ID: 901177951

View in Genome Browser
Species Human (GRCh38)
Location 1:7318320-7318342
Sequence TTGGTCAGTGACTGGTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901177947_901177951 -5 Left 901177947 1:7318302-7318324 CCCTGGGGTATGGTGGACTTGGT 0: 1
1: 0
2: 0
3: 6
4: 104
Right 901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG 0: 1
1: 0
2: 2
3: 13
4: 167
901177948_901177951 -6 Left 901177948 1:7318303-7318325 CCTGGGGTATGGTGGACTTGGTC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG 0: 1
1: 0
2: 2
3: 13
4: 167
901177943_901177951 7 Left 901177943 1:7318290-7318312 CCGTAAAGGCTTCCCTGGGGTAT 0: 1
1: 0
2: 1
3: 23
4: 254
Right 901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG 0: 1
1: 0
2: 2
3: 13
4: 167
901177942_901177951 8 Left 901177942 1:7318289-7318311 CCCGTAAAGGCTTCCCTGGGGTA 0: 1
1: 0
2: 2
3: 11
4: 168
Right 901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG 0: 1
1: 0
2: 2
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901177951 Original CRISPR TTGGTCAGTGACTGGTTGGC TGG Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901839919 1:11947759-11947781 TCGGTCAGTTACTGGGTGGAGGG + Intronic
902715543 1:18270207-18270229 TTGGAGAGTGAGTGGATGGCAGG - Intronic
903014119 1:20350791-20350813 TTGGTCAGTGAGCAGTTGGACGG + Intronic
904698091 1:32341758-32341780 TTGGTCACTGTCTGGATGGCAGG - Intergenic
905512186 1:38530311-38530333 TTGGTCAGTGCCTGCCTGCCTGG + Intergenic
905793196 1:40801153-40801175 GTGGTCAGTGAGAGGCTGGCTGG + Intronic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
906108095 1:43306635-43306657 TTGGTGATTTACTGGGTGGCTGG + Intronic
907337463 1:53709800-53709822 CTGCTCAGTGACTGGGTGGGTGG + Intronic
912264130 1:108138281-108138303 TTAGTTACTGACTGCTTGGCTGG + Intronic
913004876 1:114619514-114619536 TTGGGGGGTGAGTGGTTGGCAGG - Intronic
913277435 1:117152835-117152857 TTTCTCATTGACTGGTTGTCTGG - Intronic
915113202 1:153577885-153577907 GTGCTCAGTGGCTGCTTGGCTGG - Intergenic
915562713 1:156696738-156696760 TTGGTCACTGAGTGGCTGGCGGG - Intergenic
917589748 1:176463839-176463861 ATGTTCAGTGTCTGCTTGGCTGG + Intronic
918453926 1:184687704-184687726 TTGGTAGCTGGCTGGTTGGCAGG + Intergenic
920357500 1:205385590-205385612 TTGGACAGGGACGGTTTGGCAGG - Intronic
920404354 1:205697764-205697786 TAGTTCAGTTACTGCTTGGCTGG - Intergenic
921825597 1:219668605-219668627 TTGTTGAGTGATTGGCTGGCTGG - Intergenic
922210593 1:223483642-223483664 TGGGTCAGTGCCTGCTAGGCGGG - Intergenic
922321926 1:224496120-224496142 TTGTTCAGTAACTGCTGGGCTGG - Intronic
923799859 1:237197946-237197968 TTGGTCAATCATAGGTTGGCAGG + Intronic
1063378456 10:5569086-5569108 TTGGTGCTTGACTGGTTGGTTGG + Intergenic
1063378484 10:5569221-5569243 TAGGTGAGTGCTTGGTTGGCTGG + Intergenic
