ID: 901184934

View in Genome Browser
Species Human (GRCh38)
Location 1:7366856-7366878
Sequence CTGATACAGCTCATCTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901184931_901184934 8 Left 901184931 1:7366825-7366847 CCTGGAATGGACAAGGGGGAGCA 0: 1
1: 0
2: 0
3: 21
4: 190
Right 901184934 1:7366856-7366878 CTGATACAGCTCATCTGTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 117
901184926_901184934 13 Left 901184926 1:7366820-7366842 CCCTCCCTGGAATGGACAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 237
Right 901184934 1:7366856-7366878 CTGATACAGCTCATCTGTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 117
901184928_901184934 12 Left 901184928 1:7366821-7366843 CCTCCCTGGAATGGACAAGGGGG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 901184934 1:7366856-7366878 CTGATACAGCTCATCTGTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 117
901184930_901184934 9 Left 901184930 1:7366824-7366846 CCCTGGAATGGACAAGGGGGAGC 0: 1
1: 0
2: 2
3: 19
4: 180
Right 901184934 1:7366856-7366878 CTGATACAGCTCATCTGTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901184934 Original CRISPR CTGATACAGCTCATCTGTCT GGG Intronic
901095984 1:6680334-6680356 CAGATACAGAGCTTCTGTCTGGG - Intronic
901184934 1:7366856-7366878 CTGATACAGCTCATCTGTCTGGG + Intronic
907187454 1:52620860-52620882 CTGATTCAGCTAGTCTGACTGGG - Intergenic
907443262 1:54491111-54491133 CTGACACAGATTTTCTGTCTTGG + Intergenic
908399302 1:63755444-63755466 CTCGTACAGCACAGCTGTCTAGG - Intergenic
908462545 1:64359463-64359485 AAAATACAGGTCATCTGTCTGGG - Intergenic
916080801 1:161230881-161230903 CTGATCAATCTCATCTCTCTGGG + Exonic
917034877 1:170737457-170737479 CTGATACATCTGATCTATCATGG + Exonic
917586987 1:176437250-176437272 CTTATACACCTCATGTGGCTTGG + Intergenic
920746010 1:208629294-208629316 CTGAACCAGCTGATCAGTCTTGG + Intergenic
920873233 1:209811548-209811570 CTGATGCAGCTCTGCTGTCATGG - Intergenic
922609622 1:226915735-226915757 CTGTTCCAGTTCATCTGTTTAGG + Intronic
924589936 1:245394134-245394156 CAGTTACTGCTCACCTGTCTTGG + Intronic
1063572359 10:7227984-7228006 CTGATTTTGCTCATCTGTCTGGG - Intronic
1067841264 10:49681183-49681205 CTGATTCAGCACCTCTGTCTAGG - Intronic
1068904563 10:62308550-62308572 TTGATACCGTTCATCTGTTTAGG - Intergenic
1069186849 10:65434010-65434032 CTGATACAGCTTATCAGTCTTGG + Intergenic
1074768905 10:116720590-116720612 TTGAAACAGCTGATCTGTCAGGG - Intronic
1079874836 11:25843794-25843816 ATGAGACAGCTCATGTGTGTAGG - Intergenic
1080225930 11:29960108-29960130 CTGAAACAACTCATCTTTCTTGG - Intergenic
1082501827 11:53690430-53690452 CTGAGAATGCTTATCTGTCTAGG - Intergenic
1082520207 11:53956565-53956587 CTGAGAATGCTTATCTGTCTAGG - Intergenic
1082520334 11:53958269-53958291 CTGAGAATGCTTATCTGTCTAGG - Intergenic
1082531573 11:54120821-54120843 CTGAGAATGCTTATCTGTCTAGG - Intergenic
1082537299 11:54204135-54204157 CTGAGAATGCTTATCTGTCTAGG - Intergenic
1082544306 11:54305489-54305511 CTGAGAATGCTTATCTGTCTAGG - Intergenic
1082546715 11:54340347-54340369 CTGAGAATGCTTATCTGTCTAGG - Intergenic
1082809832 11:57473138-57473160 CTTACAGAGCTCATCAGTCTAGG - Intronic
1087719937 11:101651410-101651432 CTGATAAAGCCCATGTGTTTTGG + Intronic
1092262685 12:6960943-6960965 ATGGTACAGCTCTTCTGCCTGGG + Exonic
1096760949 12:53841565-53841587 CAGATGGAACTCATCTGTCTAGG - Intergenic
1100160903 12:91859547-91859569 CTGAGACAGCTCAGATGACTGGG + Intergenic
1102192352 12:110998295-110998317 CTGTTGCAACTCCTCTGTCTTGG + Intergenic
