ID: 901184324

View in Genome Browser
Species Human (GRCh38)
Location 1:7362705-7362727
Sequence GAGGCAGTGAACTTGGATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901184324 Original CRISPR GAGGCAGTGAACTTGGATAG AGG Intronic
900191133 1:1352778-1352800 GAGGGAGTGAAGTTGGTTTGGGG - Exonic
901184311 1:7362629-7362651 GAGTGAGTGAACTTGGGTAGAGG + Intronic
901184324 1:7362705-7362727 GAGGCAGTGAACTTGGATAGAGG + Intronic
901184357 1:7362933-7362955 GAGCGAGTGAACTTGGGTAGAGG + Intronic
901923758 1:12553292-12553314 GTGGCCGTGAACTTGGGCAGGGG - Intergenic
904005924 1:27363214-27363236 GGAGCAGTGATCTTGGACAGCGG + Intronic
906041242 1:42789338-42789360 GAAGGAGTGAACTTGGACTGTGG + Intronic
906061400 1:42951401-42951423 GAGTTAGTGAACTTGTATAGTGG + Intronic
906815521 1:48874371-48874393 GAAGCAGTGAGTTTGGAGAGAGG - Intronic
908257141 1:62312400-62312422 GAGTCTGTAAACTTGGATAGGGG - Intronic
910641711 1:89471018-89471040 TAGGCAGAGAAACTGGATAGAGG - Intergenic
912434901 1:109654878-109654900 GAGGCAGTGGAGTGGGAGAGGGG - Intergenic
912438928 1:109683436-109683458 GAGGCAGTGGAGTGGGAGAGGGG - Intronic
912441450 1:109701881-109701903 GAGGCAGTGGAGTGGGAGAGGGG - Intronic
912475262 1:109930567-109930589 AGGGCAGTGAACTTGCATATGGG + Exonic
912938312 1:114023100-114023122 GAAGCAGTAAACCAGGATAGAGG + Intergenic
915200787 1:154226882-154226904 GTTGCAGTGAACTGAGATAGTGG - Intronic
915348556 1:155210625-155210647 GAGGTAGGTGACTTGGATAGAGG + Exonic
915669688 1:157478340-157478362 GAATCAGTGAACTTGAATACAGG - Intergenic
916513476 1:165494329-165494351 GTAGCAGTGAAAATGGATAGGGG + Intergenic
916863402 1:168831164-168831186 GAGGCAATGAGGTTGGAGAGTGG + Intergenic
917083330 1:171279619-171279641 GTGGCAGTGACCTTGGGTAGTGG - Intronic
917713782 1:177712939-177712961 GAGGTAGTGAACTGGGATGGGGG - Intergenic
919562550 1:199139855-199139877 GACACAGTGATCTTGGAAAGTGG + Intergenic
919941565 1:202290550-202290572 GAGGAAATGAGCTTGGAGAGAGG - Intronic
921789555 1:219274170-219274192 AATGCAGTGAAGTGGGATAGTGG + Intergenic
923083693 1:230684898-230684920 GTGGTAGGGAACTTGGATTGTGG + Intronic
1062894774 10:1094898-1094920 GAGGTAATGAACATGGAGAGAGG + Intronic
1062894818 10:1095152-1095174 GAGGTAATGAACATGGAGAGGGG + Intronic
1064462757 10:15550930-15550952 GAGGCAGTGGAAATGGAGAGAGG + Intronic
1064467869 10:15602895-15602917 TTGACAGTGAAGTTGGATAGAGG - Intronic
1065182381 10:23139629-23139651 GAGGCAGTGAATCTTGATAAGGG + Intergenic
1070766314 10:79058446-79058468 GAGACTGTGAACTTGGGGAGGGG - Intergenic
1070807332 10:79278283-79278305 GAGGCAGTGCCCTTGGGTGGTGG - Intronic
1071661109 10:87504261-87504283 AAAGCAGAGAACTTGGAAAGGGG - Intergenic
