ID: 901177560

View in Genome Browser
Species Human (GRCh38)
Location 1:7315728-7315750
Sequence CTTTAGGGGTGGATCTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901177547_901177560 24 Left 901177547 1:7315681-7315703 CCAAAAATACAAAATCAAAGCGT 0: 1
1: 0
2: 1
3: 27
4: 525
Right 901177560 1:7315728-7315750 CTTTAGGGGTGGATCTTTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901177560 Original CRISPR CTTTAGGGGTGGATCTTTCC TGG Intronic
900743578 1:4345051-4345073 CTTTAGGGGTGGTTATTTGAAGG + Intergenic
900783384 1:4632209-4632231 CTTGAGGTGTGGATTTATCCTGG - Intergenic
901177560 1:7315728-7315750 CTTTAGGGGTGGATCTTTCCTGG + Intronic
901754425 1:11432722-11432744 CCATAGGGGAGGATCCTTCCTGG + Intergenic
907864609 1:58387652-58387674 CTCTAGGAGTTAATCTTTCCTGG + Intronic
908620663 1:65975901-65975923 CTTCAGGGGTGGAGCCCTCCTGG + Intronic
909864315 1:80647931-80647953 CTTTTGGAGTGTATCTTTCTGGG + Intergenic
910629970 1:89344345-89344367 CTTGAGGGCAGGGTCTTTCCTGG - Intergenic
911675858 1:100657292-100657314 CTTTAGGGATGGATTTTTGGGGG - Intergenic
912300015 1:108505201-108505223 CTTTGGGGGAAGAGCTTTCCAGG - Intergenic
914435962 1:147659510-147659532 CTTTAGGGGGGCATGTTTGCTGG - Exonic
914951403 1:152118176-152118198 CTTTAGGGGTGGGGCTTTGCTGG + Intergenic
917099618 1:171432023-171432045 CTCTGGTGGTTGATCTTTCCTGG - Intergenic
917681812 1:177375324-177375346 CTGCAGGGGTGGATCTCTCATGG - Intergenic
921278779 1:213545040-213545062 CTATAGGGTTGGCTCTTTCAGGG + Intergenic
1062788039 10:281562-281584 CTTTGGGAGAAGATCTTTCCTGG + Intronic
1064007486 10:11710011-11710033 CTCCAGGGGAGGATGTTTCCTGG + Intergenic
1064991328 10:21259512-21259534 CTCTAGGTGTGGATCTTTTGAGG - Intergenic
1065435372 10:25699763-25699785 CTATAGGAGTAGATCATTCCAGG - Intergenic
1065974339 10:30829337-30829359 CTGAAGGGATGGATCTTTCAAGG - Intronic
1069241792 10:66150163-66150185 TTATGGGGGTGGATATTTCCTGG + Intronic
1070820777 10:79352919-79352941 TTTTAGGGATGTCTCTTTCCTGG + Intronic
1074260502 10:111848689-111848711 CTGCAGGGGTGGATCCTTCATGG + Intergenic
1075910112 10:126117259-126117281 CCTTAGGGGTGGAGGTTTCATGG + Intronic
1076056154 10:127374848-127374870 CTCTAGGGGGGGATCCTTCCTGG - Intronic
1078604831 11:12765874-12765896 CTCTATGTCTGGATCTTTCCTGG + Intronic
1082959778 11:58907108-58907130 GTTTTAGGGTGGTTCTTTCCTGG + Intronic
1082975306 11:59064552-59064574 GTTTTAGGGTGGTTCTTTCCTGG + Intergenic
1082979737 11:59108288-59108310 GTTTTAGGGTGGTTCTTTCCTGG + Intronic
1083012918 11:59421311-59421333 CTATGGGGGTGGATCTCTCATGG - Intergenic
1083737793 11:64691568-64691590 CTTGAGCTGTGGAACTTTCCAGG + Intronic
1086153690 11:83641689-83641711 GATTTGGGGTGGATCTCTCCAGG + Intronic
1088603080 11:111500709-111500731 CTTTAGGGGTGGAGCACACCTGG - Intronic
1089047313 11:115513537-115513559 CCTTAAGGTTGTATCTTTCCAGG - Intergenic
1089781570 11:120876709-120876731 CTTTAGAGGTAGATCTCTCTGGG - Intronic
1090256767 11:125289927-125289949 CTTGAGGGCTGGGTCTTTCCTGG + Intronic