1065373970 10:25017468-25017490 TTTCTCACTGCCTGGTTGGCTGG + Intronic
1065564203 10:26992773-26992795 TTGGTAATTGACTGGTTGAGTGG - Intronic
1067268652 10:44770445-44770467 TGGGTCACTCACTGGTTGGTTGG - Intergenic
1069735591 10:70652040-70652062 GGAGTCAGTGACTGGGTGGCAGG - Intergenic
1069824456 10:71246552-71246574 TTGGTGAGTGACTGGGTTGAGGG + Intronic
1072783917 10:98267963-98267985 TTGGTGAGCGACTGGAGGGCCGG + Intronic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1079081048 11:17413993-17414015 TTGGTCACTTACTGGCTGGGTGG + Intronic
1079211617 11:18465917-18465939 TTGCTCAGTACCTGGGTGGCAGG - Intronic
1084536821 11:69762291-69762313 TGGGTCACTGACTGGATGGCTGG + Intergenic
1085464314 11:76713634-76713656 TTGGTCAGTGGGTGGATGGGTGG + Intergenic
1085608305 11:77922842-77922864 TTTTCCAGTGACTGGTTTGCTGG + Intronic
1086872830 11:92059977-92059999 TTGTTCAGTATCTGGTTTGCTGG + Intergenic
1087247200 11:95853257-95853279 TTGGTCACTGACTGGATGTAAGG - Intronic
1088291911 11:108247970-108247992 TTGATTAGTGGCTGGTTGCCAGG - Intronic
1088526723 11:110763743-110763765 TTGGCCAGTGACTGGCTGCCAGG - Intergenic
1088615621 11:111624802-111624824 GTGGTCAGAGGCTGGTTGGTTGG + Intronic
1088858648 11:113779732-113779754 TGGGTCAGTGACTGGTTAGCAGG - Exonic
1095188042 12:39224694-39224716 CAGGTCAGGGACTGTTTGGCTGG + Intergenic
1100619154 12:96255157-96255179 TTGGTGACTGACTGGGTGGGAGG + Intronic
1104979957 12:132569346-132569368 TTGGGCAGGGACTGGGTGGGAGG - Intronic
1105050799 12:133048938-133048960 CTGGTCAGTGATGGGTTGGCTGG + Intronic
1105050804 12:133048957-133048979 CTGGTCAGTGACGGGTGGGCTGG + Intronic
1105050808 12:133048976-133048998 CTGGTCATTGATGGGTTGGCTGG + Intronic
1105916339 13:24920448-24920470 TTGGTTATTAAATGGTTGGCAGG - Intronic
1106541859 13:30697525-30697547 TTGGGCATTGACAGGTTTGCAGG - Intergenic
1107089179 13:36457994-36458016 TTGGTCATTGACTGGAATGCTGG + Intergenic
1107716822 13:43208314-43208336 AAGGTCAGTGACTGTTGGGCCGG + Intergenic
1109300905 13:60589183-60589205 TGAGTCAGTTCCTGGTTGGCAGG - Intergenic
1110377267 13:74807307-74807329 TTGGGCAATGACAGGGTGGCTGG - Intergenic
1110725452 13:78817300-78817322 CTAGTAAGTGGCTGGTTGGCTGG + Intergenic
1110834037 13:80063834-80063856 TTGGGCAATGACGGGTTGGCTGG + Intergenic
1111473926 13:88722879-88722901 GTGGTCTGTCACTGGTAGGCAGG - Intergenic
1112249823 13:97769484-97769506 GTGGTCAATGACAGGGTGGCTGG + Intergenic
1112850583 13:103701203-103701225 TTGGTGAATGAATGGATGGCTGG - Intergenic
1113928651 13:113954724-113954746 TTGCTCAGTGGCTTGTTGGGTGG - Intergenic
1119041234 14:71276564-71276586 CTCCTCAGTGACTGGTTGGTTGG - Intergenic
1119540748 14:75436637-75436659 GTGGTCAGTAACTGGATGGATGG + Intronic
1122789672 14:104178961-104178983 TTGGGCAGTGGGTGGGTGGCTGG + Intronic
