ID: 901180497

View in Genome Browser
Species Human (GRCh38)
Location 1:7338214-7338236
Sequence CCCGTTAGGTCCCAGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901180488_901180497 10 Left 901180488 1:7338181-7338203 CCCTCCTGCTTTGGTACTCACCC 0: 1
1: 0
2: 0
3: 9
4: 170
Right 901180497 1:7338214-7338236 CCCGTTAGGTCCCAGAAAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 101
901180489_901180497 9 Left 901180489 1:7338182-7338204 CCTCCTGCTTTGGTACTCACCCA 0: 1
1: 0
2: 0
3: 7
4: 136
Right 901180497 1:7338214-7338236 CCCGTTAGGTCCCAGAAAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 101
901180492_901180497 -10 Left 901180492 1:7338201-7338223 CCCAGCACCCAGTCCCGTTAGGT 0: 1
1: 0
2: 0
3: 8
4: 63
Right 901180497 1:7338214-7338236 CCCGTTAGGTCCCAGAAAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 101
901180490_901180497 6 Left 901180490 1:7338185-7338207 CCTGCTTTGGTACTCACCCAGCA 0: 1
1: 0
2: 0
3: 14
4: 113
Right 901180497 1:7338214-7338236 CCCGTTAGGTCCCAGAAAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 101
901180486_901180497 19 Left 901180486 1:7338172-7338194 CCTCAGTCTCCCTCCTGCTTTGG 0: 1
1: 0
2: 6
3: 70
4: 661
Right 901180497 1:7338214-7338236 CCCGTTAGGTCCCAGAAAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901180497 Original CRISPR CCCGTTAGGTCCCAGAAAGA AGG Intronic
901180497 1:7338214-7338236 CCCGTTAGGTCCCAGAAAGAAGG + Intronic
902039381 1:13481829-13481851 CATGTGAGGACCCAGAAAGAAGG + Intronic
902502673 1:16921553-16921575 CCCGTTCTGGGCCAGAAAGATGG + Intronic
915585873 1:156843650-156843672 CCTGTTAGATCCCAGGAATAGGG - Intronic
917386140 1:174477026-174477048 ACCCTTAGGTCTAAGAAAGAGGG - Intronic
917991579 1:180385674-180385696 CCCGTGAGGACCCAGCAAGATGG + Intronic
921373011 1:214444932-214444954 CTGTTTAGGTACCAGAAAGAGGG - Intronic
1063315391 10:4999499-4999521 TCCATTAGGAACCAGAAAGATGG - Intronic
1072058268 10:91782595-91782617 CTAGTTAGGGCTCAGAAAGAAGG - Intergenic
1072082086 10:92042820-92042842 CACGTTATGACACAGAAAGAAGG + Intergenic
1072925375 10:99612392-99612414 CTCGTTAGGTACCAAAAACATGG + Intronic
1081766593 11:45615597-45615619 CCTGTAAGGTGCCAGACAGAAGG - Intergenic
1084710670 11:70841974-70841996 GCAGTTAGGTCCCAGGAATAAGG - Intronic
1087875462 11:103350721-103350743 CATGTGAGGACCCAGAAAGAAGG - Intronic
1088715999 11:112550414-112550436 CCTGTTATATCCCAGAAAGGAGG - Intergenic
1094036221 12:26074836-26074858 CCCGGGAGGTCCAAGAGAGATGG + Intronic
1096774683 12:53956741-53956763 CCTGCCAGGTCCCAGAGAGAAGG + Exonic
1101473199 12:105018703-105018725 CCCCTGAAGCCCCAGAAAGAGGG + Intronic
1102872860 12:116427529-116427551 CTCGTTAGTCCCCAGAGAGATGG + Intergenic
1107451580 13:40515030-40515052 CCAGTTAGGCCACAGCAAGAGGG - Intergenic
1117516766 14:56509738-56509760 CTCGTGAGGTCACAGCAAGAAGG - Intronic
1117876883 14:60261637-60261659 CCCGTCAGGTCCAAGTAGGAGGG + Intronic
