGAGGACAGTGG - Intronic
1108436411 13:50405674-50405696 TTCAGTTTTCTGGATGACATGGG - Intronic
1109077658 13:57858371-57858393 TTCAGTGTGCCAGATGACAAGGG + Intergenic
1109098314 13:58145427-58145449 TTCCGGGTTCTGGAGGACAGTGG - Intergenic
1109107902 13:58278018-58278040 TTCTGGGTTCTGGAGGACAGTGG + Intergenic
1109393625 13:61725453-61725475 TTCTGGGGTCTGGATGACAGTGG + Intergenic
1111081894 13:83321993-83322015 TTCCGGGGTCTGGAAGACAGTGG + Intergenic
1111083521 13:83343193-83343215 TTCCGGGGTCTGGAGGACAGAGG - Intergenic
1111358806 13:87146497-87146519 TTCTGGGTTCTGGAGGACAGTGG - Intergenic
1111472018 13:88695604-88695626 TTCTGTGGTCTGGAGGACAGTGG + Intergenic
1111634380 13:90884479-90884501 TTCCATGAGATGGATGAGAGAGG + Intergenic
1112184938 13:97118590-97118612 TTCTGTGTTCTGGATCACAGGGG + Intergenic
1114674043 14:24429541-24429563 TTCCGTTTGTTGGAAGAAAGGGG + Intronic
1116917287 14:50537495-50537517 TTCTGTGATCTGGAGGACAGTGG - Intronic
1117201132 14:53391316-53391338 GTCAGTGGGCGGGATGACAGGGG - Intergenic
1118060792 14:62135657-62135679 TTCTGGGTTCTGGAGGACAGTGG + Intergenic
1119963138 14:78882304-78882326 TTCTGGGTTCTGGAGGACAGTGG - Intronic
1120767044 14:88337772-88337794 CTCAGAGTTCTGGATGACAGAGG - Intergenic
1121128868 14:91427454-91427476 TTCTGTGATCTGGAGGACAGTGG - Intergenic
1122598503 14:102909326-102909348 TTCCCTGTGCGGGTGGACAGAGG + Exonic
1124251977 15:28112980-28113002 TTCCATGTGCTGCAGGACTGTGG + Intronic
1125116519 15:36099880-36099902 TTCCTTGTACTTGAGGACAGAGG + Intergenic
1125700022 15:41674148-41674170 TCCCAAGTGCTGGATTACAGGGG + Intronic
1127251902 15:57247408-57247430 TGTAGTCTGCTGGATGACAGAGG - Intronic
1128357640 15:66939470-66939492 CTCCGTGTTCTGAATGGCAGAGG + Intergenic
1129261695 15:74372148-74372170 TTCTGTGTCCTGGAGGAAAGGGG + Intergenic
1131572756 15:93555722-93555744 GTGCGTGGGATGGATGACAGTGG + Intergenic
1131679025 15:94702265-94702287 TTCCTTCTGCTGAAGGACAGAGG + Intergenic
1132178936 15:99736863-99736885 TTCCGTGTGCTGGGGCACAGTGG + Intergenic
1133681807 16:8126859-8126881 TTCCCTGTGGTGGTGGACAGGGG + Intergenic
1137778653 16:51077901-51077923 TTCTGGGTTCTGGAGGACAGTGG + Intergenic
1144187261 17:12808257-12808279 TTCTGGGTTCTGGATGACGGTGG + Intronic
1144528605 17:16013162-16013184 TTGCCTGTGCTGAAGGACAGTGG - Intronic
1148673784 17:49433076-49433098 CTGTGTGTGCTGGATGACAGTGG - Intronic
1151055347 17:71024295-71024317 TTTACTGAGCTGGATGACAGTGG - Intergenic
1152211744 17:79006116-79006138 TGCCGTGTGCTGGATACTAGGGG - Intronic
1152601040 17:81262287-81262309 TGCCCTGTGCTGGCTGGCAGAGG - Intronic
1156340376 18:36205232-36205254 TTTAATGTGCTGGATGACAAAGG + Exonic
1156858818 18:41813544-41813566 TTCTGGGTTCTGGAGGACAGTGG + Intergenic
1159265482 18:66073552-66073574 TTCAGGGTTCTGGAGGACAGTGG + Intergenic
1159751017 18:72302788-72302810 TTCTGGGGGCTGGAGGACAGTGG + Intergenic
1159767645 18:72509621-72509643 TTCTGAGTTCTGGAGGACAGTGG + Intergenic
1159823958 18:73182406-73182428 TACCTTGTACTGGATCACAGTGG - Intronic
1162445385 19:10719336-10719358 TTCCGAGTGCTAGAACACAGGGG + Intronic
1164447428 19:28329969-28329991 TTCTGGGTTCTGGAGGACAGTGG - Intergenic
928571049 2:32608917-32608939 TTGCCTGTGCTGGAATACAGTGG + Intronic
929564071 2:42973993-42974015 TTCTGTCTGCTGGGTGACAGGGG + Intergenic
930312890 2:49764158-49764180 TTCCCTTTTCTGGATGTCAGGGG - Intergenic