1125062187 15:35437741-35437763 TTTGCCACTGACTGGTTTGCTGG - Intronic
1130575075 15:85084876-85084898 TTGGTCAGTGACTGGATTTAGGG - Intronic
1133231475 16:4369082-4369104 TGAGTCAGTGGCTGGCTGGCTGG - Intronic
1133290699 16:4718751-4718773 TTGGTTAGTGACTGCTTTGGGGG - Intronic
1133291280 16:4723065-4723087 TTTGTCTATGACTGGTGGGCAGG + Intronic
1135221149 16:20614911-20614933 TTGCTAAGAGACTGGCTGGCAGG + Intronic
1135493496 16:22931164-22931186 TTGGTCATTTCCTGGTTGGGTGG + Intergenic
1138600228 16:58049657-58049679 ATGGTCAGTGTCTGGGTGCCTGG - Intergenic
1142134588 16:88445837-88445859 TGGCTCCGTGACTGCTTGGCCGG - Intergenic
1142741672 17:1935160-1935182 TTGGTCAGTGACGGCCTGGACGG - Exonic
1144194581 17:12877846-12877868 TTGTTCAGTGACTTCTTGGATGG + Intronic
1144720513 17:17466395-17466417 TTGGCCAGTGACTGGTCTACAGG - Intergenic
1146173942 17:30652959-30652981 TTGTTGAGTGAATGGATGGCAGG + Intergenic
1146313612 17:31790024-31790046 TTGGTCAGAGACTGGTAAGGTGG - Intergenic
1146347398 17:32068981-32069003 TTGTTGAGTGAATGGATGGCAGG + Intergenic
1146484231 17:33230398-33230420 ATGGTCTCTGACTGGTGGGCAGG - Intronic
1147918272 17:43901205-43901227 TTGGTCAGCCACTGGGAGGCAGG + Intronic
1148434659 17:47673694-47673716 TTGGTCTGTGATTGGTTGATTGG + Intronic
1150622848 17:66821523-66821545 TCGGTCACTGACAAGTTGGCTGG + Intergenic
1152869997 17:82748572-82748594 TTGGTAAATGACAGATTGGCAGG - Intronic
1154072359 18:11164144-11164166 ATGGTCAGTGTCTCGTGGGCTGG - Intergenic
1155992464 18:32293200-32293222 TTGGGCAGTGTCTGGTTGCTTGG - Intronic
1156201918 18:34842901-34842923 TTGGTTGGTGGCTGGTTGGTTGG + Intronic
1160025283 18:75211188-75211210 TTGATCTGTGACTGTTTGGAAGG + Exonic
1162453241 19:10767112-10767134 TGGCTCAGTGGCTTGTTGGCTGG + Intronic
1162988471 19:14287077-14287099 TTGTTGAGTGAATGGATGGCAGG - Intergenic
1164096991 19:22020559-22020581 TTGGGCAATGACGGGGTGGCTGG + Intergenic
1164414593 19:28036007-28036029 GGGGTCAGGGACTGGTGGGCAGG + Intergenic
1167331966 19:48861600-48861622 AGGGTCAGTGGCTGGCTGGCTGG - Exonic
1168397946 19:56064950-56064972 TTGCTGAGTGACTGTTTTGCTGG - Intergenic
1202639537 1_KI270706v1_random:69665-69687 TTGGTCAGTAACTGGCCTGCTGG - Intergenic
927935731 2:27075284-27075306 TTGGGCAGTGACAAGATGGCTGG + Intergenic
927956283 2:27209755-27209777 TTGGGCAGACACTGGCTGGCTGG + Intronic
929343311 2:40849742-40849764 TTTCTCAGTCACTGGTTTGCTGG + Intergenic
931070070 2:58636907-58636929 TAGGTCAGGGACTGGGTTGCAGG + Intergenic
932188629 2:69719980-69720002 TTGATCATTTACTGGTTGCCTGG - Intronic
932635466 2:73384606-73384628 TGGGTCATTGACAGGTAGGCAGG + Intergenic
933199360 2:79431543-79431565 TTGGTCAGTGAAATGTGGGCAGG - Intronic
934884752 2:98014576-98014598 TGGGCTAGTGACTGGTGGGCTGG - Intergenic
935304526 2:101724183-101724205 TTGCACACTGATTGGTTGGCTGG - Intronic