1073694885 10:105853661-105853683 GAGTCTGTGAACGTGGAAAGTGG + Intergenic
1073854352 10:107657469-107657491 AAGGAAATGAACTTGGATATAGG - Intergenic
1075857558 10:125643014-125643036 GAGGCAGTGAATTTGAGAAGGGG + Intronic
1076125409 10:127970185-127970207 GAGGGAGGGAACTTGGGTGGGGG + Intronic
1077942980 11:6863411-6863433 GAGTAACTGAACTTGGAGAGTGG - Intergenic
1079272354 11:19000235-19000257 GAGGCAGTGAACTGGGGAACAGG - Intergenic
1081245127 11:40756505-40756527 GAGGCAGTGTACTTGGATATAGG - Intronic
1081761899 11:45582422-45582444 GAGGCAGTGACCATGGAGACAGG + Intergenic
1084674410 11:70625721-70625743 GAGGCAGGGGACTTGGGGAGCGG - Intronic
1084750910 11:71204082-71204104 GAATCAGTGAACCTGGATGGGGG + Intronic
1085949460 11:81312031-81312053 GAGGCAGCTAAGTTTGATAGTGG + Intergenic
1089120287 11:116129384-116129406 GGGGCAGGGAACTGGGATCGGGG - Intergenic
1089614666 11:119688505-119688527 GAGGGGGTGCACTTGGGTAGAGG - Intronic
1091089187 11:132753732-132753754 GAGGAAGTGAAACTGGAAAGAGG + Intronic
1094715513 12:33011185-33011207 GAGGCAGTGATGATGGAGAGAGG + Intergenic
1095364081 12:41381468-41381490 GAGTCAGTGAACTTGAAGACAGG - Intronic
1098876380 12:75870010-75870032 GAGGCAATGGCCTTTGATAGAGG - Intergenic
1099598091 12:84694375-84694397 GAGGCTGTGAACCTGGAAAGTGG + Intergenic
1102416155 12:112764643-112764665 GAGGCAGGGAAGGTGGAGAGGGG - Intronic
1105758822 13:23494554-23494576 CCAGCAGGGAACTTGGATAGTGG - Intergenic
1105973443 13:25452187-25452209 GAGTGAGAGAACTTGGAGAGCGG + Intronic
1109298981 13:60570746-60570768 GAGGCAGTGAACATGAATGAGGG + Intronic
1110362068 13:74637590-74637612 ATGGCAGTGAACATAGATAGTGG + Intergenic
1111252589 13:85622457-85622479 AAGGCAGTAAACTTGGAAAAAGG + Intergenic
1119381973 14:74234823-74234845 GAGGAAGGGATCCTGGATAGAGG - Intergenic
1119887684 14:78157081-78157103 GAGGAAGTGAACTTTGATTTAGG + Intergenic
1121229271 14:92344680-92344702 GAGACAGTGAAAGTGGAGAGAGG + Intronic
1121714948 14:96067154-96067176 GAGGAAGTGAGCATAGATAGAGG + Intronic
1122394931 14:101418577-101418599 GAGTCTGTGAACTTGAATATAGG + Intergenic
1202928579 14_KI270725v1_random:17734-17756 GATGCAGTCAGCTTGGAGAGAGG + Intergenic
1123992657 15:25695010-25695032 GAGGCAGTGGACGTGGAGGGTGG + Exonic
1124012347 15:25849029-25849051 GAGGCAGAGACCTTGGTGAGAGG + Intronic
1124819121 15:33026221-33026243 GAGGCAGAGAAATTGAATAAAGG + Intronic
1125361521 15:38869581-38869603 GAGGAAGAGAACTTGGTTAATGG - Intergenic
1126060865 15:44781252-44781274 GAGGCAGAGGACATGGATATCGG - Intergenic
1126410659 15:48369876-48369898 TAAGCAGTGAAAATGGATAGGGG - Intergenic