932731990 2:74227931-74227953 CACCCTGTTCTGGATGACAGTGG + Intronic
937475371 2:122210244-122210266 ATCAGTCTGATGGATGACAGTGG - Intergenic
941525157 2:166597846-166597868 TTCTGTGGTCTGGAAGACAGTGG + Intergenic
943871658 2:193008085-193008107 TTCTGTGCCCTGGAGGACAGTGG + Intergenic
945003388 2:205376364-205376386 TTCCATGGGTTGGACGACAGAGG + Intronic
945291695 2:208133738-208133760 TTCGGTGTGTAGGATGACACAGG + Intergenic
945892258 2:215442564-215442586 CTCTGTTTGCTGGAGGACAGAGG + Intergenic
947968173 2:234299893-234299915 TTCCTTGTGCTGCAGGACTGAGG + Intergenic
948543073 2:238703635-238703657 TGGCGTGTGCTGGATCCCAGAGG + Intergenic
1174461292 20:50684734-50684756 TTCTGGGTGCAGGTTGACAGGGG + Intronic
1177212065 21:18083455-18083477 TTCTGGGTTCTGGAGGACAGTGG - Intronic
1178154180 21:29832291-29832313 TTCCGAGGTCTGGAGGACAGTGG + Intronic
1179830721 21:43994404-43994426 CTCCGTGTGCTGGTGGGCAGGGG - Intergenic
1182716039 22:32356828-32356850 TTCCGTACCCTGGGTGACAGGGG + Intronic
1184960280 22:47923494-47923516 TTCCTTTTGCTGGAACACAGAGG + Intergenic
1185062289 22:48613382-48613404 CACAGTGGGCTGGATGACAGAGG - Intronic
1185384144 22:50524080-50524102 TTCCACCTGCTGGATCACAGAGG - Exonic
953359231 3:42280386-42280408 TTCTGGGGGCTGGAGGACAGTGG - Intergenic
953379344 3:42455191-42455213 TTCCGGGGGCTGGAGGACAGTGG + Intergenic
953607038 3:44419005-44419027 TGCCCTGTGTTGGATGACGGGGG - Intergenic
954424248 3:50434997-50435019 TTCTGTGCCCTGAATGACAGAGG - Intronic
957113210 3:75992653-75992675 TTCTGAGTTCTGGAGGACAGTGG - Intronic
959233609 3:103690345-103690367 TTCTGGGGTCTGGATGACAGTGG + Intergenic
960945713 3:122965013-122965035 TTCCATGTGCTGGAGGGAAGAGG + Intronic
961503781 3:127356639-127356661 TTCTGGGGGCTGGAAGACAGTGG + Intergenic
961997037 3:131257022-131257044 TTGCCTGTGCTGGAGTACAGTGG + Intronic
963411071 3:144928739-144928761 TTCCCTGTGCTGGAGTGCAGTGG + Intergenic
963538903 3:146562198-146562220 TTCTGGGTTCTGGAGGACAGTGG + Intergenic
963975982 3:151480964-151480986 TTCCTTGTGCAGGAGGACTGAGG - Intergenic
970302116 4:14692366-14692388 TTCTGGGTTCTGGAAGACAGTGG - Intergenic
972094651 4:35334014-35334036 TTCTGTGGTGTGGATGACAGTGG + Intergenic
973015708 4:45134742-45134764 TTCTGGGTTCTGGAGGACAGTGG + Intergenic
974271034 4:59651790-59651812 TTCTGGGGTCTGGATGACAGTGG - Intergenic
976551645 4:86403148-86403170 TTCCTGGTGCTGGATGATATGGG + Intronic
976875573 4:89850148-89850170 TTCTGGGTTCTGGAGGACAGTGG + Intergenic
979464618 4:121022101-121022123 TTCCGGGATCTGGAGGACAGTGG + Intergenic
980310687 4:131125890-131125912 TTCTGTGGTCTGGAGGACAGTGG + Intergenic
980335586 4:131469168-131469190 TTCTGGGGTCTGGATGACAGCGG - Intergenic
982310036 4:153974983-153975005 TTCTGGGTTCTGGATGACAGTGG - Intergenic
986402158 5:7393351-7393373 TACCATGTGCTGGATGAAGGGGG - Intergenic
986667350 5:10115087-10115109 TTCCATGGGCTGGAGGACAGAGG + Intergenic
988310292 5:29548387-29548409 TTCTGTGGTCTGGAGGACAGCGG + Intergenic
988609618 5:32712258-32712280 GTCCTTGTGCTGGAAGCCAGCGG - Exonic
990371906 5:55128462-55128484 TTCTGTGTCCTGGATAAAAGAGG - Exonic
993275334 5:85850126-85850148 TTCTGGGTTCTGGAGGACAGTGG + Intergenic
994035313 5:95193557-95193579 TTCAGTGAGCTTGATGACAAAGG - Intronic
998213979 5:140223584-140223606 TTCCGGATGCTGGAGGACAAAGG + Intronic
999507647 5:152214758-152214780 TTTGGTGTGCTGGACCACAGTGG - Intergenic
1002586372 5:180251480-180251502 TGCCGTCTGCTGGAAGACTGTGG + Intronic