1090493715 11:127189686-127189708 CCTCACCGGTGGATCTTTCCTGG - Intergenic
1091769865 12:3144522-3144544 CTCTAGGGGAAGATCCTTCCTGG - Intronic
1094544234 12:31389642-31389664 TTTTAGGGGTCGATGTTTCATGG + Intronic
1094816793 12:34194982-34195004 CTTGAGGGGTGTATGTGTCCAGG - Intergenic
1098048522 12:66427750-66427772 CTTTAGGCGTGACTCTCTCCAGG - Intronic
1100297345 12:93275202-93275224 CTCTAGGGGAGGACCCTTCCGGG - Intergenic
1102525637 12:113510577-113510599 CTCTAGGGGAGGATCCTTCCTGG + Intergenic
1103166120 12:118772177-118772199 CTCTAGGGGAGGATCCTTTCTGG - Intergenic
1104476606 12:129075608-129075630 CTGCAGGAGTGGATCTGTCCTGG + Intronic
1107532959 13:41301909-41301931 CTCTGGTGGTTGATCTTTCCTGG + Intergenic
1109391830 13:61704366-61704388 CTTTAGGGGTGTAGCTCTCATGG + Intergenic
1109667463 13:65558362-65558384 TTATGGGGGTGGGTCTTTCCTGG - Intergenic
1110371015 13:74740298-74740320 GTTTATAAGTGGATCTTTCCTGG + Intergenic
1111173765 13:84565116-84565138 CTCTAGGGGAGAATCTTTTCAGG + Intergenic
1113408727 13:110065202-110065224 CGTCAGGGTTGGCTCTTTCCGGG + Intergenic
1115147648 14:30244146-30244168 CTTTAGGACTGGATCAGTCCAGG - Intergenic
1115957204 14:38794549-38794571 CTATAGGGGTGGCCCTTGCCAGG - Intergenic
1121553004 14:94816275-94816297 CTCTAGGGGAGAATCCTTCCTGG - Intergenic
1122009989 14:98738357-98738379 TTCTAGGGGAGGATCCTTCCTGG + Intergenic
1124997192 15:34735359-34735381 CTTTTGGGGAGGAGCATTCCAGG - Intergenic
1125965402 15:43871248-43871270 CTTTAGGGTTGTTTTTTTCCAGG - Exonic
1128714653 15:69899199-69899221 CTTTAGGTTTAGATCTTTCTTGG + Intergenic
1131459781 15:92609914-92609936 CTTTCAGGTTGGAACTTTCCAGG + Intergenic
1131985460 15:98039140-98039162 GTTTAGTGGTGGGTTTTTCCAGG - Intergenic
1134245358 16:12535658-12535680 CTTCAGGGCTGGGGCTTTCCAGG + Intronic
1135501067 16:22996294-22996316 CTCTAGGGGAGAATCCTTCCTGG + Intergenic
1137256865 16:46782775-46782797 CTATAGGTGTGCATCTTGCCTGG + Intronic
1140687557 16:77448267-77448289 CTTTAATGGTGGTTCTTTACTGG + Intergenic
1141581346 16:85001519-85001541 CTGTTGGGGTGGAAGTTTCCAGG + Intronic
1146660297 17:34661165-34661187 CTTGATGGGTGGAGCTCTCCTGG - Intergenic
1149445397 17:56709296-56709318 ATTTAGGGGAAGAGCTTTCCTGG - Intergenic
1150531126 17:65983003-65983025 CTCTAGGGATTTATCTTTCCTGG - Intronic
1156540377 18:37903753-37903775 CCTAAGGGGTGGCCCTTTCCTGG + Intergenic
1161924342 19:7289919-7289941 ATTTGGGGCTGGATCATTCCTGG - Intronic
1163644584 19:18481366-18481388 CTCTAGGGGAGGACCTTTCCTGG + Intronic
925640529 2:5982205-5982227 CTTTAGGGGTGAAGCTGTGCAGG - Intergenic
926377342 2:12245852-12245874 CCTTAGTTGTTGATCTTTCCTGG + Intergenic
926491371 2:13529455-13529477 CTATTGGGGTGGACCTTTACTGG - Intergenic
931047776 2:58375887-58375909 CTCTAGGGGAGGGTCCTTCCTGG + Intergenic
935658455 2:105444692-105444714 CTTTGGGACTGTATCTTTCCAGG - Intergenic
938547534 2:132348107-132348129 CTTTAGGAGAGGATCACTCCGGG + Intergenic
