ID: 901185289

View in Genome Browser
Species Human (GRCh38)
Location 1:7368958-7368980
Sequence AAACAGAAGCAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1976
Summary {0: 1, 1: 0, 2: 21, 3: 217, 4: 1737}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901185289_901185294 20 Left 901185289 1:7368958-7368980 CCTTCCTCCTTCTGCTTCTGTTT 0: 1
1: 0
2: 21
3: 217
4: 1737
Right 901185294 1:7369001-7369023 GACATGTTGCCCAAGACTAGAGG 0: 1
1: 0
2: 0
3: 6
4: 180
901185289_901185295 21 Left 901185289 1:7368958-7368980 CCTTCCTCCTTCTGCTTCTGTTT 0: 1
1: 0
2: 21
3: 217
4: 1737
Right 901185295 1:7369002-7369024 ACATGTTGCCCAAGACTAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 102
901185289_901185296 22 Left 901185289 1:7368958-7368980 CCTTCCTCCTTCTGCTTCTGTTT 0: 1
1: 0
2: 21
3: 217
4: 1737
Right 901185296 1:7369003-7369025 CATGTTGCCCAAGACTAGAGGGG 0: 1
1: 0
2: 0
3: 14
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901185289 Original CRISPR AAACAGAAGCAGAAGGAGGA AGG (reversed) Intronic
900007579 1:73168-73190 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
900020918 1:186316-186338 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900304127 1:1994900-1994922 AAAGAGAAGCGGGAGGTGGAGGG + Intronic
900545746 1:3228215-3228237 AAAGAGAAGCAAACCGAGGATGG + Intronic
900547125 1:3235434-3235456 TTCCGGAAGCAGAAGGAGGAAGG + Intronic
900851047 1:5143344-5143366 TAAGAGAAGCAGGAGGAGGGAGG + Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901179551 1:7331845-7331867 AAGCAGAATAAGAAGGACGAGGG - Intronic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901472685 1:9468522-9468544 AGACAGAATCAGAACGAAGATGG + Intergenic
901631374 1:10649790-10649812 AAAGAAGCGCAGAAGGAGGAGGG + Intronic
901679763 1:10906235-10906257 AAACCAAGGCAGAAGGAGGTGGG + Intergenic
901851772 1:12020250-12020272 AAAAAGAAAGTGAAGGAGGAAGG + Intronic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
902729988 1:18362931-18362953 AAACAGAGGCAGAAGTGGGGAGG - Intronic
902762284 1:18590028-18590050 CACCAGGAGGAGAAGGAGGAGGG - Intergenic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
902818834 1:18931250-18931272 AGACAGAAGCAGTGGGAGGAGGG - Intronic
902989568 1:20177161-20177183 AAACAGAAGCAAGAGGACGTTGG + Intronic
903219578 1:21861724-21861746 AAACAGAAGTAGGGGGAGGGTGG - Intronic
903279649 1:22243428-22243450 AAAAAAAAGAAGAAGAAGGAAGG + Intergenic
903361747 1:22781332-22781354 AAAAAGAAGAAGAAGGATGAGGG + Intronic
903545312 1:24120306-24120328 GAAAAGAACCAGAAGGAGGCTGG - Exonic
903548223 1:24140559-24140581 TAACAGAAGCAGAAGTGGGCTGG - Intronic
903570107 1:24297931-24297953 AAGCAGGAGGAGGAGGAGGAGGG + Intergenic
903995667 1:27304064-27304086 AGACAGAGGGAGAAGGAGGTGGG - Intronic
904130027 1:28268672-28268694 AAAAAGAAGCAAAAGAAGGAAGG + Intronic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904357045 1:29947022-29947044 AAAGAGAAGGAGGAGGAGGTTGG - Intergenic
904360565 1:29968714-29968736 AAGCAGAGGCAGCAGGAGGTGGG + Intergenic
904586228 1:31582404-31582426 AACCAGAACTTGAAGGAGGAGGG + Intronic
904645603 1:31963827-31963849 AAACAAAAGAAGAAGAAGGAAGG - Intergenic
904660938 1:32084294-32084316 AGACTGCAGCAGGAGGAGGAAGG - Intronic
904849779 1:33448592-33448614 AAAAAGAAGTAGAAGAAGGCAGG + Intergenic
905121934 1:35688989-35689011 AAAGAGAAAGAGAAGGGGGATGG + Intergenic
905170974 1:36109327-36109349 AGACAGAGCCAGAAGGAGGAGGG - Intronic
905229810 1:36508013-36508035 AAACAGGAGCAGAATGATGTAGG - Intergenic
905251383 1:36650932-36650954 AGGCAGAGGCAGAAGGAGGTTGG + Intergenic
905280515 1:36846220-36846242 AAACAGCAGCAGCAGGAGACTGG - Intronic
905479099 1:38248967-38248989 AAACAGAAACAAAATGGGGAGGG - Intergenic
905521321 1:38602862-38602884 AAACAGGAGCAGAAACAGAAAGG + Intergenic
905605349 1:39293657-39293679 TAACAGCAGCAGAAGGAGACAGG + Intronic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
905816265 1:40953369-40953391 AAAAAGAAGAAGAAGAAGAAAGG - Intergenic
905980541 1:42221959-42221981 AAAAAAAAGAAGAAGGGGGAGGG + Intronic
906013955 1:42556223-42556245 AGAGAGGGGCAGAAGGAGGAGGG + Exonic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906126306 1:43428985-43429007 AAACAGAAGAACTAGAAGGATGG + Intronic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906192113 1:43905280-43905302 GAAGAGGAGCAGAAGGAGGCAGG - Intronic
906192134 1:43905352-43905374 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192145 1:43905391-43905413 GAAGAGGAGCAGAAGGGGGAGGG - Intronic
906192313 1:43906003-43906025 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192456 1:43906509-43906531 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
906192485 1:43906638-43906660 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
906511773 1:46414087-46414109 GGAAAGAAGCAGAAGAAGGAAGG - Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906633973 1:47395965-47395987 AAAAAAAAGCAAATGGAGGAGGG - Intergenic
906668095 1:47635818-47635840 GAAGAGAAGGAGGAGGAGGATGG - Intergenic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
907295845 1:53453552-53453574 AAAAAAAAGAAGAAGAAGGAAGG + Intergenic
907687460 1:56626036-56626058 ATAAAGAAGCAGAAGGACAAAGG + Intronic
907825692 1:58014872-58014894 AAACAAAAGAAGAAGAAAGAGGG + Intronic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
907920756 1:58909495-58909517 AAAGGGAAGAAGAAGGATGATGG + Intergenic
908035443 1:60046429-60046451 AAAAAAAAGAAGAAGAAGGAAGG - Intronic
908125875 1:61029829-61029851 AAAAAGAAGAAGAAGAAGTATGG + Intronic
908170602 1:61500915-61500937 GATCAGAAGCAGAAGTTGGAGGG - Intergenic
908353157 1:63306225-63306247 AATAAGGAGGAGAAGGAGGAAGG + Intergenic
908411243 1:63867844-63867866 AAAGAGAAGCAGATCAAGGAAGG - Intronic
908418437 1:63935729-63935751 AAACAGCAGCTGGAGCAGGAAGG + Intronic
908481262 1:64541821-64541843 AAACAAAAACAGAATGAGGTGGG + Intronic
908528262 1:65008664-65008686 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909461993 1:75927446-75927468 AAACAGTAGCAGTGGGAGAAAGG - Intronic
909772629 1:79442742-79442764 ACACAGACGCAGAGGGAAGATGG + Intergenic
910038810 1:82822454-82822476 AAACAGAAGCAAAGGGAAGGGGG - Intergenic
910162140 1:84284799-84284821 AGAAAGAAGAAGAAGAAGGAGGG + Intergenic
910165036 1:84318258-84318280 AAACAGAAGCAGTATTAAGAGGG - Intronic
910272045 1:85407019-85407041 AAACAAAAACTCAAGGAGGAAGG - Intronic
910392930 1:86763000-86763022 AAACAGGAGGAGAAAGAGAAAGG - Intergenic
910474834 1:87595651-87595673 AAAAAGAAAGAGAAAGAGGAGGG - Intergenic
910564504 1:88628119-88628141 AAAAAGAAGAAGAAAAAGGAAGG + Intergenic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
911094381 1:94043999-94044021 AAAGGGAAGGGGAAGGAGGAAGG - Intronic
911122740 1:94312327-94312349 AAAATGAAGAAGAAGGAGGAAGG - Intergenic
911133442 1:94414729-94414751 AGACCGAAGCAGATTGAGGAAGG - Intergenic
911360177 1:96866063-96866085 AAACATATACAGAAGGAAGATGG - Intergenic
911371235 1:96997155-96997177 CAAAAGTAGCAGAAGGAGAAAGG - Intergenic
911436457 1:97865531-97865553 AATCAGAGGGTGAAGGAGGATGG - Intronic
911474325 1:98357576-98357598 GAAAAGAAGAAGAAGGAGAAGGG - Intergenic
911553426 1:99312731-99312753 AAGCAGAAGTAGGAGTAGGAGGG + Intergenic
911791799 1:102026539-102026561 AAAAAGAAGCAGCACCAGGATGG - Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911958548 1:104269371-104269393 TAACAGAAGAAAAAGGAGCAGGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912259143 1:108092051-108092073 AAAGAGGAGGAGAAGGAGGAAGG - Intergenic
912538414 1:110394055-110394077 CAACAAAGGCAAAAGGAGGATGG - Intergenic
912658615 1:111509107-111509129 AAACAAAAGCAGCACCAGGATGG + Intronic
913252924 1:116927085-116927107 AAACAGAAGCAGAAAGAGCAAGG + Intronic
913303133 1:117394567-117394589 AAACAGAAGAAGAAAGTGAATGG - Intronic
913318754 1:117574377-117574399 AAGCTGCAGGAGAAGGAGGATGG - Intergenic
913466407 1:119147791-119147813 AAACAGAAGGGGAAGCAGAACGG - Intergenic
913653960 1:120943993-120944015 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914388796 1:147199157-147199179 GAACAGAAGAAGAAGGAAAATGG + Intronic
914644153 1:149638161-149638183 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
914676532 1:149910768-149910790 GCACAGAAGAAGAGGGAGGAGGG + Intronic
914687064 1:149989743-149989765 AAAAAGAAGAAGAAGAAGGTGGG + Intronic
914805908 1:150991529-150991551 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
914857275 1:151361980-151362002 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
914956322 1:152165886-152165908 AAACAGAAACAGGAAGTGGAGGG - Intergenic
914960099 1:152197470-152197492 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915132820 1:153707701-153707723 AAAAAGAGACAGAAAGAGGAAGG + Intergenic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915468540 1:156112557-156112579 CACCAGAAGCAGAGGCAGGAGGG - Intronic
915496297 1:156285015-156285037 ACACTGAAACAGAGGGAGGAGGG - Intronic
915527585 1:156485508-156485530 AAAAAAAAGAAGAAGGAGAAGGG - Intronic
915579733 1:156806210-156806232 AGACAGAAACAGAAGGAGCCTGG + Intergenic
916047703 1:161013143-161013165 AAAAAGAAGAAAGAGGAGGAGGG + Intronic
916259738 1:162829600-162829622 AAAAAAAAGAAGAAGAAGGAAGG - Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916412385 1:164559184-164559206 AAACAAAAGCAGGAGGCTGACGG + Intronic
916588090 1:166165825-166165847 AAACAAAAGCGTAGGGAGGAGGG + Intronic
916616257 1:166444168-166444190 AGAGAGAAGGAGAAGGAGAAAGG + Intergenic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
916664166 1:166950399-166950421 AAAGAGAAGGAGAAGGAGAGAGG + Intronic
916666503 1:166972691-166972713 AAAGAGAAACAGGAGGAGAAGGG + Intronic
916852551 1:168718472-168718494 AAACCAAAGCCGGAGGAGGAGGG - Intronic
917028093 1:170663754-170663776 AAACAGAAGAAGAGAGAAGAAGG - Intronic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
918015349 1:180628328-180628350 CAACAGAGGGAGAAGGAAGAAGG - Intergenic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918128553 1:181605291-181605313 AGACAGAAGCAGAAGAAAAAGGG + Intronic
918179498 1:182074124-182074146 AAAAAGAAGAAGGAGGAGGAGGG + Intergenic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
918621907 1:186614909-186614931 AAAAAGAAACAGGAGGTGGAAGG + Intergenic
918712885 1:187753110-187753132 TAACGGAAGAAGAAAGAGGAGGG - Intergenic
918933116 1:190882797-190882819 AAAAAGAAGTAGAAAGAGCAAGG - Intergenic
919003043 1:191859620-191859642 AAACAGAAGGAGAGAGAGGAAGG - Intergenic
919016764 1:192048504-192048526 AAAAAGAAGGAGAAGGAGAAGGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919057245 1:192586389-192586411 CCACAGGAGCAGAAGGAGAAGGG - Intergenic
919176734 1:194028458-194028480 AAAAAGGAGGAGGAGGAGGAGGG - Intergenic
919178223 1:194047278-194047300 AAACAGAAACAGGAGGGGTAAGG + Intergenic
919354067 1:196499063-196499085 ACACATATGCAGAAGGAAGATGG + Intronic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919563384 1:199152865-199152887 AGAAAGGAGGAGAAGGAGGAAGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919944784 1:202311112-202311134 GAACACAAGCAGAATTAGGAGGG + Intronic
919973485 1:202595680-202595702 AAACAGAAGCAAAAGCACAATGG + Exonic
920106811 1:203559213-203559235 ATATAGAAGTAGAAGAAGGAGGG + Intergenic
920164599 1:204026604-204026626 AGACAAAGGCAGAGGGAGGAAGG + Intergenic
920606703 1:207396033-207396055 AGCCAGAGGCAGAAGGAAGATGG + Intergenic
920850482 1:209624963-209624985 AAAAAGAAGGAAAAGAAGGAAGG + Intronic
920969850 1:210733808-210733830 ACACAGAAGGACAAGGAGAAGGG + Intronic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921394485 1:214654077-214654099 AAACAGCAGCAGGAGGAGGAGGG - Intronic
921543100 1:216442693-216442715 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
921717585 1:218434143-218434165 AAACAAGAGCAGAAGGCGAATGG + Exonic
921718401 1:218443350-218443372 AAAGAGCAGCATAAGGAGGCGGG + Exonic
921734794 1:218614574-218614596 CAAAAGCAGCAGAAGGAGGTGGG - Intergenic
921866100 1:220089118-220089140 AAAAAAAAGAAGGAGGAGGAAGG + Intronic
921945406 1:220882766-220882788 AAGCAGCAGGAGGAGGAGGAAGG - Intronic
922084026 1:222328242-222328264 TTACAGAAGCCAAAGGAGGAGGG - Intergenic
922098638 1:222463921-222463943 AAAGAGCAGAATAAGGAGGATGG + Intergenic
922359604 1:224809442-224809464 AAACAGGACCTAAAGGAGGAGGG + Intergenic
922561294 1:226571627-226571649 AAAAAGAAGAAGAAGAAGAAGGG - Intronic
922572541 1:226642596-226642618 AACCAGCAGAAGAAGGAAGACGG + Intronic
922592840 1:226791522-226791544 AAAAAGAAGAAGAAGAAGAAGGG - Intergenic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922698562 1:227744585-227744607 ACACAGAAGGATGAGGAGGAAGG - Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923123113 1:231012507-231012529 AGAAAGAAGCAGAGGGAGGCTGG - Intergenic
923458247 1:234185126-234185148 AAATACTTGCAGAAGGAGGAGGG + Intronic
923462590 1:234219992-234220014 GATCAGAAGAAGCAGGAGGAGGG + Intronic
923504241 1:234591766-234591788 ATATAGAAACAGAAGGAGGCTGG - Intergenic
923670302 1:236034801-236034823 AAACAAAAACTGAAGGAAGAGGG + Intronic
924015386 1:239715635-239715657 AAACAGATAAAGAGGGAGGAAGG + Intronic
924056340 1:240127815-240127837 GCACAGAAGTAGAAGCAGGAAGG + Intronic
924061377 1:240178430-240178452 AAAAAGAAGAAGAAGAAGAAGGG - Intronic
924082697 1:240415940-240415962 GAATAGAAGCTGAAGGAGGCTGG - Intronic
924442395 1:244096968-244096990 CAACAGTGGCACAAGGAGGAGGG + Intergenic
924557454 1:245130071-245130093 AAAGAGAAGCAGAAAGAAAATGG + Intergenic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924680363 1:246224879-246224901 AAACAGAAGCAGAAAAAGGAAGG + Intronic
924680571 1:246227631-246227653 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063181164 10:3601696-3601718 ACACAGAAATAGAATGAGGAAGG + Intergenic
1063228446 10:4039682-4039704 AATAAGAAGAAGAAAGAGGAGGG - Intergenic
1063287009 10:4700606-4700628 AACCAGAAGCATAAGCAGTATGG + Intergenic
1063346977 10:5320691-5320713 AAAAAGAAGAAGAAGAAGCAAGG + Intergenic
1063534224 10:6867065-6867087 AAAGAGAAAGAGAAGGAGGGAGG - Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063674166 10:8125130-8125152 CAACAGAAACAAAGGGAGGAGGG + Intergenic
1063717739 10:8545289-8545311 AAAAAGAATAAGAAGAAGGAAGG - Intergenic
1063921837 10:10941162-10941184 AAACAAGAGCAGAAGGAGCTTGG + Intergenic
1063923110 10:10951143-10951165 AAAGAAAAGAAAAAGGAGGATGG - Intergenic
1064312879 10:14227215-14227237 GAAGAGAAGGAGGAGGAGGAAGG - Intronic
1064852734 10:19728145-19728167 AAACAAAAGTTGAAGTAGGAAGG + Intronic
1065050373 10:21785800-21785822 AAAAAGATGGAAAAGGAGGAGGG + Intronic
1065050534 10:21787337-21787359 AAAAAGGAGGAGGAGGAGGAAGG + Intronic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065819548 10:29512800-29512822 AAACAGACTCAGCAGGAGGCAGG - Exonic
1065830959 10:29613184-29613206 AAAAAAAAGAAGAAGGAGGAGGG + Intronic
1065953307 10:30671605-30671627 AAACAGACTCAGCAGGAGGCAGG + Intergenic
1066072432 10:31833341-31833363 AAAAAAAAGCAGAGGCAGGAAGG + Intronic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1067128149 10:43537792-43537814 AAAGAAAAGAAGAAGAAGGAAGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067241023 10:44493694-44493716 AAAAAGAAAGAGAAGGATGAAGG - Intergenic
1067513826 10:46919468-46919490 AAAAAGAAGGAGAAGAAGCATGG - Intronic
1067558168 10:47286651-47286673 GAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1067572131 10:47379435-47379457 AATAAGAAGGAGCAGGAGGATGG + Intronic