1004306941 6:14509624-14509646 CTCCCTGTGCTCGATCACAGTGG + Intergenic
1006899357 6:37490139-37490161 AGCAGTGTGCTGGCTGACAGTGG - Intronic
1007147163 6:39647607-39647629 TTCCTTGTGCTGAAGGGCAGGGG - Intronic
1007196635 6:40066966-40066988 TTCCGGGATCTGGAGGACAGTGG - Intergenic
1009554728 6:65148602-65148624 TTCTGGGGGCTGGAGGACAGCGG + Intronic
1009631679 6:66208641-66208663 TTCTGGGTTCTGGAGGACAGTGG + Intergenic
1013296874 6:108765506-108765528 TACCATGTGTTGGCTGACAGAGG - Intergenic
1013858214 6:114601613-114601635 TTCCATGTTCTGGATAACAATGG + Intergenic
1016110000 6:140211006-140211028 TGCCATTTGCTGGATGACAATGG + Intergenic
1016348250 6:143139412-143139434 CTCCATGTGCTGGGTGACACGGG - Intronic
1018093680 6:160366527-160366549 TTCTGGGTTCTGGAGGACAGTGG + Intronic
1018609928 6:165638073-165638095 TTCTCTGTGCTGGGTGAAAGAGG + Intronic
1021884529 7:25125565-25125587 TTGCGTGTGCTGGAGGAGCGGGG + Intergenic
1022013244 7:26327354-26327376 TACTTTGTGTTGGATGACAGGGG + Intronic
1022040952 7:26580591-26580613 TTCCATGGCCTTGATGACAGTGG - Intergenic
1022400333 7:30030067-30030089 TTTGGTTTGGTGGATGACAGAGG + Intronic
1027180340 7:75935018-75935040 TTCCGGGGTCTGGAGGACAGTGG - Intronic
1027302582 7:76856330-76856352 TTTGGTGTGCAGGGTGACAGTGG - Intergenic
1030477551 7:110056002-110056024 TTCAGTATGCTGAAAGACAGTGG - Intergenic
1032179172 7:129660795-129660817 TTCTGGGGGCTGGAGGACAGTGG + Intronic
1032866502 7:135930730-135930752 TTCCAAGTGCTGGAGTACAGTGG - Intronic
1033518004 7:142128913-142128935 TTCTGGGGGCTGGAGGACAGTGG - Intronic
1039357362 8:36835382-36835404 TTGCCTGTGCTGGAGGGCAGTGG + Intronic
1039933493 8:42017632-42017654 TACAGTGTGCTGGAAGGCAGAGG + Intronic
1040769578 8:50956825-50956847 GTCCGTGTTCTGGATAACATGGG + Intergenic
1045067262 8:98460014-98460036 TTCTGTGTTCTGGAGGAGAGTGG - Intronic
1045675910 8:104607798-104607820 TTCTGAGTTCTGGAGGACAGTGG - Intronic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1046689551 8:117267495-117267517 TTCTGTGGTCTGGAGGACAGTGG + Intergenic
1047193848 8:122703515-122703537 TTCCGTTTGCTAGATGAAAAAGG + Intergenic
1050770911 9:9198612-9198634 TTCAATGTGCTGGATTACCGAGG + Intronic
1052008290 9:23376583-23376605 ATCAGGGTGCTGGATCACAGTGG - Intergenic
1052414196 9:28157027-28157049 TTCTGGGTTCTGGAGGACAGTGG + Intronic
1055174317 9:73299010-73299032 TTCTGGGTTCTGGAGGACAGTGG + Intergenic
1055460007 9:76510659-76510681 TTCCTTGAGCTGCATGCCAGTGG + Intergenic
1056148974 9:83765471-83765493 TTCTGGGGGCTGGAGGACAGTGG - Intronic
1056192656 9:84199323-84199345 TTCTGGGTTCTGGAGGACAGTGG + Intergenic
1057831338 9:98409520-98409542 TCCTGTGTGGTGGATGCCAGGGG + Intronic
1060494204 9:124106043-124106065 TTCCATGTGCTGGAGGCCACAGG + Intergenic
1188755127 X:33952837-33952859 TTCTGGGTTCTGGAAGACAGTGG + Intergenic
1192727751 X:73769777-73769799 TTCATTGGGCTGGAAGACAGTGG - Intergenic
1195525887 X:105889437-105889459 TTCAGGGTTCTGGAGGACAGTGG + Intronic
1196461434 X:115935807-115935829 TTCCTTCTGCTTGATGAGAGAGG - Intergenic
1197220306 X:123905850-123905872 TGCCCTGTCCTGGATGACAGTGG + Intronic
1197439944 X:126475849-126475871 TTCTGGGGTCTGGATGACAGTGG + Intergenic
1197731126 X:129810984-129811006 TTCAGTGTGCTGGATCGAAGGGG - Exonic
1199041425 X:143119405-143119427 TTCTGTGGTCTGGAGGACAGTGG + Intergenic
1200062644 X:153490400-153490422 TTCCCAGTGCTGGATGGCCGAGG - Intronic