935515121 2:104026847-104026869 GTGGTCAGTGACTGGTGGCGGGG - Intergenic
936527718 2:113253057-113253079 ATGGACAGTGAGTGGTTGGAGGG + Intronic
939865471 2:147467664-147467686 TTAGTCAGTGAGTGGTTGAGTGG - Intergenic
940693553 2:156950637-156950659 ATGGTCAGTGACTGGGTGATGGG - Intergenic
948509113 2:238451284-238451306 TTGCTCAGTGCCTGGATTGCAGG + Exonic
948659254 2:239497129-239497151 TGGGGCAGTCACTGATTGGCTGG - Intergenic
1170853419 20:20024737-20024759 TATGTCAGTGGCTGGCTGGCAGG + Intronic
1171254819 20:23681811-23681833 TTTCTCAGTGACTGCTTGTCTGG + Intergenic
1173410775 20:42807796-42807818 TTGCTCAGTGAATGTTTAGCGGG - Intronic
1174195012 20:48766811-48766833 TTGGTGAGTGAGTGGATGGACGG + Intronic
1174740004 20:53003597-53003619 ATGGTCAATCACTAGTTGGCAGG + Intronic
1174816541 20:53692033-53692055 CTGGTCTGTGAATGGTTGGAGGG + Intergenic
1178500721 21:33123691-33123713 TTTGTCAGTGGCTGGGTGGAGGG - Intergenic
1181855647 22:25779890-25779912 TTGGGCAGGGAGTGGGTGGCAGG + Intronic
1183064297 22:35352860-35352882 TGGGTCAGAGTCAGGTTGGCAGG + Intergenic
1183254924 22:36756182-36756204 TTTGTCAGTACCTGGCTGGCTGG + Intergenic
1184109754 22:42387802-42387824 GTGGTCAGAGAGTGGGTGGCAGG - Intronic
1184321984 22:43748998-43749020 TTTGTCAGTGACTCCTTAGCTGG - Intronic
1184493791 22:44825756-44825778 CTGCTCAGTGCCTGGTTGGGGGG + Intronic
1184979266 22:48084596-48084618 TTGGAGAGCGACTGGTTGGCTGG + Intergenic
951780421 3:26356824-26356846 GTGGTCAGTCACTGGCTGGAAGG + Intergenic
952255914 3:31695556-31695578 TTGGTTAGTGCCTGGATGGAGGG - Intronic
954127571 3:48540468-48540490 TGGGTCAGTGCCTGGCTGGATGG - Intronic
955348771 3:58179398-58179420 TTGGACAGTGTCTGGCTGGGAGG - Intergenic
956074649 3:65491757-65491779 TTGGGATGTGACTGGGTGGCTGG - Intronic
958659511 3:97048270-97048292 TTGGGCAGTGGCTTGTTGGAAGG + Intronic
962139215 3:132771140-132771162 CAGATCAGTGACTGGTTGCCTGG + Intergenic
963757741 3:149253450-149253472 TTGGTGGGTGGCTGGTTGGTTGG - Intergenic
964747629 3:160026927-160026949 TTGGTCAGTGACTGGCTTACAGG - Intronic
967884105 3:194321807-194321829 TTGGGAAGTGACTGGTAGCCTGG + Intergenic
969630699 4:8334246-8334268 TTGGGCAGTGACTGGCTAGAAGG + Intergenic
971817329 4:31505865-31505887 TTGGGCTGTGACAGGGTGGCTGG - Intergenic
972396006 4:38660492-38660514 TTTGCCAGTGACTGGTTGGAGGG - Intergenic
972922465 4:43960641-43960663 TTGGTCAGTGAGTAGGTGGGGGG + Intergenic
974209953 4:58758971-58758993 TTGGTGAGTGACTGCTTTCCAGG - Intergenic
975386616 4:73766720-73766742 TTGGGCAATGACAGGGTGGCTGG + Intergenic
982223110 4:153141461-153141483 GTGGTCTGTCACTGGCTGGCTGG - Intergenic
985758041 5:1730806-1730828 TTGCTCAGTGACTGGCAGGATGG + Intergenic
985837208 5:2280299-2280321 TGGGTGAGTGAGTGGTTGGGTGG + Intergenic
986009163 5:3696600-3696622 TAGGTCAGTGATTGCTTGGCTGG - Intergenic