1067648428 10:48132366-48132388 AAAAAGAAGGAGAAGAAGCATGG + Intergenic
1067748786 10:48956513-48956535 AGCAAGAAGCAGAGGGAGGAGGG - Intronic
1067902326 10:50255232-50255254 AGAAAGAAGAAGAAGTAGGAAGG + Intergenic
1067908152 10:50315934-50315956 AAAAAAGAGCAGAAGGAAGAGGG + Intronic
1068174006 10:53433494-53433516 AGAAGGAAGAAGAAGGAGGAAGG + Intergenic
1068395726 10:56458727-56458749 AAAAAGAAGAAGTAGGAGGAGGG + Intergenic
1068803751 10:61171660-61171682 AAACTGAAGAAAAATGAGGAGGG + Intergenic
1068803862 10:61172721-61172743 AAAGAGAAAGAGAAAGAGGAAGG + Intergenic
1069067554 10:63959509-63959531 ATACAGATTCAGAAGGGGGAGGG + Intergenic
1069444291 10:68458550-68458572 AAAAAGAAGAAGAAAGAGGCTGG + Intronic
1069455390 10:68549924-68549946 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1069473066 10:68710317-68710339 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
1069481547 10:68787133-68787155 AAACAGAGGGAGAGGGAGAAGGG - Intronic
1069581368 10:69569186-69569208 AGACAAAAGCAGAAGAAGGGGGG + Intergenic
1069588872 10:69630023-69630045 AAGAAGGAGAAGAAGGAGGAGGG - Intergenic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069689148 10:70338194-70338216 AAACAGAAGGACAAGGAGGAGGG - Intronic
1070225902 10:74505232-74505254 AACCAAAAGCAAAAGGTGGAAGG - Intronic
1070313784 10:75292849-75292871 AAACAGAAGAACGAGGAGGTAGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070616385 10:77972499-77972521 AAAAAGAAGAAGAAGAAGAATGG - Intronic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071175638 10:82923783-82923805 ACACACAGGTAGAAGGAGGAGGG - Intronic
1071444337 10:85731806-85731828 AAAAAAAAGAAGAAGAAGGAAGG + Intronic
1071798856 10:89035416-89035438 AAAAAATAGCAGAAGCAGGAAGG - Intergenic
1071991685 10:91105754-91105776 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1072054962 10:91745729-91745751 AAAGAGAAGGAGAAGGAAGAAGG + Intergenic
1072085632 10:92076762-92076784 AGAAGGAAGAAGAAGGAGGAAGG + Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072297493 10:94025151-94025173 AATCAGCAGCAGAAGAAAGAGGG + Intronic
1072304677 10:94095851-94095873 ACACAGAAGTAGAAGGAACATGG - Intronic
1072606881 10:96991803-96991825 AAGCAGAGGCAGGAGGAGGGAGG - Intergenic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1073186763 10:101619669-101619691 AAAAAGAAGAGGAAGGGGGAAGG + Intronic
1073208688 10:101781862-101781884 ACACACAAGCAGTAGAAGGATGG + Intronic
1073325876 10:102643848-102643870 AAATAGAAACGGAAGGGGGAGGG - Intergenic
1073509040 10:104031524-104031546 AAACAGAAAAAGAAGGTTGAGGG - Exonic
1073587798 10:104727423-104727445 AAACAGAAGGATAGGAAGGAGGG - Intronic
1073959535 10:108910883-108910905 ACACAGAAGCCAAAGGAGCAAGG + Intergenic
1074051830 10:109887456-109887478 AAACAGAGGTAGATGGGGGATGG - Intronic
1074314342 10:112347895-112347917 AAACAGCAGCAGTAGGATGGGGG + Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1075055483 10:119215391-119215413 TAAAAGAAGCAGAGGGAGGCAGG + Intronic
1075540395 10:123307807-123307829 AAAAAGGAGGAGGAGGAGGAGGG + Intergenic
1075556547 10:123436421-123436443 AAAGACAAGTAGAAAGAGGAGGG - Intergenic
1075744744 10:124719052-124719074 AAAAAGAAGAAGAAGAAAGAAGG + Intronic
1076272409 10:129165934-129165956 AAAGAAGAGAAGAAGGAGGAAGG + Intergenic
1076293220 10:129363659-129363681 AAACAGAAGCAGAACCAGTCAGG - Intergenic
1076358534 10:129870188-129870210 AAATACAGGCAGAAGGAAGATGG - Intronic
1076492192 10:130869443-130869465 AAACAGAAACAGAATGAAGTAGG - Intergenic
1076509149 10:130999823-130999845 AAACAGAAGCAGAGGGATCTAGG - Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076656123 10:132024796-132024818 AAACAGGAGAAGAAATAGGAGGG - Intergenic
1076809181 10:132877912-132877934 AAAGAGAAGGACAAGGAGAAGGG - Exonic
1077233167 11:1467750-1467772 AAACGGAGGCAGAGGCAGGAAGG + Intergenic
1077338551 11:2016104-2016126 ACACAGAAGCAGAGGGAGATGGG - Intergenic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078135795 11:8650450-8650472 GAGCAGAAGGAAAAGGAGGAAGG + Intronic
1078168218 11:8909376-8909398 AAAAAGAAGAAGAAGGAAGAAGG + Intronic
1078455431 11:11471042-11471064 AGACTGAAGCACAAGGATGATGG - Intronic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078619274 11:12892666-12892688 AAAAAGAAGCAGCAGCAGTAAGG + Intronic
1078759155 11:14237857-14237879 TAAGAGCAGCAGAAGTAGGAGGG + Intronic
1079318142 11:19427338-19427360 AAAGGGAAGCAGAAGGAAGAAGG - Intronic
1079735442 11:23992114-23992136 AAACAGTAGCAGCCGGAGGGAGG - Intergenic
1079956046 11:26866051-26866073 AAACAAAAACAGAAAAAGGAAGG + Intergenic
1080478364 11:32619857-32619879 GAAGGGAAGGAGAAGGAGGAGGG + Intronic
1081374300 11:42340539-42340561 AAACAGAAGCAGAGGTCTGAAGG - Intergenic
1081557345 11:44177458-44177480 AAACAGAAGTAAAATGAGGAGGG - Intronic
1081567760 11:44270384-44270406 GAACAGGAGAAGAAGGAGGGAGG - Intronic
1081613103 11:44575196-44575218 AAAGAGAAGGAGATGGAGAAAGG + Intronic
1081646766 11:44795635-44795657 AATCAGAAGCGGCAGGAGTAAGG - Intronic
1081831782 11:46120995-46121017 AAGCAGGAGGAGGAGGAGGAGGG + Exonic
1081896097 11:46588034-46588056 GAAAAGAAATAGAAGGAGGATGG + Intronic
1082179769 11:49103314-49103336 AAGCAGAACCAGTAGGAGGGCGG - Intergenic
1082616721 11:55370477-55370499 GAACAGCAGCAGAAGCAAGAGGG + Intergenic
1082631135 11:55543775-55543797 AAATAAAAGCAGGAGGAGTAGGG - Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082733698 11:56831760-56831782 AAATACAAGAAGGAGGAGGAAGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082948180 11:58782404-58782426 AGAAAGAAATAGAAGGAGGATGG + Intergenic
1083082031 11:60104026-60104048 AAACAGAAGTAGACTGTGGATGG - Intergenic
1083709510 11:64539376-64539398 AACCAGAGGCAGCAGGAGGCTGG + Intergenic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1084508176 11:69583858-69583880 AAACAGAAGCAGAACAAAGAAGG - Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084771036 11:71343208-71343230 ATACTGAAGCAGAAGCAGGCAGG + Intergenic
1084799880 11:71536479-71536501 AAAAAGAAGAAGAAGAAGAAGGG + Intronic
1084948501 11:72651939-72651961 AAACAGGCTCAGAAGTAGGAGGG - Intronic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1085363565 11:75915768-75915790 AAACAGAACCAAAAGGAGAAAGG - Intronic
1085392288 11:76188681-76188703 AAACAGACACAGAAGGGAGAGGG + Intronic
1085502641 11:77037914-77037936 AAAAAAAAGAAGAAGGAGAAAGG + Intronic
1085699033 11:78729820-78729842 AAGCAGGAGGAGGAGGAGGAAGG + Intronic
1085790390 11:79492731-79492753 AAACAGTTACAGAGGGAGGATGG + Intergenic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1086000235 11:81974734-81974756 AGACAATAGCAGAAGCAGGAAGG + Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086080714 11:82900367-82900389 AGACAGAAGCAGGAGCAGGAGGG + Exonic
1086259613 11:84923429-84923451 AAAAAGAAGAAGAAGAAGGAGGG + Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086998917 11:93392984-93393006 AGAAAGAAGGAGGAGGAGGAGGG - Intronic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087219484 11:95531023-95531045 AGACACAAGCAAAAGGAGAAAGG + Intergenic
1087507303 11:99042348-99042370 AAAAAGAAGAAGAAGAAGGGAGG - Intronic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088079549 11:105894641-105894663 AAAAAGGAGGAGGAGGAGGAGGG + Intronic
1088446112 11:109930384-109930406 AAATAGAAGCAGCAGGAAGGTGG - Intergenic
1088563576 11:111142826-111142848 AAACAAAAGAAGAAAGAGTAGGG + Intergenic
1088621499 11:111689074-111689096 AAACAGAAGCAGAATGTTGCAGG + Intronic
1089096388 11:115923283-115923305 AGACAGCAGCAGGAGTAGGAGGG + Intergenic
1089399682 11:118157256-118157278 AAACAGAAACAGAGGAAGGGAGG - Intergenic
1089502208 11:118939412-118939434 AAACAGAAGCTGAGGGACAAAGG + Intronic
1089536307 11:119162478-119162500 AATCAGAAGCAGAATGAGCCTGG - Exonic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089711643 11:120319130-120319152 AAAGAGAAACACAGGGAGGAAGG - Exonic
1089744911 11:120609842-120609864 AAAAAGCAGTAGAAGGAGAAAGG - Intronic
1089826046 11:121278834-121278856 AAAGAGACAAAGAAGGAGGAAGG - Intergenic
1089933598 11:122340130-122340152 AAAGAGAAGGAGGAGGAGGATGG + Intergenic
1090072968 11:123560364-123560386 TAACAGCAGCAGAGGGAGGTGGG + Intronic
1090346027 11:126071512-126071534 CAACTGAAGCAGAGGAAGGAAGG + Intergenic
1090455906 11:126849607-126849629 AATCAGCTGCAGAAGGAGAAAGG + Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090500237 11:127254146-127254168 ACCCAGAAGCCGAAGGTGGAGGG - Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090676126 11:128998384-128998406 AAACAGAAGCTGAAGCAGCGGGG - Exonic
1090827618 11:130398847-130398869 TAACAGAAACAGAAGGAGAAAGG + Intergenic
1090864650 11:130688602-130688624 AAACAGAAAAAGAAAGAGAAAGG + Intronic
1091296675 11:134478566-134478588 ATACACAGGCAGAAGGAAGAAGG - Intergenic
1202821535 11_KI270721v1_random:71286-71308 ACACAGAAGCAGAGGGAGATGGG - Intergenic
1091374293 12:15912-15934 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1091545317 12:1497846-1497868 AAACACAAGAATAAGGAGAATGG - Intergenic
1091600063 12:1912628-1912650 ACAGAGGAGCAGAAGGAGGGTGG - Intronic
1091638199 12:2214162-2214184 AAACTGAGGCACAAGGAGGCTGG - Intronic
1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092092267 12:5812699-5812721 AAAGAAAAGAAGAAGAAGGAAGG + Intronic
1092428435 12:8391352-8391374 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092429516 12:8397504-8397526 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092532203 12:9353920-9353942 ACTCAGAAAGAGAAGGAGGAAGG - Intergenic
1092560408 12:9607239-9607261 AAAGAAAAAGAGAAGGAGGAAGG - Intronic
1092815603 12:12310108-12310130 AAAGTGAAACAGATGGAGGAAGG + Intergenic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093683805 12:22032957-22032979 AGAAAAAAACAGAAGGAGGAAGG + Intergenic
1093698953 12:22195953-22195975 ACATAGAAGCAGAAAGAGGCAGG + Exonic
1094059655 12:26300260-26300282 AGAGAGAAGAGGAAGGAGGAGGG - Intergenic
1094070298 12:26405159-26405181 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094324897 12:29226948-29226970 AAACACAATGAGAAGGAAGAAGG + Intronic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095515903 12:43005131-43005153 AAACAGAGGAAGAAGGGGGGAGG - Intergenic
1095740688 12:45603495-45603517 AAAAAGAAGAAGAAGGAAGAAGG - Intergenic
1096009564 12:48201532-48201554 AAAATGAAGAAGAAGAAGGAAGG - Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096366567 12:51033267-51033289 AAAAAAAAAAAGAAGGAGGAGGG - Intergenic
1096462532 12:51829866-51829888 AAAGAGAATGGGAAGGAGGAAGG + Intergenic
1096510089 12:52122893-52122915 AAAGACATGTAGAAGGAGGAAGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096653198 12:53072365-53072387 AAACAGAAGCAGTGGGGGGTGGG - Intronic
1096659917 12:53118035-53118057 AGACAGAAGGGGAAGGAGAATGG + Intronic
1096692977 12:53332597-53332619 AAAAAGAAGCAGAAATAGGCAGG + Intronic
1096729982 12:53601660-53601682 AAATAGAATCAGAAGGGGGAAGG - Intronic
1096765832 12:53888506-53888528 AAATATAAGCATCAGGAGGATGG - Intergenic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1096921250 12:55088044-55088066 AAGCTGGAGAAGAAGGAGGATGG + Intergenic
1097306033 12:58069985-58070007 ATACAGAAGGAAATGGAGGAAGG + Intergenic
1097383872 12:58926064-58926086 AAAGAGAAGAAGAAGAAGCAAGG - Intergenic
1097395338 12:59066486-59066508 TAACAGAACCAGGTGGAGGAAGG + Intergenic
1097964110 12:65560802-65560824 AAACAGAAAGAGAAGGAGTGAGG - Intergenic
1098064600 12:66600541-66600563 AAAGAAAAGCAGAAGTAGGAGGG - Intronic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098566699 12:71945307-71945329 AAACAGATGTAAAAGGGGGAAGG - Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098708005 12:73715872-73715894 AAAGAGAAGGAGAAGGAGAGAGG + Intergenic
1098844997 12:75523884-75523906 AAACAGATGGAGCTGGAGGATGG + Intergenic
1098993310 12:77090256-77090278 AAAGAGAGAAAGAAGGAGGAAGG - Intergenic
1099081066 12:78181843-78181865 ATACAGAAGGAGAAGGAGAAGGG + Intronic
1099398440 12:82170985-82171007 AAAAAGAAGGAGGAGGAGGGAGG + Intergenic
1099595020 12:84650743-84650765 CAACATAAGCAGAGGGAGCAGGG - Intergenic
1100037506 12:90270901-90270923 AAAAAGCAGCAGGAGAAGGAAGG - Intergenic
1100260166 12:92925761-92925783 AAAAAGGAGGAGCAGGAGGAGGG + Intronic
1100344538 12:93714911-93714933 AGACAGGAGGAGAAGGAGGTTGG + Intronic
1100514704 12:95315964-95315986 ACACAGAAGCCAGAGGAGGAAGG + Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100665325 12:96746014-96746036 AGAGAGAGGCAGAAGGAGGCTGG - Intronic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1100997483 12:100318250-100318272 AGAAAGAAGCAGAAAGATGAAGG - Intronic
1101025141 12:100595937-100595959 AAAGAAGAGAAGAAGGAGGAGGG - Intronic
1101627387 12:106458673-106458695 AAACAAAGGCAGAGGGAGGGAGG - Intronic
1101739878 12:107492584-107492606 ACACAGAAGCAGAAGTGGGAGGG - Intronic
1101761047 12:107659449-107659471 ATACAGAAGTGGGAGGAGGAAGG - Exonic
1101931253 12:109015912-109015934 AAAGAGGAGCAGGTGGAGGACGG + Intronic
1101994457 12:109514898-109514920 AAAAAGAAGAAGAAAGGGGATGG - Intronic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102230337 12:111257516-111257538 AAAGAGGAGGAGAAGGAGGGAGG - Intronic
1102252012 12:111393950-111393972 AAGCAGAAGTAGAAAGCGGAGGG - Intergenic
1102398456 12:112608096-112608118 AAAAAGAAAGAGGAGGAGGAGGG - Intronic
1102544100 12:113642312-113642334 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1102652745 12:114454296-114454318 AAACATATGCAGAAGTAGAAAGG - Intergenic
1102701514 12:114843436-114843458 AGCCAGAAGCAGAAGGAGCGAGG - Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103235367 12:119368150-119368172 GAAAAGAAGGAGGAGGAGGAAGG + Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1103864605 12:124042010-124042032 AGACACACGCAGAAGGAAGATGG - Intronic
1103941240 12:124502417-124502439 AAACAGAACCAGGAGGCGGCAGG + Intronic
1103976674 12:124707234-124707256 AAACAGAAAAGGAGGGAGGAAGG + Intergenic
1104054727 12:125220725-125220747 AAACAGACACAGCAGGACGAGGG - Intronic
1104143387 12:126009370-126009392 AACCAGGAGCTGAAGCAGGAGGG + Intergenic
1104277854 12:127346449-127346471 AAACAGATGAAGAAGGAGGAAGG + Intergenic
1104515292 12:129419484-129419506 AAACTTTAGCAGAAGGAGGATGG + Intronic
1104613339 12:130248108-130248130 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
1104668865 12:130667022-130667044 AGAAAGAAGAAGAGGGAGGAAGG + Intronic
1104947492 12:132422885-132422907 AGACAGAAGCAGATGGAGAGAGG - Intergenic
1105040923 12:132960583-132960605 AAAGAGATGCAGAAGCAGAAGGG - Intergenic
1105329416 13:19401275-19401297 AAACAAATTCAGAAGGAGAAGGG - Intergenic
1105669189 13:22593283-22593305 ACACAGTAGCAAAAGGAGAATGG + Intergenic
1105742168 13:23338152-23338174 AAACAGATACAAAAGGACGATGG - Exonic
1106139251 13:26997830-26997852 AAACAGAAGCAGATGGAGGCTGG - Intergenic
1106497867 13:30297163-30297185 AAAGAAAAGAAGGAGGAGGAAGG + Intronic
1106636558 13:31534847-31534869 CAAAAGAAACATAAGGAGGAAGG - Intergenic
1106663614 13:31828084-31828106 GAACAAAAAGAGAAGGAGGAAGG - Intergenic
1106748900 13:32736811-32736833 AAACTGAAGCATGAGGAGGCTGG - Intronic
1106753463 13:32797676-32797698 AAACAGAAGAAGAAGAAACATGG + Intergenic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1106899248 13:34337646-34337668 AAAGAGCAGGAGAAAGAGGAGGG + Intergenic
1107230248 13:38101008-38101030 AAAAAGAAGCAAAAGGTGTAAGG - Intergenic
1107510217 13:41076176-41076198 AACAGGAAGCAGAAGAAGGAGGG + Exonic