1102409318 12:112703655-112703677 CTGATTCAGCTCCTCTGTGGAGG - Intronic
1106724998 13:32475234-32475256 CTGAAACAGCTCCGTTGTCTGGG + Intronic
1107019271 13:35735043-35735065 CAGATGCAAGTCATCTGTCTTGG - Intergenic
1109440912 13:62371994-62372016 CTTATTTACCTCATCTGTCTAGG - Intergenic
1110164971 13:72430808-72430830 CTGATATATCTCAAGTGTCTAGG - Intergenic
1115282901 14:31684831-31684853 CTGAGACACCTCTTCTGTCATGG + Intronic
1119138553 14:72243797-72243819 CTGATTCAGCTATTCAGTCTGGG + Intronic
1119844957 14:77822330-77822352 CTGACACAGCTGCTATGTCTGGG - Intronic
1120529201 14:85611565-85611587 CTCAGACAGCTGACCTGTCTTGG + Intronic
1121920672 14:97878049-97878071 TTGAAACAGCTCATCTATATAGG - Intergenic
1127107149 15:55628544-55628566 CTGATGTGGCTCCTCTGTCTTGG + Intronic
1128487192 15:68105083-68105105 TTGTTACAGCTCAGCTCTCTTGG - Intronic
1130612629 15:85375350-85375372 CTGATACAGAGCCTCTATCTAGG - Intergenic
1131459739 15:92609704-92609726 CTGAGGCTGCTCATCTGTCCTGG - Intergenic
1133564463 16:6980244-6980266 CTGACACAGCACATTTGTATAGG - Intronic
1135635927 16:24075532-24075554 CTGATTCAGTTCCTCTGTTTGGG + Intronic
1139530448 16:67540048-67540070 CTCATACAGCTCATCGATCTGGG - Exonic
1142264046 16:89055446-89055468 CTGACTCAGCCCATCTGTCGGGG - Intergenic
1146621588 17:34402581-34402603 CTGATGCCACTCTTCTGTCTTGG + Intergenic
1148869961 17:50652031-50652053 CTTTTGCAGCTCATCTGACTTGG - Intronic
1155211944 18:23609519-23609541 CTGATACATCGGTTCTGTCTAGG + Intronic
1156361798 18:36390188-36390210 TGGACCCAGCTCATCTGTCTAGG - Intronic
1157984796 18:52424763-52424785 CTGATACAGATTATCTGCATGGG + Intronic
1158089416 18:53693379-53693401 CTCAAATAGCTCAACTGTCTTGG - Intergenic
1159521474 18:69530533-69530555 TTGATACTTCTCATCTTTCTTGG - Intronic
1159521475 18:69530562-69530584 TTGATACTTCTCATCTTTCTTGG - Intronic
1161809212 19:6462021-6462043 CTGTTCCAGCACACCTGTCTAGG - Intronic
1162324484 19:9990989-9991011 CTCATGCAGTTCATCTGCCTTGG - Intronic
1163791429 19:19308617-19308639 CTGATGCAGCTCAGGTGTCTCGG + Intronic
1166273644 19:41735144-41735166 CTGATAATGCTTATCTTTCTAGG - Intronic
925776855 2:7344232-7344254 CTGATTCTCCTCATCTCTCTGGG - Intergenic
925777607 2:7350035-7350057 CTGATTCTCCTCATCTCTCTGGG + Intergenic
926245592 2:11120652-11120674 TTGAGACAGCTTGTCTGTCTCGG - Intergenic
930171325 2:48254729-48254751 CAGATGCAGCTCCTCAGTCTTGG - Intergenic
932148046 2:69341781-69341803 ATGATGCAGGCCATCTGTCTAGG + Intronic
932230942 2:70083859-70083881 CTTCTACAACTCATCTGTCAGGG - Intergenic
933290458 2:80432745-80432767 GTGATAGAGCTCATGTGTCTTGG - Intronic
937226805 2:120374980-120375002 TTGAGACAGCCCATCTCTCTTGG - Intergenic
937792893 2:125981234-125981256 CTGATATAGATTACCTGTCTTGG - Intergenic
938336108 2:130499545-130499567 CTATTACAGCATATCTGTCTAGG - Intronic
938353714 2:130621120-130621142 CTATTACAGCATATCTGTCTAGG + Intronic
942395104 2:175538857-175538879 CTGCTGTAGCACATCTGTCTTGG + Intergenic
942471671 2:176267387-176267409 CTGGAACAGCTCATTTCTCTTGG + Intergenic
943116648 2:183680491-183680513 TTGATACTGCTCATCAGTTTTGG - Intergenic
943399819 2:187393797-187393819 CTGATTCAGGTCATCTTGCTTGG + Intronic
946037260 2:216754147-216754169 CTGATACCTCTCAGCTGACTGGG + Intergenic
948083309 2:235225520-235225542 CTGATTCAGCCCAGCTGTGTCGG + Intergenic
948869113 2:240789462-240789484 CAGAGACAGCTCATCTGCCTGGG - Intronic
1169301342 20:4444241-4444263 CTGTTTCAGCCCATCTCTCTGGG - Intergenic
1172515037 20:35527533-35527555 ATGAGGCAGCTCATGTGTCTGGG + Intronic