1127260300 15:57322510-57322532 AAGGCAGTGACCGTGGATACGGG - Intergenic
1127328973 15:57920546-57920568 GTGGCAGTGAACATGAAGAGAGG + Intergenic
1127739877 15:61892452-61892474 GAGGCAGTGATCTAGGATAAAGG + Intronic
1129359362 15:75014921-75014943 GGGGCAATGAACAGGGATAGAGG + Intronic
1129942405 15:79509908-79509930 GAGGCAGTTGACCTGGAAAGTGG - Intergenic
1130157123 15:81360751-81360773 GAGGCAGTGACCATTGACAGAGG - Intronic
1132731544 16:1364888-1364910 CAGGCAGTGAACTGGGAGAGTGG - Intronic
1135511296 16:23086120-23086142 GAGCCAGTGAACTTGGGACGGGG - Intronic
1135619081 16:23937835-23937857 GAGGCAGTTAACTTGTGCAGTGG + Intronic
1136587958 16:31199980-31200002 GGGGCAGTGAGGTTGGAAAGTGG + Intergenic
1138954454 16:61953805-61953827 GCTGCAGTGAACTGGGATTGTGG + Intronic
1139391497 16:66608683-66608705 GAGGCAGGGAACCCGGAGAGGGG + Intronic
1139790832 16:69433327-69433349 GAGGCAGTGAAACTGGGCAGAGG - Intronic
1141238624 16:82243841-82243863 GAGGCAGAGAACATGGAAAATGG + Intergenic
1143512486 17:7404357-7404379 GAGGCGATCAACTTGGAAAGTGG - Intergenic
1143598069 17:7927580-7927602 AGGGAAGTGAACCTGGATAGGGG - Intronic
1144032862 17:11337547-11337569 GAGGCAGAGTTCTTGGAAAGTGG + Intronic
1144033204 17:11340787-11340809 GAAGCACTGAACTAGAATAGTGG + Intronic
1145256896 17:21330370-21330392 GAGGCAGTGGACTGAGAAAGTGG + Intergenic
1146910811 17:36647281-36647303 GTGGCAGTGAACTTGGCCTGTGG + Intergenic
1150586679 17:66524806-66524828 GGGGAAGTGATCTTGGATAGAGG - Intronic
1152442782 17:80319196-80319218 TAGGCAGTGATCTGGGAGAGGGG - Exonic
1158003319 18:52644246-52644268 GAGGCAGTGAACTAGTTAAGTGG + Intronic
1158558146 18:58491941-58491963 GTGGCAGTGAGGGTGGATAGAGG + Intronic
1159200743 18:65180644-65180666 GAGTCAGTGGACTAGGAAAGGGG - Intergenic
1159675721 18:71282658-71282680 GAGGCAGAGATTTTGGAGAGTGG - Intergenic
1160895110 19:1398862-1398884 CAGGAAGTGACCTTGGATGGGGG - Exonic
1161481549 19:4513307-4513329 GGGGCAGTGAACTTGGCCAAAGG - Exonic
1161881938 19:6961085-6961107 AAGGCAGAGAACTTGAATACAGG + Intergenic
1163486245 19:17588226-17588248 GTGGCAGTGAGCTGAGATAGGGG + Intergenic
1167143712 19:47670011-47670033 GATGCTGTGAGCTAGGATAGTGG - Intronic
1167178497 19:47883128-47883150 GGGGCAGTCAACCTGGATACAGG + Intronic
1167648756 19:50718898-50718920 GACGCAGGGAGCTTGGACAGGGG + Intronic
926155181 2:10449378-10449400 GAGGCACTGCACTTGAATTGGGG + Intergenic
928164464 2:28959654-28959676 GAGGCAGTGAACCTGGGAGGCGG + Intronic
933717909 2:85375430-85375452 GAATCAGTGAACTTGAATATGGG - Intronic
935552941 2:104478059-104478081 GAGACAGTGATCTGGGATAAAGG + Intergenic
937732648 2:125252955-125252977 GTGTCAGTGAACTGGGAGAGGGG - Intergenic