1107659185 13:42621750-42621772 AAGCAGAAGAGAAAGGAGGAAGG + Intergenic
1107708202 13:43127609-43127631 AGACAGAGGGAGAGGGAGGAGGG - Intergenic
1107789247 13:43984550-43984572 AAACAAAGGAAGAAGGAAGAGGG + Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1107999429 13:45892724-45892746 AGAAAGAAGCAACAGGAGGAAGG + Intergenic
1108038786 13:46320400-46320422 AAAAAGAAAAAGGAGGAGGAAGG + Intergenic
1108151028 13:47534602-47534624 AAAAAGAAGCAGCAGCAGCAGGG - Intergenic
1108290872 13:48959654-48959676 AAAAAGAAGAAGAAGAAGAAAGG - Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108392090 13:49956508-49956530 AGAAAGAAGAAGAAAGAGGAAGG - Intergenic
1108639705 13:52371706-52371728 TAACAGCAGCAGCAGCAGGATGG + Intergenic
1108729770 13:53222738-53222760 GACCAGTAGCAGGAGGAGGATGG + Intergenic
1108779842 13:53816178-53816200 AAACAGACACAGAAGGAAGAAGG + Intergenic
1108788323 13:53934489-53934511 AAACAGAATCAATAGGAGCAAGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109473053 13:62835979-62836001 AAAAAGAAAGAGAGGGAGGAAGG - Intergenic
1109555176 13:63964681-63964703 AAACAAAGGGAAAAGGAGGAGGG + Intergenic
1109781445 13:67115415-67115437 ACCCAGGAGCAGAAGGATGAAGG + Intronic
1109906462 13:68847792-68847814 AAACAGCAGTAGTAGGAGCAAGG - Intergenic
1109938343 13:69325249-69325271 AAACAGAAGAAAAAGAAGAAAGG - Intergenic
1109985120 13:69970777-69970799 AAACAGAAGCAGGCAGAGGAAGG - Intronic
1110036399 13:70690797-70690819 ACTCAGTAGCAGAAGGAAGAGGG - Intergenic
1110052467 13:70922021-70922043 AAATAAAAGTAGAAGGAGAAAGG - Intergenic
1110177939 13:72579698-72579720 AAAAAGAAGCAGAGGGAGCTGGG + Intergenic
1110393827 13:75007111-75007133 AAATAAAAGGAGAAGGAGAAAGG - Intergenic
1110531005 13:76597974-76597996 AAACAGAAGCAGATGGATCAGGG + Intergenic
1110590091 13:77246478-77246500 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1110613388 13:77514112-77514134 GAACAAAAGCAGGAGGAAGAAGG - Intergenic
1110829064 13:80009609-80009631 AAAAAAAAGCATAAGGAGAAGGG + Intergenic
1111252130 13:85615418-85615440 AAAAAAAAGAAGATGGAGGAAGG - Intergenic
1111340121 13:86873466-86873488 CAACAAAAGCATAAGGAAGATGG + Intergenic
1111656063 13:91155219-91155241 CAACAGAAGCAGCAGCAAGAAGG + Intergenic
1111681967 13:91453788-91453810 AAAGAAAGGAAGAAGGAGGAGGG - Intronic
1111903131 13:94224556-94224578 AATCAGAACCATAAGGTGGATGG + Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1111956121 13:94760478-94760500 AAAGAGGAAGAGAAGGAGGAAGG - Intergenic
1112250451 13:97774481-97774503 CAACAGAGGCAGATGGAAGAAGG - Intergenic
1112489090 13:99845835-99845857 AAAACGAAGGAGAAGAAGGACGG - Intronic
1112584511 13:100706311-100706333 AAAGAGAAGAAGAAAGAGAAGGG - Intergenic
1113139271 13:107128892-107128914 ACACAGAAGCAGGAGCAAGAAGG - Intergenic
1113159617 13:107365027-107365049 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113222471 13:108120691-108120713 AAACAGAGACAGAAGGAGGGGGG - Intergenic
1113241273 13:108340322-108340344 AAGCAAAAGCAGGAGGTGGAAGG + Intergenic
1113416477 13:110132363-110132385 AAACAGGAGCAGAGGGGGGTGGG + Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1114253948 14:20985824-20985846 AAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1114261452 14:21039529-21039551 CAACAGAAAAAGATGGAGGAAGG - Intronic
1114346441 14:21800299-21800321 AAAGAGAAAGAGGAGGAGGAGGG + Intergenic
1114507280 14:23226795-23226817 AAAAAGAAGAAGAAGAAAGAAGG - Intronic
1114630400 14:24155846-24155868 AAAGGGAAGCAGAGGGAGGGAGG + Intronic
1114842059 14:26275840-26275862 CAACAGGAACAGAAGGAGGGAGG + Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115113125 14:29848252-29848274 AAAAAGATGCAAAAGGTGGATGG + Intronic
1115175604 14:30558768-30558790 AAACAGCAGCAGCAGCAAGAAGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115544437 14:34453006-34453028 AATCATAAGGAGGAGGAGGAGGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1116035189 14:39618935-39618957 AAAAAGAAGCAAAATGAGGTCGG - Intergenic
1116162052 14:41280457-41280479 AGACAGAAAGAGAAGAAGGAAGG + Intergenic
1116268335 14:42726136-42726158 AAACCGAAGAAGGAGGAGAAGGG - Intergenic
1116773260 14:49151399-49151421 AAGCAGCTGGAGAAGGAGGAAGG - Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117308496 14:54499148-54499170 AAACAAAAACAGAAGGAAAAGGG - Intergenic
1117313159 14:54548493-54548515 AAACAGAGGCAAAATCAGGAAGG - Intergenic
1117518359 14:56525232-56525254 AAACAGAAACAGTGGGAGGCTGG + Intronic
1117909310 14:60621419-60621441 AAAAAGAAACAGAAGAAGAAAGG + Intergenic
1118139426 14:63064336-63064358 AAAGAGAAGGGGAAGGAGAAAGG + Intronic
1118171696 14:63395443-63395465 AGAGAGAAGGAGGAGGAGGAGGG + Intronic
1118297655 14:64585217-64585239 CAACAAAAGCAGAAGCAGGCCGG + Intronic
1118381226 14:65219196-65219218 AAATAGAGCCAGAAGGAGGAAGG - Intergenic
1118459571 14:65976093-65976115 GAAGAGGAGGAGAAGGAGGAAGG + Intronic
1118556195 14:67025437-67025459 AAACAGAAAGAGAACAAGGAAGG - Intronic
1118614793 14:67567896-67567918 AAACAGATCCAGAAGGTGCAGGG + Intronic
1118710554 14:68515426-68515448 AAAAAGAAGAAGAAGAAGAAAGG - Intronic
1118973736 14:70659524-70659546 AAGCAGCCGCAGCAGGAGGAGGG + Intronic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119041018 14:71274635-71274657 AAATTGAAGCTAAAGGAGGAGGG - Intergenic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119235652 14:73016995-73017017 AAACAGAACTAAAAGAAGGAGGG + Intronic
1119243437 14:73082254-73082276 AAAAAAAGACAGAAGGAGGAGGG - Intronic
1119601750 14:75981325-75981347 AAGAAGAAGCAGAAGGACCATGG + Intronic
1119854584 14:77889902-77889924 AAACAGAAGAAGAAGAAAGAAGG + Intronic
1119904975 14:78293469-78293491 AAACAGTAACAGAAATAGGAAGG - Intronic
1120071698 14:80110610-80110632 AAACAGGAGGAGAAGCAAGAAGG + Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120306763 14:82780824-82780846 AAAAAGAAGGAGGAGGAGAAGGG - Intergenic
1120673988 14:87397482-87397504 CCACAGAATTAGAAGGAGGAAGG - Intergenic
1120778629 14:88464990-88465012 AGCCAGAAACAGGAGGAGGAGGG - Intronic
1120982273 14:90300840-90300862 AAACAAAGGCAGAAAGGGGATGG + Intronic
1121391524 14:93580082-93580104 AAAAAGAAGAAGAAGGAGTTTGG - Intronic
1121492840 14:94372246-94372268 GTACAGAAGGAGAAGGAAGAGGG - Intergenic
1121548035 14:94777049-94777071 AACCAGAAGCAGGAGGAGTTAGG + Intergenic
1121599868 14:95195404-95195426 AAACAGAGGCAGGGGGAGGAGGG - Intronic
1121697976 14:95928391-95928413 GAACAGAAGGAGAAGGAGATAGG - Intergenic
1121847462 14:97185755-97185777 AAAAAGAACCTGAAGGAAGATGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121932905 14:97989559-97989581 AGACAGAAGAAGATGGAAGAAGG + Intergenic
1121969727 14:98344953-98344975 AAAAAGAAGAAGAGGAAGGAAGG + Intergenic
1122088369 14:99322327-99322349 AACCAGAAGGAGAGGGGGGACGG + Intergenic
1122091794 14:99345803-99345825 AACCCCATGCAGAAGGAGGAGGG + Intergenic
1122317440 14:100834554-100834576 CAACAGAAGCAGAAAAAGCAGGG - Intergenic
1122357384 14:101131889-101131911 AAGCAGAAGTAGGAGGAGGGAGG - Intergenic
1122392786 14:101401797-101401819 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
1122420223 14:101571712-101571734 AAGCAGAGGGGGAAGGAGGAGGG + Intergenic
1122897951 14:104769632-104769654 ACACAGAAGGGGAAGGGGGAGGG + Exonic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123682733 15:22774217-22774239 AAACGGAAGCCCAAAGAGGAGGG + Intronic
1123762703 15:23444987-23445009 AAACGGAAGCCCAAAGAGGAGGG + Intronic
1123800312 15:23811950-23811972 AAAATGAAGAAGGAGGAGGATGG + Intergenic
1124334484 15:28846740-28846762 AAACGGAAGCCCAAAGAGGAGGG + Intergenic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124459636 15:29877623-29877645 AAAGAGAAGAAGAAAGAAGAAGG - Intronic
1124959680 15:34385049-34385071 ACACAGAAGAAGAAGCCGGATGG - Exonic
1124976306 15:34531270-34531292 ACACAGAAGAAGAAGCCGGATGG - Exonic
1125352328 15:38780941-38780963 AATCAGAAGCTGAAGGAGAAGGG - Intergenic
1125601134 15:40916326-40916348 AAAGAGAAGGAGCAGAAGGAGGG - Intergenic
1126091179 15:45053462-45053484 AAGCTGAAGCAGGAGAAGGAGGG + Intronic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1126355959 15:47796220-47796242 AGTCAGAAGAAGAGGGAGGAAGG - Intergenic
1126411806 15:48379948-48379970 GATCAGAAGCATAAGGAGGAGGG + Intergenic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1126678303 15:51180944-51180966 AAACAGAATCAATAGGAGGGAGG - Intergenic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126866311 15:52941162-52941184 AAGCAGAAGCATAAGGTGAAAGG - Intergenic
1127055584 15:55127713-55127735 AAAAAGAAGAAGAAGAAGCATGG + Intergenic
1127122100 15:55780570-55780592 AAGCAGAAGAAGAAGAAGAAAGG + Intergenic
1127159714 15:56169264-56169286 AAACATAAGCAGGTGGAAGATGG - Intronic
1127347653 15:58116632-58116654 AATCAGTAGCAGAACAAGGAGGG + Intronic
1127692284 15:61409125-61409147 AAAAAGAAGTAGGAGGATGAGGG + Intergenic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1127997599 15:64162756-64162778 AGACAGAAGCCGAGGGAGGAGGG + Intronic
1128095609 15:64952253-64952275 AAAAAGAAGGAGAAGGAAGAAGG - Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095733 15:64953538-64953560 AGAAAGAAGGAGAAGGAAGAAGG - Intronic
1128158990 15:65410788-65410810 AAAGAAAAGCAGAAGGAACAGGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128338426 15:66803213-66803235 AAAAAGCAGCAGCAGCAGGAAGG + Intergenic
1128364254 15:66986125-66986147 AACCAGAAGGAGAAGGAGTGTGG - Intergenic
1128560943 15:68667308-68667330 AAGCAGAGGAAGAAGCAGGATGG - Intronic
1128656197 15:69463701-69463723 AAAGAGAAAGAGGAGGAGGAGGG - Intergenic
1128658955 15:69483888-69483910 AATCAAAAGCAGATGGAGGGCGG - Intergenic
1128716809 15:69914521-69914543 AGAGAGAGACAGAAGGAGGAGGG - Intergenic
1128740145 15:70078187-70078209 AAAAATAAGCAGAGTGAGGAAGG - Intronic
1128910704 15:71511566-71511588 AAACAAAAGCAGTGGGAGGGGGG - Intronic
1129106873 15:73315856-73315878 AAAAAGAAGAAGAAGAAGGTGGG + Intergenic
1129137907 15:73570733-73570755 AAACCACAGCAGAAAGAGGACGG + Intronic
1129600356 15:76995015-76995037 AAGCAGAGGCAGGAGCAGGATGG + Intronic
1129600446 15:76995340-76995362 AATCAGCAGCAAAATGAGGAAGG - Exonic
1129601845 15:77003664-77003686 AAAAAGAAGAAGAAGGAAGCGGG + Intronic
1129650597 15:77484900-77484922 AAACAGAAATATGAGGAGGAAGG - Exonic
1129868678 15:78927457-78927479 AAACAGAACCAAAAGAATGAAGG + Intronic
1130647308 15:85740615-85740637 AAACAGAAGCTGTATTAGGAAGG - Intronic
1130719153 15:86369852-86369874 AAACAGAATTACAAGGAGGTAGG + Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131081387 15:89539185-89539207 AAAGAGAAGGAGAGGAAGGAAGG + Intergenic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131513809 15:93064497-93064519 ACGCAGAAGGTGAAGGAGGAAGG - Intronic
1131623926 15:94097725-94097747 AAACAAAAGTAGAAGGAGAAAGG + Intergenic
1131674077 15:94653446-94653468 ATACTGCAGCAGAAGGAGCATGG - Intergenic
1131852113 15:96554582-96554604 AAAGAGTAGGAGAAGGAGGGAGG - Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1132014759 15:98305730-98305752 AAACAGAAGAGGAAGGAAGAGGG + Intergenic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1132445971 15:101918944-101918966 ACAGAGTAGCAGAGGGAGGATGG + Intergenic
1132845685 16:1999879-1999901 ACACAGGAGGAGGAGGAGGACGG - Exonic
1132999455 16:2841690-2841712 CCACAGCAGCAGAAGCAGGATGG + Intergenic
1133064386 16:3195730-3195752 AAACAGAAAAAGAAAGAGGGTGG - Intergenic
1133108902 16:3533848-3533870 AGACAGAAGCAGAGGGAGTGTGG + Intronic
1133460758 16:5984197-5984219 GAAGAGAAGAAGAAGGGGGAGGG - Intergenic
1133597978 16:7311275-7311297 AAACAGAATCAAAATTAGGAAGG + Intronic
1133961260 16:10495550-10495572 AAAAAGAGGGAGAAGGAGGGAGG - Intergenic
1134031878 16:10998655-10998677 AAAAAGGAGAAGAAGGAGAAGGG - Intronic
1134068687 16:11247068-11247090 AAAAAAAAGGAGAAGGAGAAGGG - Intergenic
1134197544 16:12170524-12170546 AAGCTCAGGCAGAAGGAGGAGGG + Intronic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134304116 16:13016986-13017008 AAAAAGAAGAAGAAGAAGAAAGG - Intronic
1134324286 16:13192880-13192902 AAAGAGAAGAAGAAGAAAGAAGG + Intronic
1134751411 16:16628261-16628283 AAAAAGAAAGAGAAAGAGGAAGG - Intergenic
1134845291 16:17434880-17434902 AAAAAGAAGAAGAAGAAGAATGG + Intronic
1134868828 16:17633098-17633120 AAAAGGAAGCAGACAGAGGACGG + Intergenic
1135091368 16:19520733-19520755 AAAAAAAAGAAGAAGAAGGAAGG + Intronic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135198638 16:20417533-20417555 AACCAGGAGCTGGAGGAGGAGGG + Intronic
1135694693 16:24575754-24575776 AAAGAGAGGGAGAGGGAGGAGGG + Intergenic
1135782947 16:25322225-25322247 ATCCAGATGAAGAAGGAGGAGGG - Intergenic
1135892127 16:26366665-26366687 AAGCAGAGGGAGAGGGAGGAGGG + Intergenic
1135920307 16:26643460-26643482 AAAGAGCAGCAGAGGGTGGAGGG - Intergenic
1136079033 16:27839458-27839480 AAACAGAAGCAGAAAGCGCAAGG + Intronic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1136397532 16:30001329-30001351 AAATGCAAACAGAAGGAGGATGG - Intronic
1136546909 16:30959735-30959757 AAAAAGAAGAAGAAGAATGAAGG - Intronic
1136619883 16:31421541-31421563 AAACAGAAGCATAGAGAGAAGGG + Intronic
1136657617 16:31719982-31720004 AAACAGAAGAAGAGAGAGAAAGG + Intronic
1136777556 16:32879867-32879889 AAACAGAAGTAGTAGGAGGCTGG + Intergenic
1136893068 16:33981647-33981669 AAACAGAAGTAGTAGGAGGCTGG - Intergenic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137407266 16:48199436-48199458 AAAAAGAAACAGAAGAAGAAGGG + Intronic
1137468227 16:48730584-48730606 AAAGAGCAGCAGAAAGAGGGCGG - Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137590018 16:49687736-49687758 AAACAGGAGCCGCAGCAGGACGG - Intronic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138260308 16:55615436-55615458 AAAGAGGAACAGAAGGAAGATGG + Intergenic
1138297693 16:55900932-55900954 AAACTGAAGCACAAAGAGGAAGG + Intronic
1138760426 16:59537242-59537264 AAATAGAAGCCTAAGGAGTACGG + Intergenic
1138933868 16:61695073-61695095 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
1139119725 16:64001277-64001299 AAACAGGACCAGAAGTAGGCTGG + Intergenic
1139144499 16:64307625-64307647 AGAGAGAAGGAAAAGGAGGAAGG + Intergenic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139478644 16:67216045-67216067 AAAGAGCAGGAGAAGGAGGAAGG - Intronic
1139640050 16:68285065-68285087 AAAAAGAAGCAGAAGTGGGAGGG - Intronic
1139918815 16:70445909-70445931 AAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1139918823 16:70445949-70445971 AAAAAAAAAAAGAAGGAGGAAGG - Intergenic
1140088281 16:71815807-71815829 AGAGAGAAACAAAAGGAGGAGGG + Intergenic
1140258061 16:73353747-73353769 AAAAAGAGGCAGGAGGAGAAAGG + Intergenic
1140309509 16:73835444-73835466 AAAAAAAAGCAGAAGAGGGATGG - Intergenic
1140506998 16:75479751-75479773 AACCAGAAAGAGGAGGAGGAAGG + Exonic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141190905 16:81823967-81823989 AAAAAGAAGGAAAAGAAGGAAGG - Intronic
1141193587 16:81842720-81842742 AATCAGTAGCGGGAGGAGGAAGG + Intronic
1141244204 16:82291214-82291236 AGAATGAAGCAGACGGAGGAAGG + Intergenic
1141537903 16:84696003-84696025 AAATAGAAGCAGAAAGAGAGAGG - Intergenic
1141873281 16:86804320-86804342 AAAAAGAAGAAGAAGAAGGGAGG + Intergenic
1141891752 16:86930858-86930880 GAAGAGGAGGAGAAGGAGGAGGG - Intergenic
1141910419 16:87054797-87054819 AAACGGATGCAGAGGGTGGAGGG + Intergenic
1203079970 16_KI270728v1_random:1141976-1141998 AAACAGAAGTAGTAGGAGGCTGG + Intergenic
1142492203 17:286404-286426 ACACTGAAGCAGCAGGGGGATGG - Intronic
