ID: 901183937

View in Genome Browser
Species Human (GRCh38)
Location 1:7360101-7360123
Sequence ACTTATAAAAAGGTGGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 374}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901183937_901183943 -8 Left 901183937 1:7360101-7360123 CCAACCCCCACCTTTTTATAAGT 0: 1
1: 0
2: 2
3: 47
4: 374
Right 901183943 1:7360116-7360138 TTATAAGTAATCAGTCATATTGG 0: 1
1: 0
2: 9
3: 49
4: 289
901183937_901183944 11 Left 901183937 1:7360101-7360123 CCAACCCCCACCTTTTTATAAGT 0: 1
1: 0
2: 2
3: 47
4: 374
Right 901183944 1:7360135-7360157 TTGGATTAGTGTCCACCCTAAGG 0: 1
1: 4
2: 15
3: 49
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901183937 Original CRISPR ACTTATAAAAAGGTGGGGGT TGG (reversed) Intronic
901183937 1:7360101-7360123 ACTTATAAAAAGGTGGGGGTTGG - Intronic
902052380 1:13574413-13574435 ACATATAAAAAGGGCGGGGAGGG - Intergenic
903080337 1:20805936-20805958 ATTTTTATAAAAGTGGGGGTGGG - Intergenic
903080343 1:20805959-20805981 GCTTTTACAAAAGTGGGGGTGGG - Intergenic
903763149 1:25713227-25713249 TCTCATAATGAGGTGGGGGTGGG + Intronic
903835441 1:26200625-26200647 ATTTTTAAAGAGGTGGGGGGAGG + Intronic
906745814 1:48221487-48221509 ACTTATAAGATGCTGGGGATAGG + Intergenic
907119221 1:51993815-51993837 AAAAAAAAAAAGGTGGGGGTGGG + Intergenic
907237644 1:53062758-53062780 ATCTATAAAGAGGTGGAGGTTGG - Intronic
907294819 1:53443828-53443850 AAAAAAAAAAAGGTGGGGGTGGG - Intergenic
908136228 1:61135918-61135940 ACTTAAAAAAAGCTGGGGTAGGG - Intronic
908491311 1:64646726-64646748 TCTCAAAAAAAGGTGGGGGGTGG + Intronic
908692381 1:66797066-66797088 ACTTTTTAAGAGGTGTGGGTAGG - Intergenic
909813648 1:79962727-79962749 AGTAATAAAAAGATGGAGGTAGG + Intergenic
911344640 1:96681654-96681676 ACAGATACAAAGGTGGGGTTAGG - Intergenic
912044772 1:105440567-105440589 ACTTATAAAAAGCTGGGAGCTGG + Intergenic
912918505 1:113842206-113842228 ACTAAAAAAAAAGTAGGGGTGGG + Intronic
913590494 1:120320153-120320175 ACATATAAACTGGTGGGGGAGGG - Intergenic
913617690 1:120578210-120578232 ACATATAAACTGGTGGGGGAGGG + Intergenic
914572582 1:148932762-148932784 ACATATAAACTGGTGGGGGAGGG - Intronic
914600258 1:149197500-149197522 ACATATAAACTGGTGGGGGAGGG + Intergenic
914880040 1:151540121-151540143 ATTTACACAAAGGTGGGGCTTGG - Intergenic
915892583 1:159785193-159785215 ACGTAAAAAAAAATGGGGGTGGG - Intergenic
916826138 1:168443726-168443748 ATTATTAAGAAGGTGGGGGTGGG + Intergenic
917691647 1:177476134-177476156 ACTGATGAAAAGGTGAGGGAGGG - Intergenic
918226559 1:182488806-182488828 GATTAGAAAAGGGTGGGGGTTGG + Intronic
919651269 1:200151072-200151094 AATTCTAGAAAGGTGGGGCTGGG + Intronic
921723161 1:218495731-218495753 CCTTTTAAAAAGGTGGGGTGGGG + Intergenic
923672070 1:236049517-236049539 ATTTCTTAAAAGGTGGGGGCTGG - Intronic
924322681 1:242865460-242865482 CCTTATAAAAAGGAGAGAGTAGG + Intergenic
924518289 1:244784028-244784050 AGTTATAGGAAGGTGGGTGTGGG + Intergenic
1063361540 10:5463260-5463282 GCTTAGAGGAAGGTGGGGGTGGG - Intergenic
1063696815 10:8343715-8343737 ACCTTGCAAAAGGTGGGGGTCGG + Intergenic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1064589048 10:16869538-16869560 AATCATAATCAGGTGGGGGTGGG + Intronic
1066520647 10:36214435-36214457 ACTCACATAAAGGTGGGGGTGGG - Intergenic
1068128330 10:52867997-52868019 ACTTATTAACAGGTAGAGGTTGG + Intergenic
1068799240 10:61120680-61120702 AGTTATAATAAGGTAGGGGTGGG + Intergenic
1068837829 10:61573627-61573649 AATAATGAAAAGGTGGGGGGAGG + Intergenic
1069419368 10:68232352-68232374 AAGAATAACAAGGTGGGGGTTGG + Intergenic
1069445228 10:68467053-68467075 ATATATAAAAAGCTGGGTGTTGG + Intronic
1069512188 10:69050786-69050808 TCTTAAAAAAAACTGGGGGTGGG + Intergenic
1070383789 10:75905607-75905629 ACTCAAAAAAGGCTGGGGGTGGG - Intronic
1071087259 10:81877228-81877250 AATAAGAACAAGGTGGGGGTTGG - Intronic