937782500 2:125855001-125855023 GTGGCAGTGGACATGGAAAGTGG - Intergenic
940468306 2:154060708-154060730 GAAGCAGTAAACTTGGGTAGAGG + Intronic
941669880 2:168282160-168282182 GAGGCAAAGAAATGGGATAGTGG - Intergenic
946413126 2:219525675-219525697 GAGGCTTTGAACCTGGATACTGG + Intronic
948162113 2:235833449-235833471 GAGAGAGTGAACTTGAACAGGGG - Intronic
1168756556 20:322454-322476 CAGGCAGTGAACTTGGAACTGGG - Intergenic
1168873867 20:1156175-1156197 GAGTCAGTGAACTTGAAGATAGG + Intronic
1173839481 20:46148024-46148046 GAGGGAGTGGACATGGATGGTGG - Intergenic
1175785318 20:61708374-61708396 GAGGCAGCCAACGTGGAGAGTGG - Intronic
1176287904 21:5028577-5028599 GAGGCAGGGAGCTTGGGTGGGGG - Intronic
1179869277 21:44234898-44234920 GAGGCAGGGAGCTTGGGTGGGGG + Intronic
1180273430 22:10623351-10623373 GATGCAGTCAGCTTGGAGAGAGG + Intergenic
1182738402 22:32547669-32547691 GAGGCAGAGAAAGTGGAGAGAGG + Intronic
1183591292 22:38780670-38780692 GAGGCAGGGAACATGGGCAGGGG + Intronic
1185368050 22:50445947-50445969 GGGGCAGAGAACCTGGCTAGAGG - Exonic
949136671 3:575361-575383 GATGCAGTCAGCTTGGAGAGAGG - Intergenic
950028664 3:9837597-9837619 GAGGCAGTGAACCTGGGAGGTGG - Intronic
952221878 3:31331708-31331730 GAGACAGTGGACTTGGGGAGGGG + Intergenic
952480638 3:33758329-33758351 GAGGCAGGTAAATTAGATAGTGG + Intergenic
953055740 3:39385827-39385849 GAGGCACTGAACTTGGACATGGG + Intronic
953626530 3:44576860-44576882 GAGGCAGAGAACTTGGAAGGAGG - Intronic
958264587 3:91423092-91423114 GAGGCAGTGAGCTATGATCGTGG + Intergenic
958463739 3:94432122-94432144 GAGGCTGTGAACTTTTATTGGGG + Intergenic
962898571 3:139737313-139737335 GAGGAAATGAAGTTGGAGAGGGG + Intergenic
965336848 3:167437011-167437033 GAGTCAGTGAAGGTAGATAGGGG - Intergenic
965605157 3:170491318-170491340 GAGGAAGTAAACTTGCAAAGAGG + Intronic
968798426 4:2725491-2725513 GAGGCAGTGAAATGTGAGAGCGG + Intronic
971062270 4:22985645-22985667 CAGGCAGAGAACCTGTATAGAGG - Intergenic
971369774 4:26008362-26008384 GTGGCAGTGAGCTCAGATAGTGG - Intergenic
971409838 4:26358843-26358865 GACACAGTGAACTGGGATAATGG - Intronic
971890165 4:32509833-32509855 GAGTCAGGGAACTTGGAAAGAGG + Intergenic
972715999 4:41646711-41646733 GTGGCAGTGAATTTGGGTGGAGG - Exonic
975718418 4:77227686-77227708 CAGCCAGTGAAATTGGAGAGGGG - Intronic
975809035 4:78146219-78146241 GAGTGGGTGAACTTGTATAGGGG - Intronic
977796252 4:101168493-101168515 AAGGCAGTGAATGTAGATAGAGG + Intronic
979154429 4:117365233-117365255 GAGGCAGTCAACTTTGCTACTGG + Intergenic
980718656 4:136662505-136662527 GAATCAGTGAACTTGGAAAGAGG + Intergenic
982139746 4:152306014-152306036 GTGGGAGTGAACTTGGAAAGAGG - Intergenic