1143171067 17:4930700-4930722 AAAAAGAAGAAGAAGAAGAAAGG + Intergenic
1143173624 17:4944358-4944380 AAAGAGAAGCAGAGGTAAGAAGG - Intronic
1143399253 17:6631566-6631588 AGACAGCAAGAGAAGGAGGAAGG + Intronic
1143443528 17:6994165-6994187 AAACAAAAGCAGGAGGGGGAAGG + Intronic
1143769672 17:9160616-9160638 AAACAAAAGCAGGAAGAGAAAGG - Intronic
1143794703 17:9327301-9327323 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1143805724 17:9424519-9424541 AACCAGAGGCAGGGGGAGGAAGG - Intronic
1143830798 17:9648836-9648858 AAAGAGAAACAGAAAGAGAAAGG - Intronic
1143947430 17:10605472-10605494 AAAGAGAAGGAGGAGGGGGAGGG + Intergenic
1143964096 17:10743968-10743990 AAAAAGAGAAAGAAGGAGGAAGG - Intergenic
1144053168 17:11515281-11515303 AAAGAAAAGAAGAAAGAGGAAGG + Intronic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144289135 17:13808734-13808756 AAAAAAAATCATAAGGAGGAGGG - Intergenic
1144290178 17:13818699-13818721 AAAAAAAAGCAGAAAGAGAATGG + Intergenic
1144540087 17:16132913-16132935 AAAAAGAAGAAGAAGAAGGAAGG - Intronic
1144678370 17:17176231-17176253 ATACAGAAACAGGAAGAGGAAGG - Intronic
1144707537 17:17379511-17379533 ATACAGAAACAGAAAGCGGATGG - Intergenic
1144840338 17:18182243-18182265 AAAAAGAACGAGGAGGAGGAGGG + Intergenic
1144964782 17:19070124-19070146 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1144983185 17:19182054-19182076 AAATAGAAGGAAAAGGAGGAGGG + Intergenic
1144985040 17:19196185-19196207 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1145097662 17:20045200-20045222 AAACTCAAGCAGCAGCAGGATGG - Intronic
1145116859 17:20218314-20218336 AAACAGAGGCAGAGGGATTAAGG + Intronic
1145221383 17:21092458-21092480 AAAAAGAAGAAGAAGGTGGTGGG - Intergenic
1146144495 17:30401271-30401293 AAAGAGGAGGAGAAGGAAGAAGG - Intronic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146299612 17:31677946-31677968 AGTCAGAAGCTGAAGGAGCAGGG + Intergenic
1146502361 17:33374943-33374965 AAACAGAAGCCCAGGGAGGTTGG + Intronic
1146637284 17:34515733-34515755 AAAGAGAAGCTGAAAGAGAAAGG - Intergenic
1146641941 17:34548251-34548273 AAACTGATGCAGAAGCAGGCAGG - Intergenic
1147016327 17:37494618-37494640 AAAGAGAAGGAGCAGGAGGGAGG + Intronic
1147053979 17:37819716-37819738 CAACAGAAGAAGGAGGAAGAGGG - Intergenic
1147158693 17:38558623-38558645 GAACAGAGGCAGGAGGAGAACGG + Intronic
1147208752 17:38858383-38858405 AAACAAAGGCAGAACGTGGAAGG - Intergenic
1147876912 17:43628244-43628266 AAAAAGAAGAAGAAGTAAGAGGG + Intergenic
1147966393 17:44196426-44196448 AAACAAAAGCATAAAGAGCAGGG + Intronic
1148002203 17:44396103-44396125 AAACGGAAGTAGAAGTAGGCTGG - Intronic
1148413552 17:47488360-47488382 AAAAAGAAGAAAAAGTAGGAGGG + Intergenic
1148428670 17:47623870-47623892 AAACAGAAGCTGAAGTCAGAGGG - Intergenic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1148554363 17:48569437-48569459 AAGCAGAAGCAGGAGGAGAAGGG - Intronic
1148591410 17:48818944-48818966 AAACTGAAGCAGAATGATGGAGG + Intergenic
1148616861 17:49007279-49007301 CTACAGAAGCAGAAGAAGTAGGG - Intronic
1148669875 17:49402551-49402573 AAACAGCAGGAAAAGGAGGAAGG + Intronic
1148670368 17:49405537-49405559 AAACAGAAGCAAAAGAAAGGTGG + Intronic
1148841052 17:50497491-50497513 AAAAAGAAGCAGAAGGGGCCAGG + Intergenic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1149103051 17:52928834-52928856 AATTAGGAGGAGAAGGAGGATGG + Intergenic
1149107088 17:52982606-52982628 AAAGGGGAGGAGAAGGAGGAGGG - Intergenic
1149195154 17:54110747-54110769 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1149351767 17:55796044-55796066 AAACAGAAAGTGAATGAGGATGG + Intronic
1149367507 17:55960587-55960609 AGACAGAAGCAGGAGGGGGCAGG + Intergenic
1149381445 17:56098059-56098081 AGAGAGAAGCAGAAGGAGATTGG + Intergenic
1149467744 17:56893125-56893147 ACACAGATGCAGCAGGAGAAGGG + Intronic
1149635786 17:58168183-58168205 AAAAAGAAGAAGAAGATGGAGGG - Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1149798932 17:59548437-59548459 GAACAGAAGCAGAGGGAAGCAGG - Intergenic
1149873663 17:60207139-60207161 AAACAGAAGCAAGATGAGAAGGG + Intronic
1150087448 17:62284395-62284417 AAACAGAAGCAAGATGAGAAGGG + Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150801580 17:68287311-68287333 AAAAAGAAGAAGAAGAAGGCTGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150973363 17:70056100-70056122 AAACAGAATCAGACTGAGGAAGG + Intronic
1150974705 17:70071890-70071912 AATCAGAGGCAGAAGGAAAAGGG - Intronic
1151133300 17:71920930-71920952 AAAAAGAAGAAGAAAGAGTAGGG + Intergenic
1151221928 17:72619312-72619334 AAAAAGAAGAAGAAGAAGAAGGG - Intergenic
1151568635 17:74915019-74915041 AACCAGAGGCAGCAGGATGAGGG - Intergenic
1152053894 17:78006602-78006624 AGAAAGAAGAAGAAGGAAGAAGG - Intronic
1152084062 17:78206652-78206674 AGAAAGAAGATGAAGGAGGAAGG - Intronic
1152084241 17:78207871-78207893 AGACTGAAGCAGAAGGCAGAGGG - Intergenic
1152148039 17:78581011-78581033 AGGCAGAAGCTGAAGAAGGATGG - Intergenic
1152425556 17:80216784-80216806 AAACTGAGGCACAAGGAGGTAGG + Intronic
1152630323 17:81408083-81408105 ACACAGGGGCAGCAGGAGGAAGG - Intronic
1152690563 17:81715983-81716005 AAACAGAAGCAGGTGGCGGGAGG - Intronic
1153017273 18:595509-595531 AAAAAGAAGCACAAGAAAGACGG + Intergenic
1153062515 18:1008507-1008529 AAATACAAGCAAAATGAGGAGGG - Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153372491 18:4334758-4334780 AAACAGATGCAGGTGGAGGCAGG - Intronic
1153414021 18:4825461-4825483 AAGCAGCAGCAGCAGGAAGAGGG - Intergenic
1153448213 18:5197091-5197113 AAAGACAGGCAGACGGAGGATGG + Exonic
1153460580 18:5328397-5328419 AAAAAGAAGAAGAAGAAGGAAGG + Intergenic
1153833880 18:8947326-8947348 AAAAAAAGGCAGAAGGAGGCTGG + Intergenic
1153861641 18:9216074-9216096 AAACAGTGGAAGAAGGAGGGTGG + Intronic
1154957757 18:21276065-21276087 AAACAGAATGAGAATGAGGAAGG - Intronic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155139008 18:23026247-23026269 AAACAGAAACAGAAGGATGAAGG + Exonic
1155163516 18:23214660-23214682 CAAAAGGAGCACAAGGAGGAAGG - Intronic
1155240997 18:23863449-23863471 AAACAAAACAAAAAGGAGGAGGG + Intronic
1155409880 18:25532140-25532162 AAAGAGAAGCAACAGGAAGAGGG + Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155882174 18:31162940-31162962 ACACATAGGCAGAAGGAGGAGGG + Intergenic
1155887783 18:31228871-31228893 AAAAAAAAAAAGAAGGAGGAAGG + Intergenic
1155972993 18:32099244-32099266 AAAACAAAGCAGAAGTAGGAAGG - Intronic
1156036919 18:32774301-32774323 AAAAAGAAGCAGAAAAAGGAAGG + Exonic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156525584 18:37764785-37764807 GAACTGGAGCAGAAGGAGGAGGG - Intergenic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156634695 18:39012863-39012885 AAAAAGAAGAAGAAGAAGAAAGG + Intergenic
1156730278 18:40185764-40185786 GAAAAGAAGAAGAATGAGGAGGG + Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156987153 18:43361763-43361785 AAAAAGAAGAAGAATAAGGAGGG + Intergenic
1157007360 18:43599583-43599605 ATACAGAAAAAGAAGGAAGAAGG + Intergenic
1157237607 18:45979194-45979216 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1158085312 18:53643950-53643972 AAAGGGAAGCAAAAGGAGTAAGG - Intergenic
1158217774 18:55117724-55117746 AAAAAGTAGAAGAAGGAGGAGGG + Intergenic
1158678955 18:59549308-59549330 AAACAGAAGAATAAGAAGAATGG - Intronic
1159238753 18:65713097-65713119 AGAAAGAAACAGAAGGAGGAAGG - Intergenic
1159300976 18:66567274-66567296 AGCAAGAAGCAGAGGGAGGAAGG + Intronic
1159309806 18:66692157-66692179 AAAAAGAAACAAAAGGAGGGTGG - Intergenic
1159310289 18:66698551-66698573 AAGCAGAAGGAGGAGGAGAAAGG + Intergenic
1159679800 18:71334991-71335013 ACACAGAAGGAGTAGGTGGAGGG + Intergenic
1159740950 18:72169446-72169468 ATACAGGAGCAGGAGGAAGATGG - Intergenic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1160083269 18:75751332-75751354 ACACACAAGCAGAGGGAGAAAGG - Intergenic
1160639336 19:114763-114785 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1160925360 19:1542277-1542299 AAAAAGAAGGAGAAGGAAGGAGG - Intergenic
1161277664 19:3427827-3427849 AAAAAGAAGAAGAAGAAAGAAGG + Intronic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161610470 19:5239141-5239163 AGACAGAAACAGAGGGGGGAGGG + Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161865971 19:6832474-6832496 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162198818 19:9006708-9006730 GAACAGAAGCTCAAAGAGGAAGG - Intergenic
1162215046 19:9127223-9127245 AAAGAGAAAAAGAAAGAGGAGGG - Intergenic
1162251158 19:9444693-9444715 AAAAAGAAAGAGAAGAAGGAAGG + Intergenic
1162317947 19:9952324-9952346 AAAAAGGAGGGGAAGGAGGAAGG + Intergenic
1162353595 19:10166545-10166567 AAACAGGAGCAGAAGAATGAGGG + Intronic
1162504008 19:11071710-11071732 AAAAAGAAGAAGAAGAAGAAAGG + Intergenic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163127280 19:15251157-15251179 GAACACAGGCAGGAGGAGGATGG - Intronic
1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG + Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163703961 19:18801530-18801552 AAAAAGAAGAAGAAGAAGAAGGG - Intergenic
1163731411 19:18951636-18951658 AAACAGAGGCTCAGGGAGGAAGG - Intergenic
1163760805 19:19135436-19135458 AAAGGGAAGAAGAGGGAGGAGGG - Intronic
1163851646 19:19667788-19667810 AAAAAGAAGCAGGAGGCGGCTGG + Intergenic
1164211927 19:23106145-23106167 AAGCAGAAGGAGAAGGAGAAGGG + Intronic
1164234935 19:23323582-23323604 GAAAAGAAGGAAAAGGAGGATGG - Intronic
1164412925 19:28020715-28020737 AAGCAGGAGCGGGAGGAGGAGGG + Intergenic
1164718454 19:30412667-30412689 AAAGAGGAGAAGAAGGAGAAGGG - Intronic
1164718639 19:30415046-30415068 AAGCAGAAGCAGGAAGAAGAAGG - Intronic
1164847289 19:31444228-31444250 AAGAAGAAGAAGAAGGTGGAAGG + Intergenic
1164858637 19:31544966-31544988 AAAGAGAAGGAGGAGGAGGGAGG - Intergenic
1164858645 19:31545018-31545040 AAAGAGAAGAAGGAGGAGGGAGG - Intergenic
1165069753 19:33248494-33248516 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1165197731 19:34118117-34118139 AAAAAAAAGAAGAAGGGGGAGGG + Intergenic
1165757933 19:38304902-38304924 AAAGTGAAGAAGAAGGAGAAGGG + Exonic
1165810213 19:38607573-38607595 AAAAAAAAGAAGAAGGTGGAAGG + Intronic
1166034961 19:40161420-40161442 GAAGAGAAGCAGAAGGGGAAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166573923 19:43819266-43819288 AAAAAGAAGAAGAAGAAGAAGGG - Intronic
1166591153 19:44000483-44000505 AGGCAAAAGCAGTAGGAGGAGGG + Intergenic
1166600228 19:44087578-44087600 AAAAAAAAGCAGAAGCAGCATGG - Exonic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166787778 19:45379527-45379549 AAAAAGAAGAAGAAGAAGAAAGG + Intergenic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167191268 19:47991670-47991692 AAAGAGAAGGAAGAGGAGGAGGG - Intronic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168075584 19:53979364-53979386 AAACGGGAGGAGGAGGAGGAAGG + Intronic
1168092790 19:54096637-54096659 AGAAAGAGGCAGAAGGAGAAAGG - Intronic
1168220563 19:54957329-54957351 AAAAAGAAGAAGAAGAAGAAAGG - Intronic
1168240720 19:55087567-55087589 AAGCAAAAGAAGAAGGTGGAAGG + Exonic
1168464942 19:56594844-56594866 GAAGAGATGGAGAAGGAGGAGGG - Intergenic
1168710114 19:58494725-58494747 CAACAGAAACAAAGGGAGGAGGG - Intronic
925078154 2:1037161-1037183 AGAGAGAAGCAGAAGGCAGATGG - Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925236560 2:2283870-2283892 AAACTGAGGCAGAGGGAGGTCGG - Intronic
925549607 2:5057834-5057856 AGACAGAAGCTAAATGAGGAAGG - Intergenic
925704699 2:6673367-6673389 AAGCAGAAGGAAAAGGAGAAGGG + Intergenic
925853346 2:8105650-8105672 AAAGAGAGGGAAAAGGAGGAAGG - Intergenic
925947638 2:8880404-8880426 GAACAGATGCGGGAGGAGGAAGG + Intronic
926231583 2:11008234-11008256 GAGCTGCAGCAGAAGGAGGAAGG - Intergenic
926243809 2:11107399-11107421 AAAAAGAAGGAGGAGGAGAAAGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926861520 2:17315249-17315271 AAATACCAGCAGCAGGAGGAGGG - Intergenic
926918515 2:17916352-17916374 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
927187354 2:20491316-20491338 GAAGAGAAGGAGGAGGAGGAGGG - Intergenic
927515141 2:23667876-23667898 AAAGAGGAACAGAGGGAGGACGG - Intronic
927724341 2:25409750-25409772 AAAAAGAAGAAAAAGGAGGCAGG - Intronic
928031636 2:27784628-27784650 ATAAAGACACAGAAGGAGGAAGG + Intronic
928405450 2:31011048-31011070 AGACAGAAGCACAGGAAGGAGGG + Intronic
928620203 2:33081275-33081297 AAAAAACAGCAGAAGCAGGAAGG - Intronic
928765690 2:34642501-34642523 AAACAGAAACAGAAAGAGAAAGG + Intergenic
928908951 2:36399245-36399267 AGACAGAATCAGAAAGAAGATGG + Intronic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929171391 2:38936393-38936415 AAACAGAAAGAGGAGGAGGAAGG - Intronic
929348366 2:40916017-40916039 AAACAAAATCAGAAAGAGTATGG + Intergenic
929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG + Intronic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
929855558 2:45635928-45635950 AAAAAGAAGAAGAAGAAGGGTGG + Intergenic
930052526 2:47227815-47227837 AAATGGCTGCAGAAGGAGGAGGG - Intergenic
930109488 2:47666425-47666447 AGAAAAAAGCAGAAGGAGAAAGG + Intergenic
930175321 2:48295472-48295494 AAACAGAAGTAGAAAGAAAATGG + Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930395514 2:50818943-50818965 AATCAAAACCACAAGGAGGAGGG + Intronic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
930515264 2:52399755-52399777 AATTAGATCCAGAAGGAGGAAGG - Intergenic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930639481 2:53840509-53840531 AAAGAAAAGGAGAAGGAGAAAGG + Intergenic
931129519 2:59318465-59318487 AACAAGAAGAATAAGGAGGAGGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931279875 2:60780901-60780923 AAACCACAGCAGAAGGAGGAAGG - Intronic
931473441 2:62563830-62563852 AAAGTGAAGTAGAAGGAGGCAGG + Intergenic
931483678 2:62669056-62669078 AGGCAGAAGCAGAAGAAAGACGG - Intergenic
931513152 2:63022297-63022319 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
931992699 2:67807074-67807096 AAACAGCAGCAGAAGCCTGATGG - Intergenic
932024457 2:68119559-68119581 AAACAAAAGCATAAGGAGTCTGG - Intergenic
932283284 2:70512923-70512945 AATCAGGAGGAGCAGGAGGAAGG + Intronic
932299703 2:70657631-70657653 AACGTGAATCAGAAGGAGGATGG - Exonic
932429572 2:71666044-71666066 AAACAGAATGAGAAGGAGGAGGG - Intronic
932569805 2:72932638-72932660 GAACAGATGCTGGAGGAGGAGGG + Intronic
932599861 2:73116187-73116209 AAACAGAAGCAGGAAGAGCTTGG + Intronic
932772526 2:74508340-74508362 GAGCAGATGCCGAAGGAGGAGGG + Exonic
933014250 2:77104303-77104325 GGACAGAAACAGAAGCAGGAAGG - Intronic
933249598 2:80014256-80014278 GAGCAGAAGCTGCAGGAGGAAGG + Intronic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933844282 2:86312983-86313005 AAAAAGCAGAAGAAGAAGGATGG - Intronic
933995004 2:87661722-87661744 AAAGAAAAGGAGGAGGAGGAGGG + Intergenic
934147038 2:89105058-89105080 ACACAGAGACAGAGGGAGGAGGG - Intergenic
934222228 2:90095537-90095559 ACACAGAGACAGAGGGAGGAGGG + Intergenic
934526480 2:95055273-95055295 AAAAAGAAGAAGAAGAAGGAGGG + Intergenic
934616094 2:95772192-95772214 GAAGAGAAGCAGAGGCAGGAGGG - Intergenic
934631584 2:95930924-95930946 AAGCAGAAGCAGAAGTTAGAAGG - Intronic
934644802 2:96052368-96052390 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934802063 2:97173761-97173783 AAGCAGAAGCAGAAGTTAGAAGG + Intronic
934838213 2:97608457-97608479 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934926553 2:98385842-98385864 AAACGGCAGGAGCAGGAGGAAGG + Intronic
935089213 2:99878144-99878166 AACAAGAAGCGGAAAGAGGAAGG + Intronic