1072828355 10:98631482-98631504 ACTTGTAAGTAGGTAGGGGTTGG - Intronic
1073230314 10:101963793-101963815 ACTTAAAATAAGGTGGTAGTAGG + Intronic
1073644404 10:105284819-105284841 ACTTATGACAAGGTGGGGGAAGG + Intergenic
1074120032 10:110487400-110487422 AATGGTAAAAAGGTGGGGGCGGG - Intergenic
1075245869 10:120821794-120821816 CCTTATAAAAAGGTGAGATTTGG + Intergenic
1075251997 10:120887531-120887553 ACCTATAAAATTATGGGGGTTGG - Intronic
1075714904 10:124550481-124550503 ACTTCTGAAAACGTGTGGGTGGG + Intronic
1078790179 11:14534453-14534475 AATTTTAAAAAGGTGGGAGTGGG - Intronic
1079007168 11:16800228-16800250 ACTTAAAAAATTGTGAGGGTGGG + Intronic
1079458383 11:20657201-20657223 GATTAAAAGAAGGTGGGGGTGGG + Exonic
1079775574 11:24521358-24521380 AAAAAAAAAAAGGTGGGGGTGGG + Intronic
1081236307 11:40651335-40651357 AATTAAAAAGAGATGGGGGTGGG + Intronic
1081480347 11:43481044-43481066 ACTAATAAAAAGGAGGTAGTAGG + Intronic
1082704449 11:56476598-56476620 ACTTACAATAGAGTGGGGGTAGG - Intergenic
1083571916 11:63765647-63765669 TATTATACAAAGGTGGGGGAAGG - Intronic
1085677732 11:78540564-78540586 ACTGGGTAAAAGGTGGGGGTAGG - Intronic
1086731484 11:90256144-90256166 ACTTATAGGAAGGTAGAGGTAGG + Intergenic
1088003126 11:104906788-104906810 ATTTTTAAAAACGTGGGTGTGGG + Intergenic
1088092881 11:106064052-106064074 ACTTATAAAATGGTGGAGGAAGG + Intronic
1089226297 11:116925257-116925279 AAACAAAAAAAGGTGGGGGTGGG + Intronic
1089910981 11:122100647-122100669 AATTAAAAAAAGGCGGGGGGGGG + Intergenic
1090582839 11:128178809-128178831 ACATATAAAAATGTGAGTGTGGG - Intergenic
1090815394 11:130289597-130289619 AAAAAAAAAAAGGTGGGGGTGGG + Intronic
1091390590 12:123854-123876 ATTTATAAAAATGGGGAGGTTGG + Intronic
1092591593 12:9957191-9957213 AATTTTAAAAAGGTGTGGGTAGG + Intronic
1092824369 12:12384693-12384715 TCTTTTAAAAAGGAGGGTGTGGG - Intronic
1094187790 12:27663542-27663564 AATTAGAAAAAGGTTGGGGCCGG + Intronic
1095391261 12:41709436-41709458 ACTAATATGAAGGTGGGGGGAGG - Intergenic
1095947176 12:47759798-47759820 AGTCCTAAAAAGCTGGGGGTGGG - Intronic
1096304503 12:50462554-50462576 AATAAGAAAAAGGTGGGGGTGGG - Intronic
1096770827 12:53934878-53934900 GTTTTAAAAAAGGTGGGGGTGGG - Intergenic
1096807421 12:54149050-54149072 ACTTAAAGAAAAGTGGGGTTGGG - Intergenic
1096997278 12:55846514-55846536 AGTTATCATAAGGTGAGGGTGGG + Intergenic
1097059521 12:56272201-56272223 GCATATTAAAAGATGGGGGTTGG + Exonic
1097949447 12:65410965-65410987 CCCCATAAAAGGGTGGGGGTGGG - Intronic
1098225755 12:68321377-68321399 ATTTATATAAAGCTGGGGCTTGG - Exonic
1098685819 12:73419148-73419170 TTTTATAAAGAGATGGGGGTAGG - Intergenic
1098740958 12:74172603-74172625 ATATATAAAAGGGAGGGGGTGGG - Intergenic
1098961480 12:76744093-76744115 ACTTACAAAAGGTTGGGGGGTGG - Intergenic
1100235399 12:92655553-92655575 AATTAGAAAAAGGTGTTGGTTGG - Intergenic
1100298073 12:93281154-93281176 AAGTATAAGAAGGTGGGGTTTGG - Intergenic
1100889898 12:99113696-99113718 ACTAGTGAAAGGGTGGGGGTTGG - Intronic
1101418832 12:104532317-104532339 TCTTATAACGGGGTGGGGGTGGG - Intronic
1102368128 12:112357262-112357284 AATAAAAAAAAAGTGGGGGTTGG + Intronic
1102589275 12:113945418-113945440 ACTTGCAAAGAGGTGGAGGTGGG - Intronic
1102791802 12:115652510-115652532 ACTAATACAAAGGTGTGGGCGGG - Intergenic
1103087278 12:118071300-118071322 ACTTTTGAAAAGGTGCGGGATGG - Intronic
1103127068 12:118432758-118432780 AAAAAAAAAAAGGTGGGGGTGGG + Intergenic
1103173920 12:118845161-118845183 CCTTATAAAAAAGTGGAGATTGG + Intergenic
1104015889 12:124961947-124961969 ATTAAAAAAAAAGTGGGGGTGGG + Intronic
1106340379 13:28820894-28820916 AATTATCCAAAGCTGGGGGTGGG - Intronic
1108141578 13:47428065-47428087 AATAATAAAAAGGGGGAGGTGGG + Intergenic
1108275935 13:48809702-48809724 GATTAAAAAAAGGTGGGGGGAGG + Intergenic
1108297188 13:49035166-49035188 ACTTATACACATGTGTGGGTTGG - Intronic