982525972 4:156478703-156478725 GAGGCAGTATAGTTAGATAGTGG + Intergenic
982898122 4:160960511-160960533 GTGGGAGTGAACATGGAGAGTGG - Intergenic
983756015 4:171337303-171337325 TAGGCAGCGAACATGGAAAGAGG - Intergenic
985416643 4:189742069-189742091 GAGCCAGTGAAATTGCAGAGGGG + Intergenic
989511101 5:42288586-42288608 GAGTCAGTGAACGGAGATAGGGG + Intergenic
990583650 5:57189179-57189201 GTTGCAGTGAACTGAGATAGTGG - Intronic
996329802 5:122315846-122315868 GAGGCAGGAAAATTGGAAAGGGG + Intronic
999395535 5:151224566-151224588 GCTGCAGTGAACTATGATAGCGG - Intronic
1000797374 5:165681749-165681771 GAGTCAGTGAACTTGAAGATAGG - Intergenic
1000820320 5:165974501-165974523 GAGGGAGAGAATTTGGTTAGTGG + Intergenic
1000971231 5:167717055-167717077 GAGGCTGAGCACTTGGATACAGG - Intronic
1001359576 5:171068111-171068133 GAATCAGTGAACTTGGAAACAGG - Intronic
1001700631 5:173704308-173704330 GGGGCAGACAACTGGGATAGTGG - Intergenic
1004204080 6:13574955-13574977 GAGGCAGTGGGCGTGGAGAGGGG + Intronic
1004873855 6:19935616-19935638 GAGGCAGAGAACTTAGATACTGG - Intergenic
1005794349 6:29342386-29342408 AAAGCAGAGGACTTGGATAGAGG + Intergenic
1006914688 6:37586562-37586584 GAGGGAGGGAGCTTGGATACAGG - Intergenic
1007381759 6:41494852-41494874 AAGGCAGTGAACTTTGGGAGGGG - Intergenic
1008458090 6:51735581-51735603 GAAGGAGAAAACTTGGATAGAGG + Intronic
1008990859 6:57599882-57599904 GAGGCAGTGAGCTATGATCGTGG - Intronic
1009179379 6:60498116-60498138 GAGGCAGTGAGCTATGATCGTGG - Intergenic
1009966492 6:70583915-70583937 GAGGAAATGTATTTGGATAGAGG + Intronic
1011217899 6:85024729-85024751 GATACAGTGGACTTGGATTGGGG + Intergenic
1011288908 6:85755003-85755025 GAGGCAGTTTATTTGCATAGAGG - Intergenic
1013727035 6:113111445-113111467 GAGGCAGTGAATTTGTAAAGAGG + Intergenic
1015836599 6:137426819-137426841 GAGAAACTGAACTTGGATAGTGG + Intergenic
1017125617 6:151061519-151061541 GAGTCTGAGAACTTGGATTGTGG - Intronic
1017551574 6:155515158-155515180 AAGTCAGTGAAATTGGAAAGAGG - Intergenic
1017648364 6:156559395-156559417 GAGGCAGTGATATTGGAGATGGG - Intergenic
1020156205 7:5726769-5726791 GAATCAGTGAACCTGGAAAGCGG + Intronic
1021279666 7:18702197-18702219 GATGCAGGGAAATTGGAGAGAGG - Intronic
1021402555 7:20226196-20226218 GCGTCAGTGAACATGGAAAGAGG - Intergenic
1022370999 7:29771243-29771265 GAGGCAGTGACCTTGCTGAGTGG - Intergenic
1024258918 7:47559664-47559686 GATGCTGTGAACTTTGATGGAGG - Intronic
1026209229 7:68288629-68288651 GAGGGACAGAACTTGGATTGAGG - Intergenic
1027224032 7:76232921-76232943 GAGGCAGTGGACCTGCATGGAGG + Intronic
1027264648 7:76487675-76487697 GAGGGTGTGGACTTGGAGAGGGG + Intronic