941398376 2:164999798-164999820 TTATGGGGGTGGGTCTTTCCTGG - Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
1171211622 20:23321317-23321339 CTTGAGGGTGGGATCTTTGCTGG + Intergenic
1171876400 20:30580862-30580884 CTTTAGGAGAGGATCACTCCGGG + Intergenic
1174841021 20:53901701-53901723 CTTTAGAGGGGAATGTTTCCTGG - Intergenic
1175229313 20:57463585-57463607 CTATAGGGGAGGATCCTTCCTGG - Intergenic
1178428374 21:32497897-32497919 TCTTAGGGGCGGGTCTTTCCCGG - Intronic
1179265868 21:39802929-39802951 TTATAGGGGTGGGTTTTTCCTGG - Intergenic
1181330316 22:22086044-22086066 CCTTAAGGGTGAATCTGTCCAGG - Intergenic
1182124716 22:27808097-27808119 CTTTAGGGCTGGGACTCTCCAGG - Intergenic
1182812808 22:33132028-33132050 TCATAGGGGTGGGTCTTTCCTGG - Intergenic
1182936505 22:34227736-34227758 CTTTAGGGGAGGATCCTTTTTGG + Intergenic
1183068332 22:35379170-35379192 CTCCAGTGGTTGATCTTTCCTGG - Intergenic
1184993140 22:48183940-48183962 CTTTAGGGGAGGTTATTTCTTGG + Intergenic
949093674 3:60519-60541 CTTGAGAGGTGGAGCTATCCTGG + Intergenic
949516019 3:4807642-4807664 CATTAGGGGTGGATTTTGGCAGG + Intronic
951865548 3:27303015-27303037 CATTAGGGGTAGACGTTTCCAGG - Intronic
954410538 3:50368788-50368810 CTTGAGGGGAGGAGCATTCCAGG - Intronic
959755698 3:109896096-109896118 CTTTAGCTGTGTACCTTTCCTGG - Intergenic
960874857 3:122286180-122286202 ATTTGAGGGTGGATCTTTCTTGG - Exonic
962383577 3:134915456-134915478 CTATCGGGGAGGATCTTTCCTGG - Intronic
962564422 3:136642825-136642847 CTCTAGGGGAGGATCCTCCCTGG + Intronic
962576153 3:136756790-136756812 CTCTAGTGGTTGATATTTCCTGG - Intergenic
963683510 3:148410224-148410246 CTTAAGGGGTGGAGCCCTCCTGG - Intergenic
964144456 3:153441999-153442021 CTATAGGTATGTATCTTTCCTGG - Intergenic
973248316 4:48034490-48034512 CTTTAGGAATGTATCTTTCTTGG + Intronic
976715651 4:88120227-88120249 CTTTAGGGGTGGAGCCCTCATGG + Intronic
979994969 4:127420752-127420774 CTTCAGAGGTGGAAGTTTCCTGG + Intergenic
980436305 4:132778454-132778476 GTTTACTGGTGGTTCTTTCCTGG - Intergenic
982805269 4:159755259-159755281 CTTTGGGGGTGGAGCTTTTATGG + Intergenic
984605972 4:181786625-181786647 CTCTGGTGGTTGATCTTTCCTGG + Intergenic
984658292 4:182343803-182343825 GTTTAAGGTTAGATCTTTCCAGG + Intronic
984730761 4:183066020-183066042 CTCCAGGGGAGGATCTGTCCTGG - Intergenic
986208702 5:5649808-5649830 CTCTAGGGGCAGAGCTTTCCTGG + Intergenic
986348316 5:6854587-6854609 CTCTAGGGGAGGATGCTTCCTGG - Intergenic
986515147 5:8553772-8553794 TTTTAGGGGTGCATCTCTCCAGG - Intergenic
987340268 5:16933811-16933833 ATTTAAGGGTGGAACTTTCACGG + Intronic
991121181 5:63016044-63016066 TTCTGGTGGTGGATCTTTCCTGG + Intergenic
992816657 5:80447545-80447567 CTTTATGGGTAGTTTTTTCCAGG + Intronic
994257831 5:97620985-97621007 CTTAAGAGGTGTATATTTCCAGG + Intergenic
997671902 5:135681941-135681963 CCTTTTGGGTGGATTTTTCCTGG + Intergenic
997741170 5:136256268-136256290 CTTAAGGGCTGCAGCTTTCCAGG + Intronic
998503646 5:142654751-142654773 CTTTAGGGTTGGCTCCTTCCAGG + Intronic