1112150093 13:96749652-96749674 ACTTATAAAATTATGTGGGTTGG + Intronic
1112235053 13:97628413-97628435 ACTTATCAGAAGGTGGAGGGTGG + Intergenic
1114204737 14:20558348-20558370 AATTAAAGAAAGGTGGGTGTTGG + Intronic
1114779448 14:25521740-25521762 AATGACAAAAAGGAGGGGGTGGG - Intergenic
1115207141 14:30920576-30920598 AATTATAAAACGGTGGGGGCTGG + Intronic
1115450172 14:33538869-33538891 AATTATAGAATGTTGGGGGTGGG - Intronic
1115714587 14:36088849-36088871 ACTTAAATAAGGGTGGGGCTAGG - Intergenic
1115716555 14:36111673-36111695 AATTAGAAAAAGGTGGTGGTTGG + Intergenic
1117861263 14:60094768-60094790 AGTTAAAGAAAGATGGGGGTGGG - Intronic
1119215662 14:72867304-72867326 AGTTAAAAAAAGGTGGGGCCAGG - Intronic
1119556498 14:75557468-75557490 CCTGATAAAAAGGTGGAGTTTGG - Intergenic
1119570070 14:75662178-75662200 CCATATAAATAGGTGGGGGAGGG - Intronic
1119619435 14:76120799-76120821 ACTTATGCAATTGTGGGGGTTGG - Intergenic
1120164705 14:81184526-81184548 ACTAATAAAAAGGTGGAGTTAGG - Intronic
1120285578 14:82496266-82496288 ACAAAAAAAAAGGTGGGGGGGGG + Intergenic
1121941416 14:98074495-98074517 ACCTATAAATATCTGGGGGTGGG + Intergenic
1122018705 14:98819110-98819132 ACTCAAAACAGGGTGGGGGTTGG - Intergenic
1122175771 14:99917556-99917578 CCTCAAAAAAGGGTGGGGGTAGG + Intronic
1122255228 14:100471414-100471436 ACTTACCAAAAGCTGGAGGTGGG - Intronic
1122473850 14:101991942-101991964 CCTAATAAAAAGTGGGGGGTGGG - Intronic
1122561118 14:102615133-102615155 TCTCAAAAAAAGGTGGGGGCGGG - Intronic
1125093807 15:35828021-35828043 CCTTATAAAAGGTTGGGGGTTGG - Intergenic
1125331925 15:38590910-38590932 ACTTTTAAAATGCTGGGGCTGGG + Intergenic
1126543985 15:49852689-49852711 ACTGAGGAAAAGGTGGTGGTGGG - Intergenic
1126712030 15:51469746-51469768 AATTTTAAAAAGGTAGGAGTGGG + Intronic
1128028410 15:64459532-64459554 GGTCATAAAAAGGTGGGGGGAGG - Intergenic
1128038153 15:64545140-64545162 ACTTGTTAAAAGGTGGGGAATGG + Intronic
1128318937 15:66679319-66679341 ATTTATAAGAAACTGGGGGTTGG + Intronic
1128916344 15:71566506-71566528 ACTTGTTAAAGGGTGGGGCTTGG + Intronic
1129019857 15:72506777-72506799 AATAATAAAAAGGTGGGTTTTGG + Intronic
1130080886 15:80732557-80732579 GCTTTTAAAAAGGACGGGGTGGG + Intronic
1130429954 15:83837622-83837644 AATTTTAAAAAGCTGGGTGTTGG + Intronic
1130446875 15:84010759-84010781 ACTTTTTAAAAGTTGGGGATAGG + Intronic
1130642176 15:85687742-85687764 ATTTTTTAAAAGGTGGGGGTGGG + Intronic
1130643482 15:85701943-85701965 TCTTATAAAAAGAAGGGGGTAGG + Intronic
1131031678 15:89191393-89191415 ACTAAGAAAAAAGTGGGTGTTGG - Intronic
1131692583 15:94843353-94843375 ACTAATAAAAAATTGGAGGTAGG - Intergenic
1134266187 16:12694718-12694740 GCTTAAAAAAAGGTGGGGGGGGG + Intronic
1135876843 16:26209336-26209358 ACTGGGAAAGAGGTGGGGGTTGG + Intergenic
1136124008 16:28163216-28163238 ACCTATAGAAAGGTGGGACTTGG - Intronic
1137739716 16:50756809-50756831 GCTGATAAAAAGCTGGGGCTCGG + Intronic
1137837498 16:51607040-51607062 AACCATAAAAAGCTGGGGGTGGG + Intergenic
1138344005 16:56308913-56308935 CCTGATGAAAAGGTGGGGGTGGG - Intronic
1138633175 16:58315825-58315847 ACTTTAAAAAATGTGAGGGTTGG + Intronic
1139057613 16:63204809-63204831 ACTGATAAAAAGTTGGGTCTGGG + Intergenic
1140470427 16:75210891-75210913 ACTTAAAAACAGGTGCGGGCCGG - Intergenic
1141508420 16:84496240-84496262 ACTTATTAAAAGGCTAGGGTGGG + Intronic
1142589286 17:994526-994548 AAGAAAAAAAAGGTGGGGGTTGG - Intergenic
1144157346 17:12518748-12518770 ACTTCTAGAAACTTGGGGGTGGG - Intergenic
1144822138 17:18082717-18082739 ATTAATAAAAAGTTGGGGGGAGG - Intergenic
1146047721 17:29523839-29523861 GCTTATAAAAAGGGCTGGGTAGG - Intronic
1146253895 17:31377628-31377650 ACTTAAAAAAAGGGGGGTGGGGG - Exonic
1146995706 17:37319133-37319155 TCATAAAAAAAGGTGGGGGGTGG + Intronic
1148061903 17:44842523-44842545 GTTTATAAAAGGGTGGGGGGTGG + Intergenic