987964647 5:24855748-24855770 TAGGCCAGTGAGTGGGTGGCGGG - Intergenic
995908710 5:117159352-117159374 TTGGTCTCTGGCTGGTTAGCTGG - Intergenic
999451162 5:151679338-151679360 TGAGTGAGTGACTGGGTGGCAGG + Intronic
1003564649 6:7213006-7213028 TTGGGCACAGACTGGTTGTCAGG + Intronic
1003833721 6:10043846-10043868 ATGGTAAGTGCCTGGTAGGCGGG - Intronic
1006839799 6:37021513-37021535 TTGGTCAATGGCTGCTTGGAAGG - Exonic
1007041689 6:38727849-38727871 TTTTCCAGTGACTGGGTGGCAGG + Intronic
1013033630 6:106360384-106360406 TTGGCCTGTGACAGGCTGGCAGG - Intergenic
1015931141 6:138360907-138360929 TTGGTCAGGGACTGTTTTGTAGG + Intergenic
1021645037 7:22781707-22781729 TTGGCCAGTGCCTGGATGGAAGG - Intergenic
1024866202 7:53907138-53907160 TTGGGCAATGACGGGGTGGCTGG - Intergenic
1024942595 7:54777862-54777884 CGGGTCAGTGTCTGGTTGCCAGG - Intergenic
1025844594 7:65184997-65185019 TTTTCCAGTGACTGGTTTGCTGG - Intergenic
1025894922 7:65691335-65691357 TTTTCCAGTGACTGGTTTGCTGG - Intergenic
1030082732 7:105791367-105791389 TTAGTCAGGGCCTGGTAGGCAGG + Intronic
1030109128 7:106011513-106011535 GTGGTCACTGACAGCTTGGCTGG - Intronic
1031922543 7:127612544-127612566 TGGGTGGGTGACTGGCTGGCTGG + Intronic
1032590347 7:133186563-133186585 TTAGCCATTGACTGGTTGTCTGG - Intergenic
1038124777 8:24660695-24660717 TTTATCAGTGACTAGTTTGCTGG - Intergenic
1041167997 8:55110319-55110341 TTGGTAAGTGACAGCATGGCTGG + Intronic
1041172757 8:55161684-55161706 TTGCTCAGTGACCAGTAGGCAGG - Intronic
1045929452 8:107605228-107605250 GTGGTCAATGACTGCATGGCAGG - Intergenic
1046422781 8:114006464-114006486 CTGGTCAGTGACTATTGGGCAGG + Intergenic
1049008413 8:139872193-139872215 TTGGTGAGTAAATGGTTGGATGG + Intronic
1049236563 8:141515162-141515184 TGGGTGAGTGAATGGATGGCTGG - Intronic
1051243989 9:15090762-15090784 TTGGGCAGTGACTTGGTTGCTGG - Intergenic
1052944724 9:34159118-34159140 GTGGTGAGTGACTGGTTGGTTGG - Intergenic
1052993832 9:34539027-34539049 TTGATGAGTGAGTGGTTGGGAGG - Intergenic
1055056616 9:72029981-72030003 TGGGTGAGTGGTTGGTTGGCTGG - Intergenic
1056430878 9:86526705-86526727 TTGGACAGTGACTTGAGGGCTGG + Intergenic
1058177927 9:101759793-101759815 TGGGTCAGTGACTGTTAGGGAGG - Intergenic
1060684326 9:125594525-125594547 TTGATCAGTGACTTTGTGGCAGG - Intronic
1062649741 9:137569438-137569460 TGGGTGAGTGACTGGCTGGCTGG - Intronic
1062649785 9:137569599-137569621 TGGGTGAGTGGCTGGCTGGCTGG - Intronic
1187228582 X:17398623-17398645 GTGATGAGTTACTGGTTGGCTGG + Intronic
1191965463 X:66752580-66752602 TAGCTCAGGGACTGGTTTGCTGG + Intergenic
1199981360 X:152922302-152922324 TTCCTCAGTGACTGAGTGGCAGG - Intronic
1201386002 Y:13440043-13440065 TTGGTCGGGGTCTGGCTGGCTGG - Intronic
1201404944 Y:13640564-13640586 TTGGTTAGTGGTTGGTTGACTGG - Intergenic