935233864 2:101121646-101121668 AAACAGAAACACCAGCAGGATGG - Intronic
935346900 2:102116707-102116729 AAACAGCAACAGCAGCAGGAAGG + Intronic
935451155 2:103210969-103210991 AAAAAGAAGAAGAAGAAGAAAGG - Intergenic
935647783 2:105355196-105355218 AAAAAGAAGGAAAAGAAGGAAGG + Intergenic
935818272 2:106868262-106868284 AAACAGAAGGAAAAGAAAGAAGG + Intronic
936298854 2:111289191-111289213 AAAGAAAAGGAGGAGGAGGAGGG - Intergenic
936381056 2:111986499-111986521 AGCCAGAAGTAGAAGGAGAAAGG - Intronic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936568520 2:113597617-113597639 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
936832824 2:116669801-116669823 GAAGAGGAGGAGAAGGAGGAAGG - Intergenic
936941131 2:117885557-117885579 AAATAGAATCAGAAGAAGGGTGG - Intergenic
937002878 2:118484309-118484331 AAACAAAGGCAGCAGGACGAGGG - Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937217396 2:120321358-120321380 AACTCGAAGAAGAAGGAGGAGGG - Intergenic
937285258 2:120746524-120746546 AAACAGAAGCAGAAGAAAGAGGG - Intronic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937514653 2:122639567-122639589 AAACAGAATTTGAAGGGGGATGG + Intergenic
937579086 2:123461538-123461560 GAAAAGAAGAAGGAGGAGGAGGG - Intergenic
937683565 2:124670172-124670194 AAAGAGAAAGAGAGGGAGGAAGG - Intronic
937761625 2:125611213-125611235 GAACAAAAGCAGAAAGAGAAAGG + Intergenic
937844011 2:126557439-126557461 AAGCTGAAGCAGGAGAAGGAGGG - Intergenic
937863679 2:126732347-126732369 AAAAAGAAAAAGAAGAAGGAAGG + Intergenic
937953717 2:127407900-127407922 AGACAGGAGCAGAAGGAGGGAGG - Intergenic
938064519 2:128273803-128273825 AAACAGAAGCAGGAAGAGGGCGG + Intronic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938312944 2:130305928-130305950 AAACAGAGGAAGCAGGAGAATGG + Intergenic
938398566 2:130968457-130968479 AAACAAATGCAGAAGGATGTAGG + Intronic
939014181 2:136882376-136882398 AGAAAGAAGAAGAAGAAGGATGG - Intronic
939031881 2:137086440-137086462 AGACAGAAGCAGGAGTTGGAGGG - Intronic
939128941 2:138211311-138211333 AAACAGAAAAAAAAGAAGGAAGG + Intergenic
939743556 2:145940205-145940227 AAACCAAATAAGAAGGAGGAGGG - Intergenic
939754081 2:146087488-146087510 GGACAGAAGGAGAAGGAGAAGGG + Intergenic
939987517 2:148845208-148845230 AAAAAGAAAAAAAAGGAGGAGGG - Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940235513 2:151507375-151507397 AAAAAACAGCAGAAGCAGGAGGG + Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940786423 2:157986458-157986480 TAATAGAAGAAGAAGAAGGATGG + Intronic
941087396 2:161133843-161133865 AAAGAGAAGGAGAAGGTGAAAGG - Intergenic
941315450 2:163986400-163986422 AAAGGGAAGGATAAGGAGGAAGG + Intergenic
941638273 2:167960078-167960100 CAACAGCAGCAGATGCAGGAAGG + Intronic
941889804 2:170568240-170568262 AAACAGAGGCAGAAAGAGTGTGG + Intronic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942791356 2:179765114-179765136 AAGCAGAACCAGTAGGAGAAAGG - Intronic
943135876 2:183912532-183912554 AAAGAGAAGCAGGAGAAAGAAGG - Intergenic
943202843 2:184851370-184851392 ACTCAGAAGCAGAAAGAGAATGG - Intronic
943357111 2:186870442-186870464 AAAGAGAAGGAGGAGGAGAAAGG - Intergenic
943425149 2:187722391-187722413 AAAAAAAAGAAGAAGGAAGAAGG - Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943778120 2:191790188-191790210 AAACATAAGCAGAAAGAGCAAGG - Intergenic
943787918 2:191899490-191899512 CAAAAGAAGCAGAAGGAAAACGG + Intergenic
944175204 2:196821160-196821182 CAACAGAAGCTGGAAGAGGAAGG + Intergenic
944745248 2:202649171-202649193 AAACATAATCCAAAGGAGGATGG - Intronic
944908740 2:204288359-204288381 AAGCAGAAGAAGAAGGCTGAGGG + Intergenic
945155438 2:206832850-206832872 TAAATGAAGGAGAAGGAGGAAGG - Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945502499 2:210593372-210593394 AAACAGCAGCAGGAGAAGGAGGG + Intronic
945580406 2:211587443-211587465 ACACAGAAGCATAGGGAGAATGG + Intronic
945629998 2:212262649-212262671 TAAAAGAAGAAGAAGGAGTAAGG + Intronic
945853199 2:215034706-215034728 AAACAGAAGCTTAAGGAGGCTGG - Intronic
945911779 2:215658119-215658141 AAACACAACCAGAAGAAGGCAGG + Intergenic
945987532 2:216367315-216367337 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
946085041 2:217162433-217162455 AAAGGGAAGCAGGAGGATGAAGG + Intergenic
946192724 2:218016019-218016041 AAAGTGCAGGAGAAGGAGGAAGG + Intergenic
946363823 2:219236232-219236254 AAACAGAAATGGCAGGAGGAGGG + Intronic
946388887 2:219403824-219403846 AAATGGAGGCACAAGGAGGAAGG + Intergenic
946410907 2:219514773-219514795 AAACCCAAGGAGAAGGAGGCAGG + Exonic
946507835 2:220320549-220320571 AAACATAAGCTCCAGGAGGATGG - Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946938433 2:224746013-224746035 AAACAAAAGAAGAAGGATGCTGG - Intergenic
946960193 2:224976825-224976847 AAACAAAAGAAGGAGGAAGAGGG - Intronic
946978400 2:225178480-225178502 AAACAGAAGCATTAGGGAGAAGG - Intergenic
947085906 2:226452600-226452622 AGAAAGAAACTGAAGGAGGAGGG + Intergenic
947147019 2:227077700-227077722 AAAAAAAAAAAGAAGGAGGAGGG + Intronic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947384222 2:229575191-229575213 AAAATGAGGCAGAATGAGGAAGG + Intronic
947561455 2:231157394-231157416 AAACAGAGGCTGAAAGAGGAAGG - Intronic
947569511 2:231221253-231221275 ACACAGACACAGAAGGAAGACGG - Intronic
947598441 2:231429138-231429160 ATACAGAGACAGAAGGAGGGGGG + Intergenic
947658889 2:231852059-231852081 AAAGAGAAAGAGAAAGAGGAAGG - Intergenic
947898268 2:233695418-233695440 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
947970601 2:234319924-234319946 GAAGAGAAGAAGGAGGAGGAGGG - Intergenic
948052502 2:234989230-234989252 AACCCGAAGCTGTAGGAGGATGG + Intronic
948066350 2:235083693-235083715 AAACAGCAGCAGAAAGCAGAGGG + Intergenic
948069716 2:235110642-235110664 AAAGAGAACAAAAAGGAGGAAGG + Intergenic
948096212 2:235336060-235336082 AGAGAAAAGGAGAAGGAGGAGGG - Intergenic
948243089 2:236454985-236455007 AAAGAGAAAAAGATGGAGGAGGG - Intronic
948433709 2:237937620-237937642 AAATAAAACCAGAAAGAGGAGGG + Intergenic
948558597 2:238835356-238835378 AAAAAGAAGGAGAAGGAGAAGGG - Intergenic
948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG + Intronic
948691862 2:239711329-239711351 AAACTGAAGGGGGAGGAGGAGGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
949061272 2:241959182-241959204 AAATAGGACCAGAAGGAAGATGG + Intergenic
1168804865 20:666383-666405 ATACAGAAGGAGAAGGAGGGGGG - Intronic
1168956157 20:1835901-1835923 AAACAGAAGCAGAAACCAGAGGG + Intergenic
1168988664 20:2074206-2074228 AAAAAGAAGAAGAAGAAGAAAGG + Intergenic
1169045541 20:2531884-2531906 GGAGAGAAGGAGAAGGAGGAGGG + Intergenic
1169205271 20:3736300-3736322 AATCAGAATCAGAAGAAGGATGG - Intronic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1169548251 20:6673340-6673362 AGACAGAAGAAGAAGGAAGTTGG - Intergenic
1169765571 20:9144655-9144677 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1170024268 20:11872005-11872027 AAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1170075226 20:12411454-12411476 AAACAGAAGGCAAAGGGGGAGGG - Intergenic
1170158493 20:13289653-13289675 GAAGAGAAGGAGGAGGAGGAGGG + Intronic
1170397590 20:15944288-15944310 AAAAATAAGCAAAAGAAGGAAGG + Intronic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170731101 20:18975435-18975457 AAAAAGAGGAAGAGGGAGGAAGG - Intergenic
1170900573 20:20458625-20458647 AAAGAGAAGGAGAGGGAGCAAGG + Intronic
1171152124 20:22836354-22836376 AAATAGAAGGAAAAGAAGGAAGG - Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1171941201 20:31331462-31331484 AAAATGGAGCAGAAAGAGGAAGG + Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172175909 20:32971703-32971725 AGACTGAAGCAGAAAGAGAATGG - Intergenic
1172365242 20:34344052-34344074 AAAAAGAAGAAGAAGGTGGCAGG - Intergenic
1172511118 20:35501757-35501779 ATATAGAGGCAGATGGAGGATGG - Intronic
1172880735 20:38198423-38198445 AAACAGGATCAGAGGGATGAGGG - Intergenic
1172937399 20:38630040-38630062 AAAAAGAAGGAGGAGGAGGAGGG - Intronic
1173112405 20:40204604-40204626 AAAGAAAGGAAGAAGGAGGAAGG - Intergenic
1173134202 20:40424905-40424927 GAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1173163917 20:40672620-40672642 AAAAAGAAGAAGAAGGTGGGTGG + Intergenic
1173345796 20:42198933-42198955 AAAAAGAAAGAGGAGGAGGATGG - Intronic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1174020008 20:47522487-47522509 ATACAGAGACAGAAGGAGGGGGG + Intronic
1174215623 20:48914100-48914122 AAACAGAAGAAGAGGCAGAAAGG + Intergenic
1174559386 20:51419169-51419191 AAACAGCTGCAAAAGGAGGTTGG - Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174663027 20:52231583-52231605 AAAGAGAAGGAGGAGGAGAAGGG - Intergenic
1175319343 20:58074399-58074421 AAGCAGAAAGAGAGGGAGGAGGG + Intergenic
1175433051 20:58920703-58920725 ATACAGAGACAGAAGGAGGGGGG + Intergenic
1175498893 20:59435408-59435430 AAACAGCAGCAGGATGAGGAGGG + Intergenic
1175607038 20:60319502-60319524 CAACAGAACCGCAAGGAGGAAGG - Intergenic
1175653051 20:60745392-60745414 AATCCTAAGCAGATGGAGGAGGG - Intergenic
1175844057 20:62049421-62049443 AGACAGAATCAGAAAGAGGGCGG - Intronic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1176170391 20:63693944-63693966 AAACAGAGGCAGAAACAGGGAGG - Intronic
1176387602 21:6146572-6146594 AAACAGAAGCAGTAGGAGACGGG + Intergenic
1176847845 21:13890417-13890439 ATACAGAAGGAGTAGGAGCAAGG + Intergenic
1176849218 21:13900176-13900198 ATACAGAAGGAGTAGGAGCAAGG + Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177168611 21:17630636-17630658 AAAAAAAAGAAGAAGGAAGAAGG - Intergenic
1177249359 21:18572220-18572242 AAGCAGGAAGAGAAGGAGGATGG + Intergenic
1177259938 21:18716663-18716685 AAACAAGAACAGAAGAAGGAAGG + Intergenic
1177322245 21:19537658-19537680 AAACAGACACAGAAGGAGTCAGG + Intergenic
1177386577 21:20417205-20417227 AAACAGAAAGGGAAGGAGGTAGG - Intergenic
1177418847 21:20828741-20828763 AAACAGAAGCAAAGTTAGGAAGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177833075 21:26161443-26161465 AGACAGAATAAAAAGGAGGAAGG - Intronic
1177923340 21:27182613-27182635 AAACAGAACAAAAAGGTGGAGGG - Intergenic
1178071471 21:28972721-28972743 AAACAAGAGAAGAATGAGGAAGG + Intronic
1178127444 21:29530242-29530264 AAAAAGAAGAAGAAGAAGAAAGG - Intronic
1178150823 21:29791483-29791505 ACAAAGAAGAAGAAGGAGAAGGG + Intronic
1178150947 21:29793107-29793129 AAACATATTCAGGAGGAGGATGG + Intronic
1178291661 21:31373638-31373660 AAACAGAAAGAGAGGCAGGAGGG + Intronic
1178496222 21:33088700-33088722 AAAAAGAAGGAGAAAAAGGAGGG + Intergenic
1178699092 21:34818468-34818490 ATTCAGAACCAGAAGGAGGGGGG - Intronic
1178813485 21:35905731-35905753 AAACAGAAAAAGCAGAAGGAAGG + Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179158486 21:38872814-38872836 AACCAGCAGCAGTTGGAGGAGGG - Intergenic
1179173360 21:38990194-38990216 ACAAAGAAGTAGAAGGAGAAGGG + Intergenic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179189651 21:39112823-39112845 GAAAAGGAGGAGAAGGAGGATGG + Intergenic
1179244793 21:39623282-39623304 AAAGAGAAACAGAGGAAGGAAGG - Intronic
1179305091 21:40146289-40146311 TCAGAGAAGTAGAAGGAGGATGG + Intronic
1179645975 21:42776430-42776452 AAACAAAAGCAGAAACAAGAAGG - Intergenic
1179735870 21:43391676-43391698 AAACAGAAGCAGTAGGAGACGGG - Intergenic
1180179703 21:46112440-46112462 AACCAGAACCTGAAGGAGCAGGG + Exonic
1180593898 22:16961608-16961630 ATACAGGAGCAGAAGGTGAAGGG - Intergenic
1181301013 22:21881215-21881237 AAAAAGAAGAAGAAGAAAGAAGG + Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181577174 22:23802435-23802457 AGACAGAAGGAAAAGGAGGAGGG - Intronic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1181779642 22:25183525-25183547 AAACAAAAAAAGAAGAAGGAAGG - Intronic
1181896385 22:26111583-26111605 AAAAAGAAGGAGAAGAAGGAGGG - Intergenic
1182099525 22:27648162-27648184 AAGAAGGAGAAGAAGGAGGAGGG + Intergenic
1182488372 22:30653363-30653385 AAAAAAAAAAAGAAGGAGGAAGG - Intronic
1182512936 22:30832007-30832029 AAAGAGGAGCAGGAGGAGAAAGG - Intronic
1182590656 22:31377147-31377169 ATACAGAAACAGAAGGAGGGGGG + Intergenic
1182677143 22:32048247-32048269 ACACAGAAGAAGAGGGAAGATGG + Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182773989 22:32817590-32817612 GACCAGAAGAAAAAGGAGGAAGG + Intronic
1182910190 22:33977587-33977609 AAAGTGAAGCAGAATGAAGATGG - Intergenic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183044739 22:35210816-35210838 CTACAGAAGCAGAAGGAAAATGG + Intergenic
1183063511 22:35349169-35349191 AAACTGAGGCTGAGGGAGGAAGG + Intergenic
1183385404 22:37511373-37511395 AAAAAGAAGAAGAAGGAGAAGGG + Intronic
1183653451 22:39171875-39171897 AAACACAGGCAGACGGGGGATGG - Intergenic
1184281754 22:43441410-43441432 TCACAGAAGCTGCAGGAGGAAGG - Intronic
1184372980 22:44094447-44094469 AGGCAGAGGCAGAAGGAGCAGGG + Intronic
1184570624 22:45322091-45322113 ACACAGGAGCAGATGAAGGATGG - Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1184989903 22:48160292-48160314 AGAAAGAAGAAGGAGGAGGAGGG + Intergenic
1184992701 22:48181668-48181690 AAACCAAAGCACAGGGAGGAGGG + Intergenic
1185178593 22:49346455-49346477 ACACAGAGGCAGGAGGAAGATGG + Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949639326 3:6017116-6017138 AGACAGAAGAAGAGGGAGGGAGG + Intergenic
949758638 3:7443030-7443052 AAAGAGGAGGAGGAGGAGGATGG - Intronic
949830770 3:8211793-8211815 AAACGGAGGCAGAAGGGGCAAGG + Intergenic
949934890 3:9108922-9108944 AAACAGCAGAAAGAGGAGGAAGG + Intronic
950109711 3:10411178-10411200 ACACAGACACAGAAGGATGATGG + Intronic
950130054 3:10536466-10536488 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
950354115 3:12389527-12389549 AAATGGAAGCAGAAGGATAATGG + Intronic
950358222 3:12429569-12429591 AAAAAGAAGCAGGTGGAGGAAGG + Intronic
950360793 3:12448235-12448257 AAAAAGAAAAAGAAAGAGGAAGG + Intergenic
950850280 3:16055640-16055662 AAAGAGAAGCAGAAAGTGAAAGG - Intergenic
950904913 3:16529464-16529486 AAACAGAATCAGACAGAAGAGGG - Intergenic
951152551 3:19308827-19308849 AGAAAGAGGGAGAAGGAGGAGGG - Intronic
951568563 3:24038007-24038029 AAACAGAAGCCAAGGGATGAAGG - Intergenic
951717252 3:25663465-25663487 TAACTGCAGCGGAAGGAGGAAGG - Intronic
951795925 3:26538228-26538250 AAAGGGAAGGAGAAGGGGGAGGG + Intergenic
951856308 3:27200926-27200948 AAACAGAAGGGGAAGTGGGAGGG + Intronic
952064277 3:29549046-29549068 AAAAAAAAACAGAAGTAGGAGGG - Intronic
952449124 3:33414271-33414293 AAAAAGAAAGAGAGGGAGGAGGG + Intronic
952708873 3:36408648-36408670 ATTCAGAAGCAGAAGAATGATGG - Intronic
952843976 3:37671308-37671330 AAACAGATGAGGCAGGAGGAGGG + Intronic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953237628 3:41120211-41120233 AAACAGAAACAGAAGGAAGGAGG - Intergenic
953411470 3:42692746-42692768 AAAGAGAAGCCGGAGTAGGAGGG - Exonic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
953700958 3:45195407-45195429 AAAGAGAAGGAAAGGGAGGAAGG - Intergenic
953794729 3:45975874-45975896 AAACATGTGCAGAAGGAGGAAGG + Intronic
953843111 3:46405861-46405883 AAAAAGAAGAAGGAGGAGGAGGG - Intergenic
953886602 3:46717732-46717754 CAACAGAAGCAGCAGCAGCAGGG + Exonic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954214981 3:49119673-49119695 AAATAGAAGGTGGAGGAGGAAGG + Intronic
954871491 3:53770748-53770770 AAACAGAAGAGAAAGCAGGAAGG + Intronic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955406631 3:58629850-58629872 AGAGAGGAGGAGAAGGAGGATGG + Intergenic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