1148068742 17:44893754-44893776 TTTTAAAAAAAGGTGGGGGGGGG + Intronic
1149598429 17:57877583-57877605 AAAAAAAAAAAGGTGGGGGTGGG + Intronic
1149920781 17:60657031-60657053 ACTAATAAAAAGGTGATTGTGGG + Intronic
1150441912 17:65198061-65198083 GCTTTTAAATTGGTGGGGGTTGG + Intronic
1150563374 17:66315307-66315329 AGTTAGAAAATGGTGGGGCTGGG + Intronic
1150574378 17:66416896-66416918 TCTCAAAAAAAGTTGGGGGTGGG + Intronic
1151709429 17:75793765-75793787 ACTTTTAATAAGGAGGGGGAAGG + Intronic
1151765983 17:76133257-76133279 ACTTAAAATGAGGTGGGGCTGGG + Intergenic
1153038983 18:792887-792909 AGTTATTAAAAAGTAGGGGTGGG - Intronic
1153061527 18:999827-999849 ACTTACAAGAAGGTAGGGATAGG + Intergenic
1153272144 18:3333333-3333355 ACTTAACAAAAAGTGGGAGTAGG - Intergenic
1153285954 18:3453834-3453856 ACTTTAAAAAATGTGGCGGTGGG - Intronic
1153586376 18:6624845-6624867 ACGAATAAAGAGGTGGGGGAAGG + Intergenic
1155012205 18:21790907-21790929 AATTATAAAAAGGAGGTGCTGGG + Intronic
1155520320 18:26661322-26661344 AATTATAAACAGGTGGTGGCTGG - Intergenic
1157504475 18:48216953-48216975 CCTTATAAAAAGGGGAGGTTTGG + Intronic
1157859838 18:51131747-51131769 AGTAATAAAAAGGGGGGGATGGG - Intergenic
1159206961 18:65265415-65265437 TTTTTTAAAAAGTTGGGGGTTGG + Intergenic
1159360866 18:67401128-67401150 ACATATAAGAAGGTGGGGTGAGG + Intergenic
1159785728 18:72712311-72712333 ACTGGTTAACAGGTGGGGGTTGG - Intergenic
1160268711 18:77364365-77364387 AGTTATCAAGAAGTGGGGGTTGG - Intergenic
1161147284 19:2686456-2686478 ATTTTTAAAAAGGAGGGGGGAGG - Intronic
1162326617 19:10003347-10003369 ACTGATAACAGGGTGGGGGTGGG - Intronic
1162400859 19:10445833-10445855 AAAAAAAAAAAGGTGGGGGTGGG - Intronic
1162456991 19:10791386-10791408 CCTTATAAAAAGGGGGAGTTGGG - Intronic
1163563153 19:18032892-18032914 GCATATTAAAAGCTGGGGGTTGG - Intergenic
1164518687 19:28959651-28959673 ACTTTTTAAAATGTTGGGGTGGG + Intergenic
1166626959 19:44366648-44366670 CTTTTTAAAAAAGTGGGGGTGGG - Intronic
1166765063 19:45247909-45247931 ATTTTTAAAAAGGAGGGGGACGG - Intronic
1166925036 19:46261296-46261318 ATTTAGAAAAAGATGGGGCTGGG + Intergenic
1167401682 19:49275934-49275956 ATTTTTAAAAAGGAGAGGGTAGG - Intergenic
925383604 2:3446309-3446331 ATTTATGAAAAGGTGTGTGTTGG + Intronic
927033403 2:19146943-19146965 AGATATGAAAAGGTGGGGGTAGG - Intergenic
927512446 2:23652841-23652863 CCTGATAAAAAGGAGGAGGTGGG - Intronic
927652818 2:24922548-24922570 TCTCAAAAAAAAGTGGGGGTTGG + Intergenic
927866752 2:26593069-26593091 ACGAACAAAAAGGTGGGGGAAGG + Intronic
928151360 2:28832832-28832854 AAAAAAAAAAAGGTGGGGGTGGG - Intronic
928625761 2:33138482-33138504 ATTTTTAAAAAGGCAGGGGTGGG - Intronic
929193083 2:39157844-39157866 TCTTAAAAAAACATGGGGGTGGG + Intergenic
929962292 2:46506006-46506028 ACCCATAGTAAGGTGGGGGTGGG + Intronic
929986794 2:46742347-46742369 GCTACTAAGAAGGTGGGGGTGGG - Intronic
930653118 2:53982143-53982165 ACATATAAAAACTGGGGGGTAGG - Intronic
930732535 2:54742223-54742245 AATGGCAAAAAGGTGGGGGTAGG - Intronic
930811579 2:55547051-55547073 ACTTAGAAAAGGGTGGACGTGGG - Intergenic
931070600 2:58644378-58644400 ACTTAAAAAAATGTGGGCGGTGG - Intergenic
931661702 2:64570920-64570942 ACTGGAAAAAAGGTGGGGGGGGG - Intronic
932057556 2:68461664-68461686 ACTTATGAAAAGGGGGGATTGGG + Exonic
932280679 2:70489237-70489259 TGTTAGAAAAAGGTGGGCGTTGG + Intronic
933848476 2:86346612-86346634 ACTTAAAAAAATGTGGGAGCTGG - Intergenic
935405036 2:102699891-102699913 ACTTATAAAAAGAAGAGGTTTGG - Intronic
936539646 2:113339866-113339888 ACTTAGAAAAAGTTAAGGGTAGG + Intergenic
936780294 2:116024699-116024721 ACTTAAGAAAAGGGGTGGGTGGG + Intergenic
937208142 2:120249986-120250008 TCTTAGCAAAAGATGGGGGTAGG - Intronic
937811941 2:126209338-126209360 ATTTTTTATAAGGTGGGGGTTGG - Intergenic
938757960 2:134397878-134397900 ACTCCTATAAAGGTTGGGGTTGG - Intronic