1118758695 14:68864392-68864414 CCAGGTAGGTCCCAGAGAGTGGG + Intergenic
1118976852 14:70685231-70685253 CTCTTTAGGACCCAGAAAAAGGG + Intergenic
1123767801 15:23499180-23499202 CCCATTAGGCCCCAGGAAGCTGG - Intergenic
1125347643 15:38734251-38734273 CACGTGAGGACACAGAAAGAAGG - Intergenic
1126154830 15:45556177-45556199 CCTCTTGGGTCCCAGGAAGAGGG + Intergenic
1128742871 15:70095940-70095962 CCCGTGGGGTCCCCGAATGAGGG - Intronic
1131524352 15:93140677-93140699 CTCTTTAGGTCCCAGACACAAGG - Intergenic
1132980516 16:2736697-2736719 CCCGGGAGGGCCCAGCAAGAAGG + Intergenic
1133094281 16:3430769-3430791 CCTGTGAGGACCCAGCAAGAAGG - Intronic
1140966692 16:79973223-79973245 CCTGTTAGGACACAGCAAGAAGG + Intergenic
1142549506 17:729749-729771 ACTGTTAGGTCCTAGAAACAAGG - Intergenic
1143145383 17:4771999-4772021 CCCATTAGGTACCAGCAGGAGGG - Exonic
1146266330 17:31455412-31455434 CCCCTTAGGTGCCTGAAAGTAGG - Intronic
1146402079 17:32507816-32507838 CACGTGAGGACTCAGAAAGAAGG + Intronic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1149217714 17:54377211-54377233 TCCATTAGGTACCAGAAACACGG - Intergenic
1152391799 17:80007917-80007939 CCCGGTGGGTCCCAGGCAGAGGG + Intronic
1160245278 18:77153681-77153703 CCATTTAGGTACCAGAAAGCAGG + Intergenic
1161486172 19:4537025-4537047 CCAGTTAGGTCCCAGGATGGGGG + Exonic
1166201843 19:41242816-41242838 CCCTTTGGGTCCCAGAGAGCTGG + Intronic
932483314 2:72063322-72063344 CCCTTTGGATCCCAGAAAGAAGG + Intergenic
933727135 2:85433417-85433439 CAAGCTAGCTCCCAGAAAGAGGG + Intronic
937349991 2:121154684-121154706 CCTCTGAGGTCCCAGAGAGAGGG - Intergenic
937934364 2:127230747-127230769 CCTGTGAGGACACAGAAAGAAGG + Intergenic
939126949 2:138188871-138188893 CCAGTTAGTTCCCAGAGAGTTGG + Intergenic
939288576 2:140164313-140164335 ACAGTTAGGCCCCAGAAAAAAGG - Intergenic
944387470 2:199181709-199181731 CCAGTGGGGTCCCACAAAGATGG - Intergenic
945916358 2:215708515-215708537 CGTGTGAGGTCCCAGCAAGAAGG - Intergenic
946947072 2:224832022-224832044 ACCCTTAGGCCCAAGAAAGAAGG - Intronic
1171369725 20:24653817-24653839 CCCGTGAAGTCGCAGCAAGAAGG - Intronic
1178546326 21:33495847-33495869 CCTGTGAGGACACAGAAAGAAGG + Intergenic
1180154715 21:45972370-45972392 CCGGCTGGGTCCCAGAGAGACGG - Intergenic
1184469169 22:44685845-44685867 CCAGATAGTGCCCAGAAAGATGG + Intronic
1184615898 22:45638488-45638510 CCTTTTAGCTCCCAGAGAGATGG + Intergenic
950853808 3:16087072-16087094 CACCTTAGGTGCCAGAATGAAGG + Intergenic
951054047 3:18126854-18126876 ACCATTAGGCCCCAGAAAGGTGG - Intronic
957986918 3:87583951-87583973 CATGTGAGGTCCCAGCAAGAAGG - Intergenic
958499824 3:94890842-94890864 CCAGTGGGGCCCCAGAAAGATGG + Intergenic
961492366 3:127264699-127264721 CCAGTTAGGCTCCAGAAAGGAGG + Intergenic
970410978 4:15807606-15807628 CATGTGAGGTCCCAGAAGGAAGG + Intronic
975923780 4:79424414-79424436 CCAGTTAGGAACCAGAAAGTGGG - Intergenic
976546170 4:86338119-86338141 TCGGTTAGGACACAGAAAGAAGG - Intronic