1173643931 20:44622067-44622089 CTGATACTGCTCCTGTGGCTTGG + Intronic
1174409331 20:50323379-50323401 CAGTAACAGCTCATCTGTGTTGG + Intergenic
1175558048 20:59887973-59887995 CAGAAACAGATCATCTGACTAGG + Intronic
1179724308 21:43333261-43333283 CGCAAACAGCTCATCTGGCTGGG - Intergenic
1184320500 22:43739016-43739038 CTGAGACAGCTCATCTTCATGGG - Intronic
1185227770 22:49662893-49662915 CAGACACAGCTCATCTATCACGG + Intergenic
950437191 3:12987049-12987071 CTGAGGGAGCTCATCTGTGTGGG - Intronic
952234498 3:31464696-31464718 TTGACACAGCTCCTCTGTGTGGG + Intergenic
953707129 3:45239781-45239803 CTGATTCAGCACATCTGGGTGGG + Intergenic
954093936 3:48307757-48307779 CAGCTAGAACTCATCTGTCTGGG - Intronic
955981518 3:64532046-64532068 CCGATTCAGCTCATCTGTGTGGG + Intronic
965397539 3:168177530-168177552 CTTATAAAACTCATCTTTCTTGG + Intergenic
965671947 3:171156720-171156742 CAGATACTGCTTATCTGTGTGGG - Intronic
966666885 3:182481382-182481404 CTGCTAAAGCTCATCTGACTGGG - Intergenic
967534451 3:190586407-190586429 CTGAGACACCTCTTCTGTCTGGG - Intronic
969169311 4:5347163-5347185 CAAATGCAGCTCATTTGTCTTGG + Intronic
971395571 4:26224132-26224154 CTGACACAGAACATCTATCTTGG + Intronic
972218849 4:36929813-36929835 CTGAGACAGCTCACCTGGCTTGG - Intergenic
974123699 4:57669708-57669730 GTCATACAGCTCACCTGTATGGG - Intergenic
981205743 4:142037754-142037776 CTGATACAATTCAACAGTCTAGG - Intronic
983826691 4:172270463-172270485 CAGGTACACCTCATCTATCTTGG + Intronic
987639461 5:20594210-20594232 CTAATACAGCACATATGTATGGG - Intergenic
987841343 5:23225935-23225957 CTGATACAGCTCTGATGACTGGG - Intergenic
991815860 5:70509805-70509827 CTGCTACAGCTCCCGTGTCTGGG + Intergenic
994732712 5:103512428-103512450 CTTACACAGCTCAGCTTTCTGGG + Intergenic
998224558 5:140316540-140316562 CTGAAAGAGCTGATATGTCTGGG - Intergenic
1003017642 6:2480954-2480976 CTCATTCAGCTCATCTAACTAGG + Intergenic
1004501492 6:16214004-16214026 CAGATACAGCTGATCTATCAAGG + Intergenic
1006289577 6:33124369-33124391 ATGAAACAGCTCCACTGTCTAGG + Intergenic
1006407806 6:33855404-33855426 CTGACACAGCCCACCAGTCTAGG + Intergenic
1006548885 6:34803835-34803857 CTGCTTCTGGTCATCTGTCTCGG + Intronic
1013942437 6:115680843-115680865 CTCATACAGCTCCTCTCTCATGG - Intergenic
1014826646 6:126054674-126054696 CTTCAACAGCTCATTTGTCTTGG - Intergenic
1017185903 6:151600212-151600234 CTGATACCGGTAATCTGTCTTGG - Intronic
1022946303 7:35288082-35288104 CAATTACAACTCATCTGTCTGGG - Intergenic
1026870917 7:73850943-73850965 CTGATACAGCTCCCCTTTCCTGG + Intergenic
1028125741 7:87110896-87110918 CTGATACAGAGCATCCCTCTTGG - Intergenic
1031955773 7:127940745-127940767 CAGATCCAGCCCATCTGACTGGG - Intronic
1032705707 7:134419757-134419779 CTGATACTGGTCATCTATTTGGG - Intergenic
1034270588 7:149801856-149801878 CTGCCACAGCTCAGCTGGCTCGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1047673976 8:127180260-127180282 CTGAAACAGCTCAGGTGTCTAGG - Intergenic
1055526489 9:77138861-77138883 CTGAAACATCTCATCTGATTGGG - Intergenic
1056140577 9:83674742-83674764 CTGATACTGCTCAATTGTATGGG + Intronic
1058068859 9:100581306-100581328 TTGATTCAGCTGATCTGGCTGGG - Intronic
1061359150 9:130130093-130130115 CTGACACAGCTTCTCTCTCTGGG + Intronic
1186047034 X:5547851-5547873 CTGATACAGATGAACTCTCTTGG - Intergenic
1186841367 X:13487782-13487804 CTGAAACAGCTCTTCTGTTGGGG + Intergenic
1187942721 X:24397829-24397851 CTGATGCTTGTCATCTGTCTCGG + Intergenic
1202080017 Y:21074628-21074650 CTGATACAACTCTACTGTCTGGG + Intergenic