939035860 2:137130362-137130384 AATAATAAAAAGGTGAGGCTTGG - Intronic
939090421 2:137773919-137773941 ACTTCTAAAGAGGAGAGGGTGGG - Intergenic
939606398 2:144259993-144260015 ACTAATAAAAATTTGGAGGTGGG + Intronic
941389654 2:164895950-164895972 AACTTTAAAAAGGTGGTGGTAGG - Intergenic
941444259 2:165581536-165581558 TCTCAAAAAAAGGTGGGGGTGGG - Intronic
942074310 2:172342563-172342585 TCTTATAAAAAGGAGGGGGAGGG - Intergenic
942339369 2:174927056-174927078 AATTTGAAAAAGGTGTGGGTAGG - Intronic
942495753 2:176538499-176538521 AATTAAAAGAAGGTGGGGCTGGG + Intergenic
942656591 2:178220245-178220267 ACTTAAAAAAAGGCAGGGGTGGG - Intronic
943757820 2:191575484-191575506 ACTAATGAAAAGATGGGTGTTGG + Intergenic
944310135 2:198224103-198224125 ATTTATAAAAATGGGTGGGTAGG + Intronic
944756774 2:202770981-202771003 ACCTCTTTAAAGGTGGGGGTGGG - Intergenic
944791903 2:203139546-203139568 AAAAAAAAAAAGGTGGGGGTGGG - Intronic
945034293 2:205690960-205690982 ACTTAATAACAGCTGGGGGTGGG + Intronic
945063846 2:205931747-205931769 ACACAGAAAAAGGTGGGGGCGGG + Intergenic
946514172 2:220393424-220393446 AGTTATACAACTGTGGGGGTGGG + Intergenic
946623337 2:221583026-221583048 ATTTATATAAAGGAGGGGGAAGG + Intergenic
946759088 2:222975355-222975377 ACTTAAAAAAAGGGGGGGGCAGG - Intergenic
946778483 2:223168992-223169014 ACTTATCAGAGGGTGGAGGTTGG + Intronic
947252703 2:228125774-228125796 TCTTATAAAAAGGAGTGGTTGGG + Intronic
947815824 2:233035350-233035372 ACCTACACAAAGCTGGGGGTAGG - Intergenic
1171012114 20:21514491-21514513 ATCTTAAAAAAGGTGGGGGTGGG + Intergenic
1171105594 20:22429749-22429771 ACTGATAAACAGATGGGGGCTGG + Intergenic
1171875399 20:30570608-30570630 CTTTTTAAAAAAGTGGGGGTGGG + Intergenic
1172136037 20:32687496-32687518 ATTTAAAAAAAGGAGGTGGTGGG + Intergenic
1172423185 20:34835118-34835140 ATACACAAAAAGGTGGGGGTGGG + Intergenic
1172780061 20:37431317-37431339 GCTGATAAGATGGTGGGGGTTGG - Intergenic
1173230103 20:41188397-41188419 AAAAAAAAAAAGGTGGGGGTGGG - Intronic
1173361532 20:42349032-42349054 ACTTCTAAATTGGTGGTGGTTGG + Intronic
1173436296 20:43034911-43034933 GCTGAGGAAAAGGTGGGGGTGGG - Intronic
1173449643 20:43151382-43151404 GTTAATAAAGAGGTGGGGGTGGG + Intronic
1174073453 20:47915234-47915256 ACTCATAAACATGTAGGGGTGGG + Intergenic
1174140212 20:48407602-48407624 ACTTTTAAAAAGATGTGGATAGG - Intergenic
1174311955 20:49663476-49663498 ACTAATAAAAATGAAGGGGTAGG + Intronic
1174762331 20:53218027-53218049 ACTCTTAAAAAGGAGGGTGTTGG - Intronic
1174793216 20:53499113-53499135 ACAAAGAAAAAAGTGGGGGTGGG + Intergenic
1175001615 20:55635202-55635224 ACTGATAAAAATGTTTGGGTTGG + Intergenic
1175437749 20:58966257-58966279 ACTTATTAAATGGTGGGGCTTGG + Intergenic
1177325946 21:19589051-19589073 AGAAAAAAAAAGGTGGGGGTGGG - Intergenic
1177350444 21:19932604-19932626 ATTTATAGAAGGGTGAGGGTGGG + Intergenic
1178369614 21:32016642-32016664 CCTTCTAAGGAGGTGGGGGTGGG + Intronic
1181487352 22:23239811-23239833 TCTTAAAAAAAAGTGGGGGTGGG - Intronic
1181523288 22:23461678-23461700 AATTCTAAAAAGGTGGGAATGGG - Intergenic
1183035549 22:35138471-35138493 ACCTATTAAAAGGTGAAGGTTGG + Intergenic
1183611196 22:38907579-38907601 ACTCATGAAAAGGGGGGTGTAGG - Intergenic
1184639780 22:45864377-45864399 ATTTAAGAAAAGGTGGGGGTGGG - Intergenic
950036863 3:9892309-9892331 ACTAATAAAAAGGCAGGGCTGGG - Intronic
950391824 3:12702793-12702815 AGTTAAAAAAATGTGGAGGTAGG + Intergenic
950450788 3:13063936-13063958 AATTTTTAAAAGGTGAGGGTGGG - Intronic
950769055 3:15296416-15296438 TCTTATAAAAGGGTGTGGGATGG - Intronic
951220943 3:20068429-20068451 ACTTGAAGAAAGGTGGGAGTTGG - Intronic
951315795 3:21188955-21188977 ACTTATAAAAAGGAGGTTGAAGG + Intergenic
951666889 3:25136277-25136299 ACTTATAAAAAGCTAGGGCTAGG + Intergenic
953210901 3:40874155-40874177 ATTTATAAAATGGTGGGGTGAGG + Intergenic