998532202 5:142895639-142895661 CTTTTGGGGTGGATTTTTTTAGG + Intronic
1005317167 6:24614329-24614351 CTTTTGAGCTGGATATTTCCAGG - Intronic
1005988692 6:30890357-30890379 ATTTAGGGGAGGAGCTTTGCAGG - Intronic
1006391453 6:33761364-33761386 GAGTGGGGGTGGATCTTTCCTGG - Intergenic
1010275277 6:73961949-73961971 CTCTAGGCATGGATCCTTCCTGG - Intergenic
1012967154 6:105687236-105687258 CTTCAGGGGTGGAGCTCTCATGG + Intergenic
1017570182 6:155735672-155735694 CCCTAGGTGTGGATGTTTCCTGG + Intergenic
1022337383 7:29434457-29434479 CTCTAGGGGAGGATCTTCTCTGG + Intronic
1023956245 7:44889200-44889222 CTTTAGGGATGGATCTCAACAGG + Intergenic
1024142131 7:46472247-46472269 CTTTTGGGATGGATGTGTCCTGG + Intergenic
1024730118 7:52244364-52244386 TCATAGGGGTGGGTCTTTCCTGG + Intergenic
1026654970 7:72248754-72248776 CTTTGGGGGTACATCTTTCGGGG + Intronic
1027796823 7:82705525-82705547 TTTTAGGTGAAGATCTTTCCAGG - Intergenic
1029140834 7:98408712-98408734 TTATAAGGGTGGGTCTTTCCTGG + Intergenic
1029839271 7:103344773-103344795 CTTCCGGGATGGATCTTTCGTGG + Exonic
1030559089 7:111063092-111063114 CTGTAGGGGTGGAGCTCTCATGG - Intronic
1032004144 7:128286497-128286519 CTTTAGGGGAGGACAGTTCCTGG - Intergenic
1032270479 7:130400141-130400163 CTTTGGGGCTGGATCGTTTCCGG + Exonic
1035708571 8:1695713-1695735 CTGTAGGGGTGGTTCCTACCTGG - Intronic
1037023042 8:13997851-13997873 CTTTGGTGGTTGATCTTTCCTGG - Intergenic
1037319496 8:17630001-17630023 CATCCGGGGTGGTTCTTTCCTGG - Intronic
1037600665 8:20391256-20391278 CTTTATGGCTGCATGTTTCCCGG - Intergenic
1037625053 8:20599383-20599405 CATTTGGGGTGGATGTTTTCTGG + Intergenic
1037922120 8:22814832-22814854 CTTTATGGGTAGATGCTTCCAGG - Intronic
1042235651 8:66611424-66611446 CTAGAAGGGTGGTTCTTTCCTGG + Intronic
1044220418 8:89663371-89663393 CTGTAGGGGTGGAGCTCTCATGG - Intergenic
1048856435 8:138690349-138690371 CTTTAGGGTTGCATCTTTTTTGG - Intronic
1049164727 8:141118807-141118829 CTTTGGTGTTGGATCTTCCCAGG + Intronic
1052637209 9:31121177-31121199 CTTCAGGGGTGGAGCTGCCCAGG - Intergenic
1053044820 9:34906832-34906854 CTCCAGTGGTTGATCTTTCCTGG - Intergenic
1053111111 9:35460851-35460873 CTTGAGGGGTTGAGCCTTCCAGG - Intergenic
1055531426 9:77188016-77188038 TCATAGGGGTGGATCTTTCATGG + Intronic
1055752338 9:79520914-79520936 CATTAGAGGTGTTTCTTTCCAGG + Intergenic
1061494809 9:130966623-130966645 CTATAGTGGTGAATCTTCCCAGG - Intergenic
1185923933 X:4125474-4125496 CTCTAGAGGAGGATCCTTCCTGG - Intergenic
1185942561 X:4338124-4338146 CTTTAGGGATGGCTCTTTTTTGG - Intergenic
1187590254 X:20709877-20709899 TTTTTGGGGTGGCTTTTTCCAGG + Intergenic
1190784056 X:53626575-53626597 GTTTCGGTGCGGATCTTTCCAGG - Intronic
1191840530 X:65510609-65510631 CTTAAGCGGTGGAGCTTGCCTGG + Intergenic
1196376835 X:115042410-115042432 CTTTAGGGGAGGAAGTTTGCAGG - Intergenic
1196483634 X:116179930-116179952 CTGTAGGGGTGGGTCCTTCACGG + Intergenic
1196760929 X:119200289-119200311 CTCCAGTGGTTGATCTTTCCTGG + Intergenic