955730488 3:61980486-61980508 AGAAAGAGGGAGAAGGAGGAGGG + Intronic
955731872 3:61995760-61995782 AAAAAGAAAAAGAAGGAGGGAGG - Intronic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
956010825 3:64829795-64829817 AGACAGAAAGAGAAGAAGGAAGG - Intergenic
956014520 3:64867525-64867547 AAAAAGCCGCAGAAGCAGGAAGG - Intergenic
956225053 3:66947861-66947883 AAAATGAAGCAGAAAGTGGAAGG - Intergenic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
956989308 3:74745077-74745099 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
957047336 3:75386185-75386207 AGAAAGAAGGAGAAGAAGGAAGG + Intergenic
957379191 3:79403121-79403143 AAACAGAAACAGAGGGTGGGAGG - Intronic
957379941 3:79414217-79414239 AAAGAGAAAGAGAAAGAGGAGGG - Intronic
957641786 3:82862480-82862502 AAACAGAATCAGAAAGATCAGGG + Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
957947061 3:87078465-87078487 TAACAGAAGCAGAAATGGGAAGG + Intergenic
958255887 3:91324414-91324436 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
958667161 3:97155904-97155926 AACCAGAAGCAGAAGAGAGATGG - Intronic
958759247 3:98288191-98288213 AAAAAGAAGAAGAAGAAGAAGGG - Intergenic
958844738 3:99252834-99252856 AAACAGAAGCAGATGAAATAAGG + Intergenic
958867658 3:99519684-99519706 AAAGAGGAGGAAAAGGAGGAGGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959426300 3:106193046-106193068 AAAATGAAGTAGAAGAAGGAAGG - Intergenic
959437211 3:106330613-106330635 AAACAGAACCAGCAGGAGGTAGG - Intergenic
959463043 3:106650552-106650574 AAAAAAAAGCAGATGGAAGAAGG - Intergenic
959526301 3:107381248-107381270 AAACAGGAGCAGAGGGCGGGGGG + Intergenic
959563111 3:107805159-107805181 AGACAGAATGGGAAGGAGGAAGG + Intronic
959611331 3:108298194-108298216 TGACAGAAGAATAAGGAGGAAGG - Intronic
959627641 3:108471038-108471060 AAAGAAAAGGAGAAAGAGGAAGG + Intronic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
959971765 3:112417533-112417555 AGACATAAGCAGCAAGAGGAGGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960110415 3:113839474-113839496 AAACCAATGTAGAAGGAGGATGG - Intronic
960166570 3:114409490-114409512 AAACAGAAGCAGCTGAAGGAAGG + Intronic
960168491 3:114431143-114431165 GTACAGAAGAAGAAGGAGGAAGG + Intronic
960389773 3:117063442-117063464 AAACAGAAGCCCAGAGAGGAGGG - Intronic
960845557 3:122001399-122001421 AATCAGCAGCAGGAGGAGGAGGG + Exonic
960906441 3:122606459-122606481 AAACACAGGAAGAATGAGGAGGG + Intronic
960992251 3:123319614-123319636 AACCAGGACCAGGAGGAGGAGGG - Intronic
961000916 3:123373462-123373484 AAACAGAACTGGAAGGATGAAGG + Intronic
961073848 3:123963572-123963594 AAACAGAACCTGAAGCTGGAGGG - Intergenic
961228049 3:125271815-125271837 TAAAAGAACCAGAAGGAGGCAGG - Intronic
961309713 3:125988239-125988261 AAACAGAACCTGAAGCTGGAGGG + Intergenic
961616937 3:128189845-128189867 AAAAGGAAGTAGAAGGAGGCTGG - Intronic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962390009 3:134963181-134963203 GTACAGAAGAAGAAGGAAGAAGG - Intronic
962433625 3:135344769-135344791 AAACAGAAGCTATAGCAGGAGGG - Intergenic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
962769688 3:138600898-138600920 AAAAAGAAGGAGGAGAAGGAGGG + Intergenic
962916945 3:139912774-139912796 AACCATAAGCAAAAGTAGGAAGG - Intergenic
962938075 3:140100000-140100022 AAAACGAAGGAGAAAGAGGATGG - Intronic
963431287 3:145207688-145207710 AAAAAGAAAAAGAAGGAGGGAGG + Intergenic
963600949 3:147378431-147378453 AAAGAGGAGGAGGAGGAGGATGG + Intergenic
963928714 3:150979190-150979212 GGAGAGAAGCAGAAGGAGTAGGG + Intergenic
964367812 3:155968439-155968461 GAACAAAAGGAGAAGGAGGTTGG + Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964472791 3:157072159-157072181 AAAGAAAAGGAGGAGGAGGAAGG + Intergenic
964548569 3:157861607-157861629 ACATAGAAGCAGAAGAAGGGTGG + Intergenic
964561097 3:157997421-157997443 AAGTAGAAGCAGAAGGCAGAAGG - Intergenic
964585501 3:158294773-158294795 AAACAGTAGTATTAGGAGGAAGG - Intronic
964619009 3:158702004-158702026 AAACAAATGCAGAGGGAGAATGG - Intronic
964817236 3:160730197-160730219 AAACAGAAGCACAAGCAGTGAGG + Intergenic
964846546 3:161050122-161050144 AAACAGTATCAGAAGGAACAGGG - Intronic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
964938063 3:162119011-162119033 AAACAAAAGCAGAAAGAAAATGG - Intergenic
965099398 3:164277427-164277449 ATACAGAGACAGAAGGAGGAGGG + Intergenic
965151398 3:164981293-164981315 AAACAGCAGTAGCAGTAGGATGG + Intronic
965263071 3:166507850-166507872 AGAAAGAAGTAGAAGGAGAAAGG - Intergenic
965329155 3:167348379-167348401 AAAGAAAAGAAGAAGGAGGGAGG + Intronic
965617141 3:170606102-170606124 AAAAAAAAGAAGAAGAAGGAAGG - Intronic
965743060 3:171897129-171897151 GAACAAAAGCAGAGGTAGGATGG - Intronic
965783851 3:172315983-172316005 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
966502550 3:180659474-180659496 GAACAGATGCAGAAGAGGGATGG - Exonic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966668959 3:182505777-182505799 AAACTGAAGCTGAAGAAGGACGG - Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966759767 3:183407550-183407572 AAAAAGAAGCAGAAGAAAGAGGG - Intronic
966809789 3:183833361-183833383 CAACGGAAGCAGAAGCAGGTGGG - Intronic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
967211101 3:187169926-187169948 AAACAAAAGCAGAAGGTAAAAGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967510145 3:190301498-190301520 AAAAAGAAGAAGAAGAAGAAGGG + Intergenic
967553894 3:190831862-190831884 AAACAGAAGAAAAAGGACAAAGG + Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968391398 4:195982-196004 AAAGAGAAGCAGAGAGAGAAAGG - Intergenic
968604077 4:1523360-1523382 AAACAGAAGAAGAATGGGGCAGG - Intergenic
968753316 4:2401552-2401574 TCACAGAGCCAGAAGGAGGAGGG - Intronic
969262257 4:6041442-6041464 AAATGGGAGGAGAAGGAGGAAGG - Intronic
969277779 4:6148619-6148641 AAACAGGAGCAGAGGAAGAAGGG + Intronic
969560771 4:7946397-7946419 AAGCAGGAGCAGAAGGATGAGGG + Intergenic
969565500 4:7974811-7974833 AAACAGAACCATTAGGTGGATGG - Intronic
969615843 4:8252233-8252255 AGACAGAGGCAGAGGGAGGTTGG - Intergenic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
969838398 4:9862076-9862098 AAAAAGAAGTAGATGCAGGAAGG + Intronic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
970816278 4:20159960-20159982 AAACAGAACCAGAACCAGTAGGG - Intergenic
970999435 4:22305188-22305210 AAAAAGAAGAATAAGAAGGATGG + Intergenic
971034173 4:22675142-22675164 AAAGAGAAAGAGAGGGAGGAAGG - Intergenic
971057783 4:22933081-22933103 AAACAGAAGCATAAGAAGAAGGG + Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971166778 4:24191667-24191689 AAAAAGAAGGAAAAGGAGAAAGG + Intergenic
971221080 4:24706475-24706497 AGAGAGAAGAAGAAGGAGAAGGG - Intergenic
971224552 4:24738872-24738894 AAAAAGAAGAAGAAGAAGCATGG - Intergenic
971251264 4:24975321-24975343 AGACAAAAGGAGAAGGGGGAAGG + Intronic
971251415 4:24975986-24976008 AAAAAGAAGGAGAAGGGAGAGGG + Intronic
971386481 4:26145011-26145033 AAAAAGAAGAAGAAGAAGGCAGG - Intergenic
971447062 4:26762172-26762194 AGACAGATTCAGAAGGAGGTAGG + Intergenic
971648748 4:29243262-29243284 AAAAAGAAGGAGGAGGAGAAGGG + Intergenic
972534706 4:39989974-39989996 AAAAAGAAGAAGAAGAAGAATGG + Intergenic
973259234 4:48144470-48144492 AAACAGAAGGAAAAGAAGAATGG + Intronic
973318713 4:48788062-48788084 AAAGTGAAGGAGAGGGAGGAAGG + Intergenic
973628467 4:52795712-52795734 AAGCTGAAGCAGGAGAAGGAAGG + Intergenic
973978731 4:56288210-56288232 AAAGAAGAGCAGGAGGAGGAAGG - Intronic
974074169 4:57153900-57153922 AGAGAGAAGGAGGAGGAGGAGGG + Intergenic
974229280 4:59088959-59088981 AAAAAGAAGAAGGAGGAGGGGGG - Intergenic
974435897 4:61856933-61856955 AAAGAGAAGAAGAAAGAGGGAGG - Intronic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
974677223 4:65108426-65108448 AAAGAGAAGCAGAAGCACTATGG - Intergenic
974753773 4:66176784-66176806 AATGAGAAGGAGAAGGAGAAGGG + Intergenic
974845794 4:67350224-67350246 AAAAAGAGAAAGAAGGAGGATGG + Intergenic
975032762 4:69642383-69642405 AAACAGAAAAAGAAGAAGGAAGG + Intronic
975365937 4:73527562-73527584 AAACAGAAGGAGAGAGAGTAGGG + Intergenic
975501005 4:75084867-75084889 AAAAAGACGAAGAAGAAGGAAGG + Intergenic
975868296 4:78749152-78749174 AAAAAAAATCAGAAGGATGAAGG + Intergenic
975969403 4:80015712-80015734 GAAGAGAAGAAGCAGGAGGAGGG + Intronic
976022540 4:80646750-80646772 AAAGAGAAGCAACAGGAGAAGGG - Intronic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
977148013 4:93471204-93471226 GCACAGAAGCAAAAGAAGGAAGG - Intronic
977340917 4:95756422-95756444 AAACAGAAACAGCAGCATGAAGG - Intergenic
977599077 4:98916298-98916320 AAAAAGGAAGAGAAGGAGGATGG + Intronic
977779935 4:100969121-100969143 AAACAGAGGCAGAGGTGGGAAGG - Intergenic
977858379 4:101924523-101924545 AAACAGAAGCAGAAAGGGTCAGG + Intronic
977876374 4:102155204-102155226 AAACATAAGCAGAAGTAGCTGGG + Intergenic
978105189 4:104893449-104893471 GAACAGAAGGAAAAGAAGGAAGG + Intergenic
978277343 4:106967871-106967893 AAGCAAAAGGAGAAGAAGGAAGG + Intronic
978588549 4:110299598-110299620 AAACAAAACGAGAAAGAGGAAGG + Intergenic
978623094 4:110654160-110654182 AAAAAGAAAAAAAAGGAGGAGGG - Intergenic
978733436 4:112057908-112057930 AAACAAAACCAGAAGAATGAAGG - Intergenic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
979006190 4:115300294-115300316 TCACAGAAGCAGAAGTGGGAGGG - Intergenic
979199874 4:117964523-117964545 AAATGGAAGCTGAAGGATGAGGG - Intergenic
979532569 4:121784821-121784843 ACAAATAAGCAGAAGGAGGTGGG + Intergenic
980091094 4:128443653-128443675 GAACAAAAGCAGGAGGAAGAAGG + Intergenic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
980666299 4:135941160-135941182 AAACAGTAGCAAAAGGAGAGAGG - Intergenic
980784320 4:137532632-137532654 AAAGAGACGGAGAAGGAGGAAGG + Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
980933720 4:139206441-139206463 AAACTGAAGCAGAAGGATAGAGG - Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981369922 4:143948267-143948289 AGAGAGAAGAAGAAGAAGGAAGG - Intergenic
981514009 4:145587709-145587731 AAAAAGGAGAAGAAGGAGAAGGG + Intergenic
981950710 4:150403561-150403583 AAAAAGAAGGGGAAGGAGAAGGG - Intronic
981955570 4:150469052-150469074 AATCAGAAGGAGAAGGAAGTGGG - Intronic
982119722 4:152130993-152131015 AAAAAGGACGAGAAGGAGGAAGG - Intergenic
982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG + Intergenic
982970594 4:161980087-161980109 AAAAAGAAAAAGAAAGAGGAAGG + Intronic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983398703 4:167235210-167235232 AGACAGAAGCATAACGAGGTAGG + Intergenic
983768156 4:171512725-171512747 ATACAGAGGCAGAGGGAAGAGGG - Intergenic
983808381 4:172024068-172024090 AAACCTAAGCAGAATGAGAATGG - Intronic
984218399 4:176943177-176943199 AAAGAGGAGAAAAAGGAGGAGGG - Intergenic
984677622 4:182568380-182568402 AAACAGAATGAGAAGGGGCAAGG + Intronic
984725165 4:183013456-183013478 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
984822038 4:183890497-183890519 AAACAGCAACAGAAGAAAGAGGG + Intronic
984836726 4:184029171-184029193 AAAGAGAAGGAGCAGGAGGTGGG - Intergenic
984883853 4:184432731-184432753 ACACAGACACAGAGGGAGGATGG + Intronic
984886609 4:184455287-184455309 AAAAAAAAGAAGAAGAAGGAAGG - Intronic
985052206 4:186002203-186002225 AAACACTATCAGAAGGACGATGG + Intergenic
985085884 4:186312025-186312047 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
985169095 4:187129120-187129142 AAACAGAAAAGGAAGGAAGAAGG + Intergenic
985345049 4:188995512-188995534 GAGCAGAAGCAGAAGGACAAAGG + Intergenic
985679129 5:1246818-1246840 GAACAGAGGGAGAGGGAGGAGGG - Intergenic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985679994 5:1250943-1250965 GAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
985981983 5:3477665-3477687 AAACAGAAGCTGAGAAAGGATGG + Intergenic
986004287 5:3655011-3655033 AGACAGGAGCAGAAGCAGGGAGG - Intergenic
986009681 5:3700900-3700922 GAAAAGAAGAAGAAGGAGGGAGG - Intergenic
986017551 5:3770916-3770938 AAACAGAAGCAGCTGGAAGTGGG - Intergenic
986199172 5:5565813-5565835 AAACAAAAGCAGATGGAGTACGG - Intergenic
986221734 5:5774775-5774797 AAGTAGGAGGAGAAGGAGGAGGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986350796 5:6877947-6877969 CTACAGAAGAAGAAGGAAGAGGG - Intergenic
986393339 5:7304753-7304775 AAACGGAAGCCCAAAGAGGAGGG + Intergenic
986482652 5:8204350-8204372 TAGCAGAAGGTGAAGGAGGAAGG - Intergenic
986551525 5:8961359-8961381 AACCAAAAGGTGAAGGAGGAGGG - Intergenic
986551773 5:8964181-8964203 AAACACAAGCAGAACCATGAGGG - Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986641504 5:9876133-9876155 AAACAGCTCCAGAAGGATGAGGG + Intergenic
986658387 5:10037510-10037532 AAACAGAGGCAGAAATTGGAGGG + Intergenic
986918260 5:12652309-12652331 ACACAGTAGCTAAAGGAGGAGGG + Intergenic
986989111 5:13531207-13531229 AAAAAAAAGAAGAAGTAGGAAGG - Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987354666 5:17052762-17052784 AACCAGAAGAAGAAAGAAGAAGG - Intergenic
987518601 5:18948261-18948283 AAAGAGAAGAAGGAGAAGGAAGG + Intergenic
987865362 5:23528951-23528973 AAACAGAAGAAAAAGGAGAAAGG + Intergenic
988089614 5:26519699-26519721 AGAAAGAAGGAGAAGGAAGAAGG + Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988427375 5:31079146-31079168 AACCAGAAGCAGATGGAGGGAGG - Intergenic
988454317 5:31373651-31373673 CAACAGAAGCAGGAGGAGGCAGG - Intergenic
988513918 5:31888960-31888982 AAACTGAAGCCGACGGAGGTTGG - Intronic
988563024 5:32298000-32298022 CAACAGAACCAGAAGCAGGCAGG + Intronic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
988683201 5:33503155-33503177 AAATAGAATCTGAAGTAGGAAGG - Intergenic
989159057 5:38372453-38372475 AAAAAGAAGCAGTATGAGGCCGG - Intronic
989557008 5:42808930-42808952 AAACAAAAGAAGAAGAAGAAAGG + Intronic
989709315 5:44378141-44378163 CAACAGCAGCTGAAGGGGGATGG + Intronic
990037926 5:51345481-51345503 GTACAGGAGCATAAGGAGGAGGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990526482 5:56633167-56633189 AAAAAGGAGGAGCAGGAGGAGGG + Intergenic
990721661 5:58702654-58702676 AAACAGGAAAGGAAGGAGGAAGG - Intronic
990767274 5:59198737-59198759 ATACAGAAGTAGAAGAAGGATGG - Intronic
991145776 5:63301950-63301972 AAACAGAGGCAGGTGGAGGGTGG - Intergenic
991210238 5:64096125-64096147 AGACAGTAGAAGAAGGAGGAGGG - Intergenic
991496718 5:67234059-67234081 AAACAGAAACTGATGGAAGAAGG - Intergenic
991651725 5:68862459-68862481 AAACAGCAGTAGAAAGAGGATGG - Intergenic
992085483 5:73274732-73274754 AAACATAAACATAAGGAGGCAGG - Intergenic
992214909 5:74516431-74516453 AAAGAGGAGGAGGAGGAGGATGG - Intergenic
992271502 5:75068883-75068905 AAACATCAGCAGAAAAAGGATGG + Intronic
992588708 5:78270854-78270876 CTACAGAATCAAAAGGAGGAGGG - Intronic
993389295 5:87298425-87298447 AAAAAGAAGAAGAAACAGGAAGG + Intronic
993415731 5:87627766-87627788 AAAATGAAACAGAATGAGGAGGG + Intergenic
993427398 5:87784898-87784920 AGACAGAGGGAAAAGGAGGAAGG + Intergenic
993766621 5:91867046-91867068 AAACAGAAGCAGACGGAAGGAGG - Intergenic
993835301 5:92812476-92812498 AAAGAGGAGCAAAAGGAAGAAGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994302719 5:98165073-98165095 AAGCAGAAGCAGAAGGGGAAGGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
994913679 5:105945617-105945639 AAAAAGAAGAAGAAAGAAGAGGG + Intergenic
995016788 5:107318875-107318897 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
995082623 5:108071561-108071583 GAACAGGAGGAGAAGGAGGTGGG - Intronic
995085943 5:108109234-108109256 AGAAAATAGCAGAAGGAGGAAGG + Intronic