953971488 3:47351986-47352008 AGTTAGAAAAAGGTGGTGGTGGG - Intergenic
955107981 3:55918305-55918327 AAAAATAAAAAGGTGGGGGCAGG + Intronic
955671531 3:61407926-61407948 ACATATAAATTGGTGGGGGGTGG + Intergenic
955914750 3:63895542-63895564 GCTCATTAAAAGGTGGGGGCGGG + Intronic
955962933 3:64359386-64359408 TTTTAAAAAAAGGTGGGGGTGGG + Intronic
957154173 3:76526089-76526111 ACTTATAAAATGTTGGTGTTAGG + Intronic
957970228 3:87374389-87374411 AGTTGTGAAAAGCTGGGGGTGGG + Intergenic
959960956 3:112297052-112297074 ATTTTTTAAAAGGTGGGGGATGG - Intergenic
961908037 3:130282947-130282969 ACTTAGAAAAAGGCTGGGGCTGG + Intergenic
962378745 3:134879821-134879843 AATTAAAAAAAAGTAGGGGTTGG + Intronic
962472030 3:135717843-135717865 ACTTATATAATTGTGGGGGCTGG + Intergenic
963289522 3:143473716-143473738 ACTTCTAAAAAATTGGGAGTCGG - Intronic
965338170 3:167453865-167453887 ATTTAAATAAAAGTGGGGGTGGG + Intronic
965565093 3:170107293-170107315 ACTTTCAAAAAGCTGAGGGTGGG + Intronic
966133069 3:176666504-176666526 AGTTAAAAAAAAGGGGGGGTTGG + Intergenic
966582379 3:181582543-181582565 ACTTTTAAAAACGTAGGTGTTGG + Intergenic
966831702 3:184015953-184015975 CCTTTTTAAAAGGTGGGGGTTGG + Intronic
971965000 4:33542394-33542416 ATTTATACAAAGAAGGGGGTAGG - Intergenic
972981667 4:44711699-44711721 ACTTATAAAAATGTGTGGATTGG + Intronic
973176530 4:47212705-47212727 TCTTATGAAAAGAAGGGGGTTGG - Intronic
974024454 4:56720952-56720974 AGTCATACAAAGGTGGGGGTTGG + Intergenic
974320741 4:60346092-60346114 ACTTATACAAGGCTGGGGGTTGG - Intergenic
975558943 4:75691584-75691606 AGTAATAAATAGGTGGAGGTCGG - Intronic
975619422 4:76280962-76280984 ACTTGTAACAGGGTTGGGGTGGG + Intronic
975706839 4:77120273-77120295 ACTTGTAAAAAGTGGGGGGGGGG - Intergenic
976030316 4:80744394-80744416 TCACAAAAAAAGGTGGGGGTGGG + Intronic
977526262 4:98149813-98149835 AAAAAAAAAAAGGTGGGGGTGGG - Intergenic
978091829 4:104726641-104726663 ACTTTTAAAAAGGTGGGTAAGGG + Intergenic
978639875 4:110857680-110857702 TCTTAGAAAAAGGTGGGTGTAGG + Intergenic
978673433 4:111279536-111279558 TTCTTTAAAAAGGTGGGGGTTGG - Intergenic
980079900 4:128333246-128333268 AGTCATAACAAGGTGGGAGTAGG - Intergenic
980949232 4:139355991-139356013 AATTTTAAAAAGGAGGGAGTGGG - Intronic
980968346 4:139545536-139545558 CTTTACAAAAAGGTGGGGTTGGG + Intronic
981002440 4:139840659-139840681 CCTTATGAACAGGTGGAGGTGGG + Intronic
981773966 4:148343405-148343427 ATTTAAAAAAAAGGGGGGGTCGG - Intronic
981776145 4:148369945-148369967 ACTTCTAAAAAGGTGGCACTTGG - Intronic
982022941 4:151222564-151222586 ACTTTAAAAAAGGTTGGGGAGGG - Intronic
983190058 4:164745662-164745684 ACTTTTAAAAAGGTGGGGGGAGG - Intergenic
983588189 4:169378696-169378718 TCTCAAAAAAAGGTGGGGGGGGG - Intergenic
985353346 4:189090714-189090736 ACTTTTAAAGAGGTGGGTCTAGG - Intergenic
985872390 5:2567491-2567513 AGTTATTAAAGGGTGAGGGTGGG + Intergenic
987017495 5:13835581-13835603 ACATATTAAAAGGCTGGGGTTGG + Intronic
987085683 5:14465512-14465534 AATTAAGAAAAGGAGGGGGTGGG - Intronic
987192847 5:15497030-15497052 CCTTATAGCCAGGTGGGGGTGGG + Intergenic
988882415 5:35517506-35517528 AGTTACAAAAAATTGGGGGTGGG - Intergenic
989164763 5:38423437-38423459 ATTTTTTAAGAGGTGGGGGTAGG - Intronic
989363576 5:40631069-40631091 ATTTATAAAAAGGTGTTAGTGGG + Intergenic
990031225 5:51261879-51261901 ACTGATACAAAGTTGGGGGCAGG - Intergenic
990091265 5:52052744-52052766 CCTTATAAAAAGGGGGCTGTAGG - Intronic
990299190 5:54433726-54433748 TCTTCAAAAAAAGTGGGGGTGGG - Intergenic
990469897 5:56105610-56105632 ACTTCTGAAGAGGTAGGGGTGGG + Intronic
992109281 5:73477566-73477588 CCTTAAAAAAAAGTGGGGGGGGG + Intergenic
993445609 5:88008742-88008764 ACTTATAAAAAGGTGAAATTTGG - Intergenic
993826890 5:92700192-92700214 CCTGATATAATGGTGGGGGTAGG - Intergenic
993836121 5:92822355-92822377 GCATATTAAAAGGTGAGGGTGGG - Intergenic