977792093 4:101118015-101118037 CCCTCTAGGACCCTGAAAGATGG + Intronic
981161388 4:141503241-141503263 CATGTGAGGGCCCAGAAAGAAGG + Intergenic
982318829 4:154058620-154058642 CCAGTGGGGTCCCACAAAGATGG - Intergenic
993755228 5:91720991-91721013 CACACTAGGTCCCTGAAAGAGGG - Intergenic
993845830 5:92942114-92942136 CTCGTTAGGTCCCTGATAAAAGG + Intergenic
994103084 5:95915566-95915588 CCCATTAGTTCCTTGAAAGAGGG - Intronic
1002800160 6:514814-514836 CCCGTGATGTCCCAGGAGGAGGG + Intronic
1003422124 6:5968026-5968048 CCACTGAGGTCCCAGCAAGAAGG - Intergenic
1007828520 6:44620128-44620150 CCCTATAGGTCCCTGAAAAATGG + Intergenic
1010145822 6:72668722-72668744 CACATGAGCTCCCAGAAAGAGGG - Intronic
1011388697 6:86826492-86826514 TCAGTTAGGGCCCAGAGAGATGG - Intergenic
1014296410 6:119623827-119623849 TCCTTTAGGTCACAGAAACAGGG - Intergenic
1014634139 6:123824194-123824216 CCCCTGAGGTTCCAGACAGACGG + Intronic
1015573458 6:134646041-134646063 ACCCTCAGGTCCCAGAAAGGAGG - Intergenic
1016764035 6:147772641-147772663 CCCGTGAGGACCCAGAGAGAAGG - Intergenic
1018494442 6:164335351-164335373 CCTGTGAGGACACAGAAAGAAGG + Intergenic
1018979659 6:168592763-168592785 CCCGTGAGGCCTCAGGAAGAAGG - Intronic
1018979710 6:168593018-168593040 CCCGTGAGGCCTCAGGAAGAAGG - Intronic
1022633207 7:32105570-32105592 CCCGTTAGCTCCCAGAATGTTGG + Intronic
1024886574 7:54148947-54148969 CACGGAAGGTCACAGAAAGATGG - Intergenic
1027701843 7:81479197-81479219 CCCAGTAGCTTCCAGAAAGAAGG + Intergenic
1029457913 7:100680213-100680235 CCCATCTAGTCCCAGAAAGATGG - Exonic
1032044443 7:128592667-128592689 CCCGGTAGGGCCCAGAAACCAGG - Intergenic
1032400192 7:131619371-131619393 CCTGTATGGTACCAGAAAGATGG - Intergenic
1033046494 7:137967117-137967139 CCTGTGAGGACACAGAAAGAAGG + Intronic
1035289033 7:157825366-157825388 CCTCTGAGGTCCCAGAAACAAGG - Intronic
1035993271 8:4516222-4516244 CACGTGAGGACCCAGAGAGAAGG + Intronic
1036185995 8:6622704-6622726 CACGTGAGGTCACAGGAAGAAGG - Intronic
1038029990 8:23629435-23629457 CCCTTTAGGAGCCAGAAAAAGGG - Intergenic
1045547838 8:103143642-103143664 TCACTAAGGTCCCAGAAAGAAGG - Intronic
1046458555 8:114503748-114503770 CATGTTAAGTCTCAGAAAGAAGG - Intergenic
1046999121 8:120555873-120555895 CACGTGAGGACACAGAAAGAGGG + Intronic
1047597917 8:126397039-126397061 CACGTGAGGACACAGAAAGAAGG + Intergenic
1050258084 9:3814522-3814544 CCAGTGGGGTCCCACAAAGATGG + Intergenic
1050318346 9:4425912-4425934 CCAGGAAGGCCCCAGAAAGATGG + Intergenic
1050406617 9:5314915-5314937 AAGGTTAGGACCCAGAAAGAAGG - Intergenic
1053398634 9:37798899-37798921 CCCTTGAGGTACCAGAATGATGG - Intronic
1053434636 9:38067155-38067177 CCCATAAGGTCCCAGGAACACGG - Intronic
1053833183 9:42105931-42105953 CTTGTTAAGTCACAGAAAGAAGG + Intronic
1054597368 9:67081477-67081499 CTTGTTAAGTCACAGAAAGAAGG - Intergenic
1062368787 9:136225821-136225843 CCCATTAAGTAACAGAAAGAGGG + Intronic
1198455684 X:136815537-136815559 CACGTTATGTCACAGCAAGAAGG - Intergenic