1027316020 7:76985777-76985799 GAGGGTGTGGACTTGGAGAGGGG + Intergenic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1032017443 7:128389038-128389060 GAGGCAGGGAACCTGGACAGAGG - Intergenic
1033254469 7:139788201-139788223 GGATCTGTGAACTTGGATAGGGG - Intronic
1034160125 7:148987744-148987766 GAGGCAGGGATCTTGGGCAGTGG - Intergenic
1036138036 8:6180363-6180385 AAGGCAGTGGAGTTGGATTGTGG - Intergenic
1038411272 8:27361603-27361625 CAGGGAGGGACCTTGGATAGGGG + Intronic
1038536888 8:28359921-28359943 GAGGCAGAGAACATGGTTTGTGG - Intronic
1039032364 8:33324274-33324296 GAGGTAGAGAACATGGATAATGG + Intergenic
1043943506 8:86224007-86224029 TAGGCATTGAGTTTGGATAGTGG + Intronic
1044745254 8:95364916-95364938 GAGGCAGGGAAGATGGATGGTGG + Intergenic
1047348798 8:124053932-124053954 GGGGCAGCTAACTTGGATAGAGG - Intronic
1047698187 8:127424340-127424362 TAGGAATTGAACTTGGTTAGTGG - Intergenic
1048030861 8:130630592-130630614 GAGGAAGTGATCTTGGATCTAGG - Intergenic
1048197360 8:132343033-132343055 GATTCAGTGTACTTGGACAGAGG - Intronic
1048411512 8:134179099-134179121 GAGTCAGTGAACTTGAAGATAGG - Intergenic
1048417767 8:134245661-134245683 GAGGCCGGGAACTTAGATAAGGG - Intergenic
1049168624 8:141143464-141143486 GATGCAGTGAGCTATGATAGCGG - Intronic
1050442048 9:5675012-5675034 AAGGCAGTGTACTTCTATAGAGG + Intronic
1051178812 9:14388696-14388718 GAGGCAGTGGGATTTGATAGTGG + Intronic
1060597123 9:124855360-124855382 GAGGCAGTGAACCTAGGCAGCGG + Intronic
1062131792 9:134899502-134899524 GAGCCAGTGAACTTGAAGACAGG + Intergenic
1203620614 Un_KI270749v1:125042-125064 GATGCAGTCAGCTTGGAGAGAGG + Intergenic
1187466267 X:19530503-19530525 GAGGAAGTGAATCTGGAAAGAGG - Intergenic
1188179140 X:27032503-27032525 CAGACAGTGAACATGGATGGAGG - Intergenic
1188545611 X:31302596-31302618 GAACCAGTGAACTTGAATATAGG + Intronic
1188715561 X:33455989-33456011 GAGCCTGTGGACTTGGGTAGGGG + Intergenic
1188725687 X:33578829-33578851 AAGGCATTGAAAGTGGATAGAGG - Intergenic
1190515960 X:51223743-51223765 GAGGCAGTGAAATTGCAGTGAGG + Intergenic
1190760896 X:53437445-53437467 GAGCCCATGGACTTGGATAGAGG - Intergenic
1191693325 X:63963294-63963316 GAGTCAGTGAACTGTGATAATGG - Intergenic
1192853211 X:74980047-74980069 GAGACAGTGAACTTGGGTGGGGG + Intergenic
1194693001 X:97009963-97009985 GAGTCAGTGGACTTGGTTGGGGG - Intronic
1194749336 X:97666993-97667015 GTGGCAGGCAATTTGGATAGTGG + Intergenic
1196624763 X:117865598-117865620 GAGGCAGTGGAGTTAGATAAGGG + Intergenic
1196632396 X:117957161-117957183 GAGGCAGTGAGAGTGGATGGGGG - Intronic
1198190640 X:134300844-134300866 GAGACAGTGAACTTGAAGACAGG + Intergenic
1199912365 X:152300790-152300812 GAGTCAGTGAACTTGAAGGGAGG + Intronic