995493763 5:112720537-112720559 AAACAGAGGCCCAAGGAAGATGG + Intronic
995541282 5:113188553-113188575 ACACAAAAGCAGAAAGGGGAAGG + Intronic
996064748 5:119068418-119068440 AAACAGGAACAGGAGGATGAGGG + Intronic
996116192 5:119622305-119622327 AAACAGAAAGAGAAGAAAGAAGG - Intronic
996262621 5:121492119-121492141 ACACAGAAGCAGAAAGTGAAAGG - Intergenic
996814600 5:127560836-127560858 ACACAGAAGCAGAAGAGGCAAGG - Intergenic
996947448 5:129087713-129087735 AAAGAGAAGAAAAAGGAGGCAGG + Intergenic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
998034909 5:138906991-138907013 AGAAAGAAGGAGGAGGAGGAAGG - Intronic
998151788 5:139761722-139761744 AAACAGCACCAGATGGAGGCCGG - Intergenic
998408554 5:141889238-141889260 AGACCAAAGCAAAAGGAGGAAGG - Intergenic
998549864 5:143067035-143067057 AAGCAGAAGCGGGAGGGGGAGGG - Intronic
998597683 5:143550767-143550789 AAAAAGAAGGAGGAAGAGGAGGG - Intergenic
998690153 5:144579286-144579308 AAAAAGAAGAGGAAGAAGGAGGG + Intergenic
998765100 5:145477838-145477860 AAAGAGAAGGAGGAGGAGAAAGG + Intronic
998936720 5:147236795-147236817 AATCAGAAAGAGAAAGAGGAAGG - Intronic
999081481 5:148848312-148848334 GAACAGAAAAGGAAGGAGGAAGG - Intergenic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999137293 5:149330632-149330654 AACCAGAATCAATAGGAGGAAGG + Intronic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999376615 5:151091176-151091198 AAAAAGAAGAAGAAGCAGAAAGG - Intronic
999432729 5:151538105-151538127 AAAGAGAAGCAGAGAGAGGGAGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999625194 5:153513205-153513227 AAACAGAAGCTTAAGCAGAAGGG + Intronic
999782315 5:154859177-154859199 AAACAAAAACAGAAGAAGAATGG + Intronic
1000010112 5:157223132-157223154 GAGCAGAGGCAGAAGGAAGAGGG + Intronic
1000018512 5:157299425-157299447 GAAAAGAAGCTGAAAGAGGAGGG - Intronic
1000024422 5:157346491-157346513 AAACAGAGGCAGAGAGTGGAAGG + Intronic
1000040509 5:157481364-157481386 ACACAGAAGAAGTACGAGGAGGG + Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000363388 5:160468361-160468383 AGACAGTAGCACAACGAGGAGGG + Intergenic
1000850429 5:166333294-166333316 AAAGAGAAGCAGCAGGAGCCAGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001456422 5:171864114-171864136 AAACAGAAGCAAAGGGAGTGTGG + Intronic
1001543710 5:172557110-172557132 GAGCAGAAGCAGGAGGAGGGAGG - Intergenic
1001656814 5:173357263-173357285 AAACTGAAGCAGAAAGAGTTAGG - Intergenic
1001699076 5:173693813-173693835 CACCAGAAGCTGGAGGAGGAAGG + Intergenic
1001737804 5:174021087-174021109 AGAAAGAAGAAGAAGAAGGAAGG + Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001887227 5:175303958-175303980 AATGAGTAGCGGAAGGAGGAAGG - Intergenic
1001991046 5:176115533-176115555 GCACAGAAGTAGAGGGAGGAGGG - Intronic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1002352440 5:178592412-178592434 GAGCAGAGGCAGAAGGAAGAAGG + Intergenic
1002554102 5:180020780-180020802 ACACAGAGGCAGAAGGGGGGTGG + Intronic
1002621880 5:180494135-180494157 GAACAGAAGGAGACGAAGGATGG + Intergenic
1002746687 6:63169-63191 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003315853 6:5011350-5011372 AAAGAGACACAGCAGGAGGAAGG + Intergenic
1003358694 6:5402103-5402125 AAAAACAACCAGAAGGAGGATGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003664922 6:8102148-8102170 AAACAAAACCAGTTGGAGGAGGG - Intronic
1003714239 6:8628617-8628639 AGACAGAAAGAGAAGAAGGAAGG - Intergenic
1003868884 6:10386047-10386069 AACCAGGAGGAGGAGGAGGAGGG + Intergenic
1004002042 6:11604802-11604824 AAAAAGAAGAAGAAGAGGGAGGG + Intergenic
1004257992 6:14082638-14082660 AAACAGAAGCTGCAGGTGAATGG + Intergenic
1004275814 6:14234180-14234202 CCACAGAAGCAGAGGCAGGAAGG + Intergenic
1004290074 6:14358745-14358767 AAACAGAAACAGAGAAAGGAAGG - Intergenic
1004357463 6:14942496-14942518 AGAAAATAGCAGAAGGAGGAAGG + Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004404982 6:15324481-15324503 AAAAAGAAGAAGAAAAAGGAGGG - Intronic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004680609 6:17890616-17890638 AAAAAAAAGAAGAAGGAGAAGGG - Intronic
1004798494 6:19116728-19116750 AACCAAAATTAGAAGGAGGAAGG + Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005088499 6:22032073-22032095 AAAAAGAAGAAGAAGGAAGCGGG - Intergenic
1005125480 6:22442220-22442242 GAAAAAAAGCAGAAGCAGGAAGG + Intergenic
1005369922 6:25121791-25121813 AAAGAGAAAAGGAAGGAGGAAGG + Intergenic
1005516330 6:26558081-26558103 AAAAAGAAGAAGAAGAAGAAAGG - Intergenic
1005631067 6:27708455-27708477 AAACAGAAAGAGAGGAAGGAAGG - Intergenic
1006109310 6:31735142-31735164 AAACCCAAGCAGAAGGGAGAGGG + Intronic
1006617746 6:35341380-35341402 AAAGAGAAGCAGAAAGAAGGGGG + Intergenic
1006677579 6:35775579-35775601 AAAAAAAAGCAGAAGCAGGCAGG + Intergenic
1006953965 6:37850183-37850205 AAACATAACCAGAAGCAGGATGG + Intronic
1007071868 6:39043828-39043850 GAAGAGAAGCAGGAGGTGGAGGG + Intergenic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007479790 6:42142419-42142441 AAAAAGAAGCAGACGGTGCAGGG - Exonic
1007828922 6:44623225-44623247 AGAAAGAAGAAAAAGGAGGAAGG - Intergenic
1007829056 6:44624490-44624512 AATGAGAACCTGAAGGAGGAGGG + Intergenic
1008065540 6:47043857-47043879 GAAAACAAGCAGAAGGAGAATGG - Intergenic
1008246763 6:49184690-49184712 AAAAAGAAGAAGAAGGAGGTGGG - Intergenic
1008443147 6:51556020-51556042 GAACAGAAAGGGAAGGAGGAAGG + Intergenic
1008664336 6:53701243-53701265 TAGCAGAAGCAGAAGCATGAAGG - Intergenic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009051891 6:58285443-58285465 AAAGAGAAGAAGCAAGAGGAAGG - Intergenic
1009056767 6:58345716-58345738 AAACTGAAGCAAATGGTGGAAGG + Intergenic
1009187940 6:60596174-60596196 AAAAATAAGAAGAAGGAAGAAGG - Intergenic
1009234475 6:61105856-61105878 AAACTGAAGCAAATGGTGGAAGG - Intergenic
1009321660 6:62298070-62298092 AAATAGAAGCAGGAGGATCAAGG + Intergenic
1010327692 6:74583998-74584020 AAAAATGATCAGAAGGAGGAAGG + Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010932521 6:81819656-81819678 AAACAGAAGCCCAAGGATGAAGG - Intergenic
1011041840 6:83038064-83038086 AAAAAGAAGAAGAAGAAAGAAGG + Intronic
1011096606 6:83673165-83673187 TAACAGAAAGAGAAGAAGGAAGG - Intronic
1011421332 6:87176540-87176562 AGAAAGTAGCAGAAGCAGGAAGG - Intronic
1011492852 6:87910492-87910514 ACACAGAATCAGCAGGAGGATGG + Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011749400 6:90440009-90440031 AAAAAGAAAAAGAAAGAGGAAGG - Intergenic
1012069202 6:94590700-94590722 AAACAGAAGTAGAAGGACTCTGG + Intergenic
1012123819 6:95400869-95400891 CAACAGCAGCAGATGGAGAAGGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1012817182 6:104039096-104039118 AAACGGGAGCAGAAGGCAGAAGG + Intergenic
1012849846 6:104433311-104433333 TGACAGAAGAACAAGGAGGAAGG + Intergenic
1013312084 6:108904656-108904678 AAAAAGAAGAAGAAGAAGGAAGG + Intronic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1013382138 6:109585122-109585144 AAAAAGAAGAAGAAGAAGCAAGG - Exonic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013504476 6:110786083-110786105 AAACTAAAGCAGACGGAAGAAGG - Intronic
1013719520 6:113007163-113007185 AAACAGTAGCAGATGGACGAAGG + Intergenic
1014103075 6:117533168-117533190 AAACAGTTGCAGAAGGCAGAAGG - Intronic
1014166966 6:118236214-118236236 AAAGAGAAGGAGAGGGAAGAAGG - Intronic
1014187979 6:118457595-118457617 AAACAAAAACAGAAGGCGGGTGG - Intergenic
1014207566 6:118672779-118672801 AGAAAGAAGAAGGAGGAGGAAGG + Intronic
1014650212 6:124027006-124027028 AAACAGAAGAGGAAGTAGGAGGG - Intronic
1014740606 6:125144143-125144165 AAACAGAGGGAGAAGAAAGAAGG - Intronic
1014869563 6:126576256-126576278 AAACAGAGGCAGAAGAAGAAAGG - Intergenic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1014940262 6:127429834-127429856 AAACAATAACAGAAGGAGGCTGG + Intergenic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015452642 6:133388929-133388951 GAGCAGAAGCAGAAGGACGTGGG - Intronic
1015492360 6:133839967-133839989 ACACAGAAGTAGAAGGAAGAAGG - Intergenic
1016010233 6:139131934-139131956 AAACAAAATGAAAAGGAGGAAGG - Intergenic
1016114526 6:140263401-140263423 GAACATGAGCAGAAGAAGGAGGG - Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016464698 6:144313907-144313929 AAACAGAAGCATGAGGAAAAGGG - Intronic
1016694479 6:146976755-146976777 AAAGAGAAGAAGAAGGATGGGGG - Intergenic
1016987477 6:149905929-149905951 AAAAGGAAGCAGAAGCAGAAAGG + Intergenic
1017175539 6:151500374-151500396 AAAAAGAAACAGAAGGAATAGGG + Intronic
1017258122 6:152357499-152357521 AAACAGCAGAAGATGGAGGAAGG - Intronic
1017297204 6:152811910-152811932 AAAGAAAAGGAGGAGGAGGAAGG - Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017567097 6:155699258-155699280 AAAGAGAAAAAGAAGAAGGAAGG - Intergenic
1017586939 6:155936875-155936897 AAATAGAGAGAGAAGGAGGAGGG + Intergenic
1017587444 6:155942789-155942811 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1017757974 6:157545682-157545704 AAAAAAAAGTAGAAGGAGGGTGG + Intronic
1017803098 6:157916403-157916425 AAACAGAAGTAGAAGGCCCATGG - Intronic
1017807539 6:157958695-157958717 AAACCAAAGCAGAAGGTGCATGG - Intergenic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018469760 6:164084982-164085004 AAAAAGAAGAAGAAGAAGAAAGG - Intergenic
1018623884 6:165758688-165758710 AGAAGGAAGGAGAAGGAGGAGGG + Intronic
1018788267 6:167125683-167125705 AAGCAGAACCAGAAGAAAGAGGG - Intronic
1019363744 7:619756-619778 AAACAGAAGCACAAAGAAGAGGG - Intronic
1019465901 7:1188775-1188797 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1019484141 7:1280823-1280845 AGAAGGAAGAAGAAGGAGGAAGG + Intergenic
1019484170 7:1280976-1280998 AGAAGGAAGAAGAAGGAGGAAGG + Intergenic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1020011358 7:4807556-4807578 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011369 7:4807594-4807616 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011514 7:4808087-4808109 GAAGAGAGGAAGAAGGAGGAGGG - Intronic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1021104545 7:16622030-16622052 AAAAAGAAGAAGAAGAAAGAAGG + Intronic
1021289378 7:18823983-18824005 AAGAAGAAGAAGAAGGAGAAGGG + Intronic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021904279 7:25317682-25317704 AAAAAGGAGCAGTTGGAGGAAGG + Intergenic
1021990278 7:26134644-26134666 AAACAGGAGCAAAAGAATGAAGG - Intergenic
1022047255 7:26631763-26631785 GCACAGAAAAAGAAGGAGGATGG + Intergenic
1022094306 7:27129591-27129613 AAATAGAAGGCCAAGGAGGAGGG + Intronic
1022303801 7:29127607-29127629 AAAAAACAGCAGAAGCAGGAAGG + Intronic
1022636599 7:32142178-32142200 AGGCAGAAGGAGAAGGGGGAAGG + Intronic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023030492 7:36086601-36086623 AACCAGTAGCAAAAGGAAGAGGG + Intergenic
1023149127 7:37183190-37183212 GCACAGAAGGAGAAGGAGGAAGG + Intronic
1023188993 7:37559153-37559175 AAAAAGAAAGAGAAGGAGGAGGG - Intergenic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023654958 7:42410068-42410090 AAACAGAAGGGGAAAGAGAAGGG - Intergenic
1023795728 7:43790301-43790323 AACCAGGAGCAGAAGCAGGAGGG - Intronic
1024135769 7:46406529-46406551 AAACACAATCAGAAGTTGGAGGG - Intergenic
1024230158 7:47357740-47357762 AAACTGCAACAGAAGGCGGAAGG + Intronic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024450689 7:49539419-49539441 ACGCAGAAGCAGAAGGAGATGGG + Intergenic
1024450934 7:49542291-49542313 GAACTGAAGCAGAAGGAGATGGG + Intergenic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1024961435 7:54980922-54980944 AGAGAGAGGCATAAGGAGGAAGG + Intergenic
1024991784 7:55240435-55240457 AAGAAGAGGCAGAAGGAGAAAGG - Intronic
1024999546 7:55303652-55303674 AAAAAGAAGAAGAAAGAAGAAGG + Intergenic
1025111452 7:56220129-56220151 AAAGAGAGGAAGGAGGAGGAGGG + Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1025733882 7:64130089-64130111 AAACAAAAGAAGAAGACGGATGG + Intronic
1025994325 7:66518604-66518626 GGACAGAGGCAGCAGGAGGAGGG - Intergenic
1026104170 7:67407903-67407925 ACACAGAAGGAGAAGGAAGTGGG - Intergenic
1026159714 7:67858003-67858025 AAACAAAAGAAGAAGACGGATGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG + Intergenic
1026985935 7:74555293-74555315 GGACAGAGGCAGCAGGAGGAGGG - Intronic
1026997272 7:74626003-74626025 AAAAAGAAGAGAAAGGAGGAAGG - Intergenic
1027001496 7:74657694-74657716 AAAAAGGAGGAGGAGGAGGAGGG + Intronic
1027253504 7:76414682-76414704 AAAAAAAAGGAGGAGGAGGAGGG - Intronic
1027505229 7:79009006-79009028 AAAAAAAAGGAGAAGGAAGAGGG - Intronic
1027532344 7:79352527-79352549 AAGCAGAAGCATGAGGGGGAAGG + Intronic
1027587545 7:80076642-80076664 AAACCCAAGCAGAGTGAGGAGGG + Intergenic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1028070824 7:86448032-86448054 AAAAAAAAGGAGGAGGAGGAGGG + Intergenic
1028109462 7:86921390-86921412 ACACAGACCCAGAGGGAGGACGG + Intronic
1028246673 7:88487374-88487396 AAAGAGGAGGAGAAGGAGAAGGG + Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028696374 7:93717712-93717734 AAAGAGAAAGAAAAGGAGGAAGG + Intronic
1028930119 7:96403726-96403748 AAACAAAAACAAAAGCAGGAAGG + Intergenic
1029377788 7:100191043-100191065 AAACAGAATTATAAGGAGAAAGG - Intronic
1029446584 7:100616392-100616414 AAACAGAGGAAGAGGGAGAATGG + Intergenic
1029459443 7:100686711-100686733 GAACAGGAGGAGGAGGAGGAGGG - Exonic
1029530194 7:101120366-101120388 GAAGAGAAGGAGAAGGAGAAGGG + Intergenic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1030022845 7:105292898-105292920 AAACAGAAGCAGATGTACTATGG - Intronic
1030141935 7:106313223-106313245 AAACAGTAGCATTAGGAAGAAGG - Intergenic
1030190535 7:106806112-106806134 AAATGGAAGGAGAAAGAGGAGGG + Intergenic
1030568564 7:111191938-111191960 AAGCAGGAGCAGGAGTAGGAGGG + Intronic
1030749464 7:113212985-113213007 AAACAGAAGCAGAACAGGCAAGG + Intergenic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1030849877 7:114470797-114470819 AAAAACATGGAGAAGGAGGATGG - Intronic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031374510 7:121007786-121007808 AAAGAGAAGCAGCAACAGGATGG - Intronic
1031537417 7:122952438-122952460 GAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031651444 7:124295589-124295611 AATCAGAAGCAGAGGGACCATGG + Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032210079 7:129905665-129905687 ACACAGAAAGAGAAGGAAGAGGG + Intronic
1032422479 7:131793768-131793790 AAAGAGAAGCAGGGGAAGGAAGG - Intergenic
1032457258 7:132082790-132082812 ACAAAGAAGAAAAAGGAGGAAGG + Intergenic
1032509505 7:132460784-132460806 AAACAAAAGCAGAGGGGGGATGG + Intronic
1032523301 7:132562053-132562075 GAAGAGGAGGAGAAGGAGGAGGG - Intronic
1032523694 7:132563744-132563766 GAAAAGGAGGAGAAGGAGGAGGG - Intronic
1032528107 7:132595282-132595304 AAACAGAGAAAGAAGGAGCATGG + Intronic
1032716098 7:134510580-134510602 ACACACAAGCAGGAGGAGAAGGG - Intergenic
1032952247 7:136928127-136928149 AAAAAGAAGCAGAGGAAGGAGGG + Intronic
1033028910 7:137806102-137806124 AAACAGACGCTAAAGAAGGATGG - Intronic
1033189001 7:139259303-139259325 AAGCGGAAGCGGAAAGAGGAAGG + Exonic
1033282300 7:140014913-140014935 AAAAAGAAGAAGAAGAAAGAAGG + Intronic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033555619 7:142486457-142486479 AAACATTAGGAGAAGGAGGAGGG - Intergenic
1033560465 7:142525985-142526007 AACCATTAGGAGAAGGAGGAGGG - Intergenic
1033639495 7:143247611-143247633 AGAGAAAAGAAGAAGGAGGAAGG + Intronic
1033889594 7:145994978-145995000 AAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1033978563 7:147133565-147133587 AGACAGAAGAAAAAGGAGCATGG - Intronic