993953630 5:94205448-94205470 AAATATAAAAAAGTGGTGGTGGG - Intronic
993993626 5:94691397-94691419 GCATTTAAAAAGGCGGGGGTGGG - Intronic
994722204 5:103393188-103393210 ATAGATAAAAAGGTGGGGGTGGG + Intergenic
997443156 5:133922906-133922928 ATAAATAAAAAGGTGGGGGGTGG - Intergenic
997581640 5:135020871-135020893 ACTTAAAAAAGGATAGGGGTGGG + Intergenic
997869521 5:137495200-137495222 ACTTCTAAAAAGAAGGGGATAGG + Intronic
999396735 5:151234257-151234279 ACATTTAAAAAGTGGGGGGTGGG - Intronic
1001061874 5:168497879-168497901 ACATATTAACAGGTGGGGGATGG - Intronic
1001249814 5:170138322-170138344 ACTTAGAAATGGCTGGGGGTGGG + Intergenic
1002286347 5:178165106-178165128 ATTTATAAAAACATGGGGGCCGG + Intergenic
1002657027 5:180757501-180757523 CCTTATCAAAAGGTGGGCGAAGG - Intergenic
1002659227 5:180779415-180779437 AATTTTTAAAAGGTGTGGGTAGG - Intergenic
1002693260 5:181065694-181065716 ACTTAAAAAAAAAAGGGGGTGGG + Intergenic
1003516230 6:6821203-6821225 ATTAATAAAAAGGTGTGGGATGG + Intergenic
1003568844 6:7242689-7242711 ACTTAAAAAAAAGGGGGGGGGGG + Intronic
1004954593 6:20715265-20715287 TTTTTTAAAAAGGTGGGGGGAGG - Intronic
1005276537 6:24225125-24225147 ACTTATAAAAATCTGGGTATGGG - Intronic
1007187120 6:39981366-39981388 ACAGATAAGAAGATGGGGGTGGG + Intergenic
1008118151 6:47577738-47577760 ACTTAAAAAAGGTTGGGGGTGGG - Intronic
1010546869 6:77169888-77169910 ACTTATAAGAGGGTAGAGGTTGG - Intergenic
1010996134 6:82535328-82535350 TCTGGTAAAAAGTTGGGGGTTGG - Intergenic
1012488717 6:99753073-99753095 ACTTATTAAGAGCTGGGGGCTGG + Intergenic
1012946066 6:105466996-105467018 ACTTTTAAAAAGTTGGGGGAGGG + Intergenic
1013824287 6:114192972-114192994 ACTTTTAAAAAGGTGGGGGCAGG - Intronic
1013919634 6:115388154-115388176 ACTTATAAAATGGTGGTTGAGGG + Intergenic
1015993343 6:138971587-138971609 AGATAAAAAAAAGTGGGGGTAGG + Intronic
1016515849 6:144892591-144892613 ACTTAAAAAAAGGCGGGGGATGG + Intergenic
1016582802 6:145648166-145648188 ACTTGTAAATAGGTGGTGGATGG + Intronic
1017988584 6:159466500-159466522 ACTTACAGAAAGGTGAGGCTGGG + Intergenic
1019543663 7:1562509-1562531 ACTTAGGAAAAGGGGGTGGTGGG + Intergenic
1020222069 7:6246674-6246696 ACTGAGAAGTAGGTGGGGGTGGG - Intronic
1020773417 7:12424252-12424274 ACATATTAAAAGGTTAGGGTGGG - Intergenic
1020876328 7:13699378-13699400 ATTAAAAAAAAGGTGGGGGTGGG + Intergenic
1022671159 7:32457686-32457708 AGTGGTGAAAAGGTGGGGGTTGG - Intergenic
1023388397 7:39683283-39683305 ACTTAGAAGAGGGTGGGAGTGGG - Intronic
1023920518 7:44625977-44625999 ATTTAAAAGAAGGTGGGGGGCGG + Intronic
1023933534 7:44722721-44722743 TCTTATAAAAGGGAGGGGGGAGG - Intergenic
1024815307 7:53261890-53261912 TCTTATATAATGGTGGGGATTGG - Intergenic
1027738218 7:81963064-81963086 GTTTAAAAAAAAGTGGGGGTGGG + Intronic
1027776281 7:82469269-82469291 ATATATAAAAACGTGGGGGGTGG + Intergenic
1028749148 7:94362806-94362828 CCCTATAAAATGGTGGGGATGGG + Intergenic
1029994252 7:104991459-104991481 TCTTTTAAAAAGGTGGAGGGGGG - Intergenic
1030244912 7:107372760-107372782 TCTTAAAAAAAGGTGGGGTGGGG + Exonic
1031531595 7:122883688-122883710 ATTTTTTAAAAGGTGGGGGAGGG + Intronic
1031537001 7:122946913-122946935 ACTTGTGAAAAGGGAGGGGTAGG + Intergenic
1032641567 7:133774901-133774923 ACTAATAAAGTGGTGGGGGAGGG - Intronic
1033427266 7:141255718-141255740 TCTTAAAAAAAGGCAGGGGTCGG - Intronic
1035824840 8:2633423-2633445 ACATTTTAAAAGGTGTGGGTAGG - Intergenic
1036459349 8:8938191-8938213 ACTTAGAACAAGGTGAGGGAGGG + Intergenic
1037275092 8:17169535-17169557 ACTGATAAAGAGGAGTGGGTGGG + Intronic
1038411123 8:27360617-27360639 AATCATAAAGGGGTGGGGGTGGG + Intronic
1038679261 8:29651998-29652020 ATTAAAAAAAAGGTGGGGGGAGG - Intergenic
1039071625 8:33654150-33654172 ACATATGAACTGGTGGGGGTGGG - Intergenic
1039165976 8:34680454-34680476 AAAAAAAAAAAGGTGGGGGTGGG - Intergenic
1039387201 8:37146575-37146597 ACTGATAGTAAGTTGGGGGTTGG + Intergenic
1039396696 8:37231850-37231872 TCTTTTAAAAAGCTGGGGATGGG + Intergenic
1039683059 8:39763599-39763621 ATTCATAAAAGGGTGGGAGTGGG - Intronic
1041558243 8:59184085-59184107 ACTTTTTTAAAGGAGGGGGTGGG - Intergenic
1041612415 8:59867189-59867211 AGTGATGAAAAAGTGGGGGTTGG + Intergenic
1041646886 8:60262003-60262025 ATTTACAAAAAAGTGGGGCTGGG - Intronic
1041895965 8:62924992-62925014 ACATATGAATTGGTGGGGGTGGG + Intronic
1044378198 8:91501048-91501070 CCTTATAAAATGGAGGGGGGGGG - Intergenic
1044464519 8:92487898-92487920 AATTATGAAAACGTGGGGATGGG + Intergenic
1044926654 8:97214900-97214922 GCTTAGAAAAAGGAGGGGGCAGG - Intergenic
1046084516 8:109415641-109415663 ATTTAAAAAAAGGAGGGGGCTGG + Intronic
1047514442 8:125541392-125541414 ACTTATCTAAGGATGGGGGTGGG + Intergenic
1049379889 8:142306797-142306819 TCTTTTAAAAAGGTGGGGAGTGG - Intronic
1050556089 9:6790744-6790766 ATTTAGAAGAAGGTTGGGGTGGG + Intronic
1050839408 9:10128347-10128369 CCTTATAAAAAGGTGACAGTTGG + Intronic
1051816641 9:21115548-21115570 ACTGAAAAAAAGGTGGGGGGTGG + Intergenic
1051946971 9:22581085-22581107 ACTCATAAAATGGTGGGGAAAGG + Intergenic
1052046328 9:23798426-23798448 ACCTATAAAATGGCGGGGGTGGG + Intronic
1053237813 9:36471477-36471499 AGTTTAAAAAAGGTTGGGGTGGG - Intronic
1053662673 9:40295263-40295285 AGTTATAAAAGGGTGCGGGTAGG + Intronic
1053913123 9:42925439-42925461 AGTTATAAAAGGGTGCGGGTAGG + Intergenic
1054374803 9:64441488-64441510 AGTTATAAAAGGGTGCGGGTAGG + Intergenic
1054521938 9:66081021-66081043 AGTTATAAAAGGGTGCGGGTAGG - Intergenic
1054812616 9:69446883-69446905 ACTTAAGTAAAGGTGGGGATGGG - Intronic
1056146785 9:83738928-83738950 AAAAAAAAAAAGGTGGGGGTGGG - Intergenic
1058760628 9:108128110-108128132 AGTAATAAAAAGGTGAGGGCCGG + Intergenic
1058930889 9:109717628-109717650 AATTATGAAAAGGTGCGGATAGG + Intronic
1059991701 9:119871362-119871384 ACTTGTAAAAATGTGGGCTTTGG + Intergenic
1060651598 9:125332108-125332130 CTTTATAAATAGGAGGGGGTAGG - Intronic
1060681843 9:125573088-125573110 TCTTATAAAAGGGGGGGGGGGGG + Intronic
1062251207 9:135595526-135595548 AGTAATAAAAAGGTGGAGGTAGG + Intergenic
1186158688 X:6752993-6753015 ACTTAAAAAAAAATGTGGGTGGG - Intergenic
1187067774 X:15856768-15856790 AGCCAAAAAAAGGTGGGGGTAGG + Intergenic
1189150964 X:38706188-38706210 ATTTACAAAATGGTGAGGGTGGG + Intergenic
1189385831 X:40536173-40536195 TCTCAAAAAAAGGTGGAGGTGGG + Intergenic
1189756245 X:44274608-44274630 ACTTTTAAAAAGTAGGGGGAGGG + Intronic
1192016442 X:67336548-67336570 ACTTATAAAAAGAAGGAGTTGGG + Intergenic
1192058439 X:67797842-67797864 ACTTATGAAAAGGTGGAAGTGGG + Intergenic
1192867317 X:75148509-75148531 ACATATAAATTTGTGGGGGTGGG - Intronic
1193029210 X:76879868-76879890 ACTTAGAAATGGGTGGAGGTTGG - Intergenic
1193142990 X:78048451-78048473 TCTTAAAATCAGGTGGGGGTAGG + Exonic
1193217975 X:78887023-78887045 ACTGAAAAAAAGGTGGGGGGAGG + Intergenic
1193403825 X:81078451-81078473 ATTTAAAAAAAGGGGGGGGAAGG + Intergenic
1195941748 X:110173113-110173135 CTTTATAAACAGGTGGGGATTGG + Intronic
1196276372 X:113770086-113770108 ACTTCTAAAAGGAAGGGGGTAGG + Intergenic
1196614413 X:117751456-117751478 ACTAAGAAAAAGGTGGGGCCAGG + Intergenic
1196949175 X:120858777-120858799 ATTAAAAAAAAGGTGGGGGGGGG - Intergenic
1197752477 X:129974967-129974989 ACATATAAAAAGCTGTGGGAGGG + Intergenic
1198135898 X:133749968-133749990 ACGTACCAAATGGTGGGGGTAGG - Intronic
1199254914 X:145708737-145708759 CAGTATAAAAAGGTGGGGGAAGG + Intergenic
1199514564 X:148661881-148661903 AATAACAAAAAGATGGGGGTGGG - Intronic
1199592975 X:149485110-149485132 ACTTATAAAAAGATGAGGTCAGG + Intronic
1200500194 Y:3939328-3939350 TCAAAAAAAAAGGTGGGGGTGGG - Intergenic
1201483642 Y:14468806-14468828 CCTTATAAAAAGGGGGAGTTTGG + Intergenic