1034251554 7:149695535-149695557 AAAAAGAAGAAGAAGAAGAAAGG + Intergenic
1034282731 7:149865085-149865107 AAACTGAGGCACAAAGAGGAAGG - Exonic
1034319797 7:150169401-150169423 AAAAAGAAGAAGAAGATGGAGGG + Intergenic
1034354421 7:150441866-150441888 AAGCAGAAGGAGAAGGAGAAGGG - Intergenic
1034772954 7:153797825-153797847 AAAAAGAAGAAGAAGATGGAGGG - Intergenic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034978920 7:155463489-155463511 AAAGAGAAGGAGGAGGAGGAAGG - Exonic
1035138942 7:156737894-156737916 AGACTGAAGCAGTAGGAGGGCGG + Intronic
1035181473 7:157092439-157092461 AAAAAGAAGCAAAAGCTGGAAGG + Intergenic
1035412577 7:158656955-158656977 GCACAGAAACAGAAGGATGAGGG - Intronic
1035752462 8:2005935-2005957 AACCGGAAGGAAAAGGAGGAAGG - Exonic
1036587731 8:10140331-10140353 AGAAAGCAGCAGAAGCAGGAAGG - Intronic
1037064860 8:14565720-14565742 AAACATATCCAGAAAGAGGAGGG + Intronic
1037156760 8:15710111-15710133 AAATAGAAGAAAAAGGAGGTAGG - Intronic
1037218213 8:16484051-16484073 AAAGAGAAGGAGAAGAAGAAAGG + Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037277720 8:17199666-17199688 GAAAAGAAGAAGAAGAAGGAGGG - Intronic
1037277727 8:17199745-17199767 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
1037300263 8:17444063-17444085 GATCAGAAGGAGGAGGAGGAGGG - Intergenic
1037598466 8:20373866-20373888 GAAGAGAAGGAGGAGGAGGAGGG + Intergenic
1037708680 8:21337926-21337948 AAAAAAAAGAAGAAGGAGAAAGG + Intergenic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1037923184 8:22822523-22822545 AAAAAGAAGAAGAAGAAGAAAGG - Intronic
1037944966 8:22983356-22983378 AAGAAGAAGAAGAAGGAGCAAGG + Intronic
1038284992 8:26198582-26198604 AAAAAGAAGGAGGAGGAGGAGGG - Intergenic
1038698096 8:29824260-29824282 AAAAAGAAGAAGAAGGAAGTGGG + Intergenic
1038712373 8:29959389-29959411 AAAGAGAAGATGAAGGAAGAGGG + Intergenic
1038786319 8:30619987-30620009 CAACAGAAGAGGATGGAGGAAGG + Intronic
1038794749 8:30699951-30699973 AAAGAGAAGCTGTAAGAGGAGGG + Intronic
1038848017 8:31247806-31247828 AAACTGAAGGAGAAATAGGATGG + Intergenic
1038931951 8:32203259-32203281 AACCAGAAACAGAAGAAGAAAGG + Intronic
1039306804 8:36272182-36272204 AAAAGAAAGCAGATGGAGGAGGG - Intergenic
1039436608 8:37563856-37563878 CCACAAAAGCAGAAGGAAGAAGG + Intergenic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1039986530 8:42452453-42452475 GAAGAGATGGAGAAGGAGGAAGG + Intronic
1040065687 8:43141676-43141698 AAGCAGAAGCTGGAGGAGAAAGG + Intronic
1040518635 8:48155103-48155125 AAACAGAAACACAAGGAGTTAGG + Intergenic
1040627864 8:49172579-49172601 AAAAGGAAGCAGAAGGAAGCTGG - Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1040728397 8:50411489-50411511 AAATAAAAACAGAAGGAGGAAGG + Intronic
1040817701 8:51526566-51526588 ATACAGAGGCAGGAGGAGGTTGG - Intronic
1041056009 8:53986809-53986831 AAACAGAAGCAGAAGAGGATTGG - Intronic
1041108383 8:54463306-54463328 AAAGAGGAACAGGAGGAGGAAGG - Intergenic
1041165670 8:55090140-55090162 AAACAAAGGCAGCAGTAGGAGGG - Intergenic
1041265724 8:56062724-56062746 AATCAGTAGCAGAAGGAAAACGG + Intergenic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1041321185 8:56614131-56614153 AAAAAGAAGAAGAAAGTGGAAGG - Intergenic
1041441015 8:57896998-57897020 AAGCAGGAGAAGGAGGAGGATGG - Intergenic
1041899139 8:62961488-62961510 AAAAAGAAGAAGAAGAAGAAAGG + Intronic
1041911752 8:63096410-63096432 AAACTGAGGGAGTAGGAGGAGGG - Intergenic
1041948842 8:63477263-63477285 AAACACCAGCAGAAGCAGAATGG - Intergenic
1042150033 8:65771903-65771925 AAAAAGAAGAAGAAGAAAGAAGG + Intronic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042274183 8:66986010-66986032 AAACTGAGGCTGTAGGAGGAAGG - Intronic
1042477593 8:69266566-69266588 GGACAAAAGCAGAAGCAGGAAGG + Intergenic
1042893653 8:73642178-73642200 ATAGAGAAGCAGTAGGAGAAAGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043062803 8:75526527-75526549 AAAAAGAAGAAGAAGAAGAAAGG - Intronic
1043091700 8:75912729-75912751 AAACTTAAGAAGAAAGAGGAAGG + Intergenic
1043510699 8:80947442-80947464 AAACAGAAGCACAAGTCAGAGGG - Intergenic
1043656957 8:82679672-82679694 GAAGAGGAGAAGAAGGAGGAGGG + Intergenic
1043703341 8:83318491-83318513 AAAAAGAAGAAAGAGGAGGAGGG - Intergenic
1043751790 8:83945654-83945676 AAATAACAGCATAAGGAGGAAGG + Intergenic
1043832924 8:85011946-85011968 AAAGAGAAGAAAAGGGAGGAGGG - Intergenic
1044140794 8:88649082-88649104 AAACAGAAACAGAATGAATAGGG - Intergenic
1044177484 8:89146272-89146294 AAAAAGAAGAAGAAGAAGAATGG + Intergenic
1044801948 8:95966151-95966173 TAAGAGAGGGAGAAGGAGGAAGG + Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044917776 8:97134345-97134367 AAAAAGAAGCAGCAGCATGAAGG + Intronic
1044985521 8:97753283-97753305 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
1045009234 8:97943382-97943404 ACAGAGAAGGAGAAGGAGAAAGG - Intronic
1045062989 8:98424661-98424683 AGACAGGAACAGAAGGAGGCGGG + Intronic
1045236103 8:100353781-100353803 GAACAGGAGCAAAAGGAAGAGGG + Intronic
1045302110 8:100920702-100920724 AAGCTGAAGCAGGAGAAGGAGGG - Exonic
1045311607 8:101008052-101008074 GCACAGAAGAAGAAGGAGGTAGG + Intergenic
1045587830 8:103559217-103559239 AAAAAGAAGAAGAAGGAAGTGGG - Intronic
1045682732 8:104679944-104679966 AAAGAAAAAAAGAAGGAGGAAGG - Intronic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1045806215 8:106165480-106165502 AGAAAGAAACAGAAAGAGGAAGG + Intergenic
1045844675 8:106619912-106619934 ATACAGAGGCAGAAGCAGCAAGG - Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046230123 8:111345290-111345312 AAAAAGAAGAAGAAAGAGGAAGG + Intergenic
1046509897 8:115188966-115188988 AGAGAGAATCAGAAGGATGAAGG - Intergenic
1046780299 8:118207685-118207707 AAAAAGAAGAAGAAGAAGAAAGG - Intronic
1046930416 8:119836403-119836425 AAACAGTATAAGAAGGAGAAAGG + Intronic
1046934964 8:119876643-119876665 AAAAAAAAGAAGAAGAAGGATGG + Intronic
1047097883 8:121642964-121642986 AAACAAAGGCTGAAGCAGGAAGG - Intergenic
1047433613 8:124815757-124815779 GAACAGATGCAAAAGGAAGAAGG + Intergenic
1047526415 8:125638086-125638108 AAAAAGGAGGAGGAGGAGGAGGG + Intergenic
1048068532 8:130998211-130998233 ATACAGCAGCATAAGTAGGATGG + Intronic
1048194532 8:132321500-132321522 AAACAGAAGCAGGAGGGCCATGG - Intronic
1048383741 8:133892100-133892122 AAACAAAATCAGCAAGAGGATGG - Intergenic
1048383905 8:133893251-133893273 AAACAGAGAGAGAAGGAGGGAGG + Intergenic
1048597685 8:135883631-135883653 AGACAGAAGAAGAAGCTGGAAGG - Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048889422 8:138934437-138934459 AAAAAGAAGGAAGAGGAGGAAGG + Intergenic
1049142554 8:140969115-140969137 AAACAGTAGCAGGTGGATGAGGG + Intronic
1049311757 8:141937310-141937332 AAAGAGGAGGAGAGGGAGGAGGG - Intergenic
1049675827 8:143888599-143888621 AGCCAGAAGCTGAAGGAGCAGGG + Intergenic
1049932522 9:470558-470580 GAAAGGAAGCAGGAGGAGGAGGG + Intronic
1050358544 9:4805384-4805406 AAAAAGAAGAAGAAGGAGAAGGG + Intronic
1050448451 9:5752960-5752982 AAACAGAAACATAAGGGGCAAGG + Intronic
1050692184 9:8240581-8240603 AAACAGAAACAGAAACAGGTAGG + Intergenic
1050778426 9:9298632-9298654 ATAAAGAAGCTGAAGCAGGAGGG + Intronic
1050831361 9:10018198-10018220 AGAGAGAAGGAGTAGGAGGAAGG + Intronic
1050985937 9:12082310-12082332 AGAGAGAAGTGGAAGGAGGAAGG + Intergenic
1051072405 9:13187562-13187584 AAAAAGAAAGAGAAGGAGGAGGG - Intronic
1051097847 9:13487019-13487041 AAAAATAAGTAAAAGGAGGAAGG + Intergenic
1051428605 9:16959871-16959893 AAACAGAGGGAGAAGCAGGAGGG - Intergenic
1051436617 9:17040419-17040441 GAACAGGAGCAGAAGGTGGGTGG - Intergenic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1051662117 9:19435409-19435431 ACACAGAAGGAAAAAGAGGAAGG + Intronic
1051814211 9:21086813-21086835 AAACAAAAGCTGAGGTAGGATGG + Intergenic
1052142708 9:25006662-25006684 AAACAAAAGCAGAAGTAGAAGGG - Intergenic
1052295761 9:26894753-26894775 ATACAGAACCAGAGGGAAGAGGG - Intergenic
1052964505 9:34329580-34329602 CACCCGAAGCAGAAGGAGGTAGG - Exonic
1052976794 9:34417063-34417085 AAAAAGAAGAAGAAGGAGAAGGG - Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053046344 9:34922193-34922215 AAGCTGAAGCAGGAGAAGGAGGG - Intergenic
1053107577 9:35425004-35425026 AACCAGGAAAAGAAGGAGGAGGG - Intergenic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053275804 9:36782417-36782439 AAACAGAAGCAATGGGATGATGG - Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1054814015 9:69457187-69457209 ACCCAGATGCAGAAGGAGTAAGG + Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055074571 9:72200325-72200347 AAAAGGAAGAAGAAGGAGAAGGG - Intronic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055502575 9:76916288-76916310 AAAAAACAGCAGAAGTAGGAAGG + Intergenic
1055652025 9:78415499-78415521 AAATAGAATCATGAGGAGGATGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055897712 9:81198529-81198551 AAAAAGGAGGAGAAGGAGGAAGG + Intergenic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056165547 9:83937409-83937431 GAAGGGAAGAAGAAGGAGGAGGG + Intergenic
1056236970 9:84604361-84604383 GAAAAGAAGAAGGAGGAGGAGGG - Intergenic
1056251904 9:84757143-84757165 AAAAAAAAGAAGAAGGAAGAGGG - Intronic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056543723 9:87595760-87595782 AAAGAGATGCAGAAAGAGAAGGG - Intronic
1056741698 9:89261800-89261822 TAACAGTAGCAGAAGAAGTAAGG - Intergenic
1056741856 9:89263516-89263538 ATACAGAAGAAGAAGAAGAAAGG - Intergenic
1056954573 9:91072053-91072075 GAAGAGAAGCAGAGGGAGGGAGG + Intergenic
1056983026 9:91334390-91334412 GAACAAAAGGTGAAGGAGGAAGG + Intronic
1057081296 9:92176462-92176484 TGACAGAAGCAGATGGAGGAGGG - Intergenic
1057142766 9:92737585-92737607 AAACAGAAGCTGGACGATGAAGG + Intronic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057739767 9:97701172-97701194 GAGCCGAAGGAGAAGGAGGAGGG - Intergenic
1057869202 9:98706122-98706144 AAAAAGAAGGAGGAGGAGGAGGG + Intronic
1057962219 9:99467775-99467797 AAACAGAAACAAGAAGAGGAGGG + Intergenic
1058231077 9:102426334-102426356 AAACATAAACAGAAGTAGAAAGG + Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058700645 9:107597431-107597453 TAAAAGAAGCAGCAGGATGAAGG - Intergenic
1058779337 9:108317669-108317691 AAATAGAAGCAGAAAAAGAATGG + Intergenic
1058872320 9:109213280-109213302 ATACAGAAGGAGAAGGAGACAGG - Intronic
1058953183 9:109922453-109922475 AAAAAGATGGAAAAGGAGGAAGG + Intronic
1059254280 9:112914430-112914452 AAAAAGAAGAAGAAGAAGAAAGG + Intergenic
1059361118 9:113742722-113742744 CAACAGAAGCAGGAAGAGGCTGG - Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059508551 9:114822371-114822393 AAAGAGTAGCATAAGGAGGTGGG + Intergenic
1059552787 9:115246529-115246551 AAACAGAAAGAAAAGGATGAGGG - Intronic
1059614832 9:115938218-115938240 AAATAGAAGAAGAAAGATGATGG + Intergenic
1059678180 9:116560462-116560484 AACAAGAAGAAGAGGGAGGAAGG - Intronic
1059799485 9:117735881-117735903 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1059883103 9:118714404-118714426 AAAGAAAAGCAAAAGAAGGAAGG - Intergenic
1060518783 9:124282324-124282346 AGACAGACGCACAAGGAAGAAGG - Intronic
1060679561 9:125549656-125549678 ATACACAAGGAGAAGGCGGAGGG - Intronic
1060762657 9:126268996-126269018 AAACAGACGCAGTAGGAGAAAGG - Intergenic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1060880293 9:127113307-127113329 AAAGAGAAGCCCAAGGAGCATGG - Intronic
1060989402 9:127839457-127839479 AAGAAGCAGCAGGAGGAGGAAGG + Intronic
1061082732 9:128381989-128382011 AAAGAGAAAGAGAAGGAGGGAGG + Intronic
1061579116 9:131526045-131526067 AAACAGATGCAACAGCAGGAGGG + Intronic
1061632470 9:131881783-131881805 AAAAAGAAGAAGAAGAAGGAAGG - Intronic
1061698412 9:132395821-132395843 GGACAGAAGGAGAAGCAGGAAGG - Intronic
1061796587 9:133088932-133088954 AAACCGAAGCAGAGGGATGGCGG - Intergenic
1061810108 9:133157420-133157442 AAACAGAACCAGTAAGAGGTAGG - Intronic
1061929121 9:133823242-133823264 AAACAGAAGCAGGAAGACAAGGG + Intronic
1061998620 9:134204289-134204311 AATCAGAAACAGAAGGAGCAGGG - Intergenic
1062074723 9:134579738-134579760 AAAAAGAAGAAGGAGGAGGAGGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062103750 9:134741591-134741613 GTACAGAAGCAGAGGCAGGAGGG + Intronic
1062185757 9:135217646-135217668 AGACAGAGGTAGAAGGAGGAGGG - Intergenic
1062437884 9:136554691-136554713 CAACAGAAGCTGGAGGAGGTGGG + Intergenic
1062530475 9:136997325-136997347 AAAAAGAAGCAGCAGGAGAGGGG + Intergenic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638479 9:137504164-137504186 AGACGGAAGAAGAAGGAAGAAGG + Intronic
1185501716 X:601800-601822 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185501748 X:602078-602100 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185575491 X:1169031-1169053 AAAGAGAAGGAGGAGGTGGAGGG + Intergenic
1185688218 X:1948093-1948115 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185688507 X:2133632-2133654 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185701241 X:2232020-2232042 AAAAAGGAGGAGAAGGAAGAAGG - Intronic
1185814986 X:3146313-3146335 AAAAAGAAGAAGAAGGAAGAGGG - Intergenic
1185895407 X:3854163-3854185 AAAAAGAGGGAGAAGAAGGAAGG - Intergenic
1185900524 X:3892587-3892609 AAAAAGAGGGAGAAGAAGGAAGG - Intergenic
1185905640 X:3931018-3931040 AAAAAGAGGGAGAAGAAGGAAGG - Intergenic
1186034478 X:5406171-5406193 AAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186136282 X:6525304-6525326 AAACAGAAGCAAAAGGATTGAGG + Intergenic
1186225585 X:7395867-7395889 AGCAAGAAGAAGAAGGAGGAAGG - Intergenic
1186264625 X:7818772-7818794 AAAAAGAAGGAAAAGGAGAAGGG + Intergenic
1186332242 X:8547032-8547054 AGACAGCAGTAGGAGGAGGAAGG - Intronic
1186471176 X:9823145-9823167 GAAAAGAAGAAGAAGGAAGAAGG - Intronic
1186677594 X:11835380-11835402 AGAAAGAAGGAGATGGAGGAGGG - Intergenic
1186821059 X:13288472-13288494 AAATAATAGCAGAAGCAGGAAGG - Intergenic
1187025685 X:15433659-15433681 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025690 X:15433682-15433704 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025695 X:15433705-15433727 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025700 X:15433728-15433750 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025705 X:15433751-15433773 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025710 X:15433774-15433796 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025715 X:15433797-15433819 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025720 X:15433820-15433842 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025725 X:15433843-15433865 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025734 X:15433886-15433908 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025752 X:15433955-15433977 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025770 X:15434041-15434063 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025791 X:15434127-15434149 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025805 X:15434227-15434249 AGATAGAAGAAGGAGGAGGAAGG + Intronic
1187073544 X:15912006-15912028 CAACAGAAGGGGAAGAAGGAGGG - Intergenic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187416138 X:19094900-19094922 AAAAAGAAGGAGAAAGTGGACGG - Intronic
1187435020 X:19259769-19259791 AAAAAGAAGAAGAAGAAAGAAGG + Intergenic
1187602906 X:20851650-20851672 AAACAGACACACAGGGAGGAAGG + Intergenic
1187843369 X:23511141-23511163 ACACAGACACAGAAGGAAGAAGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188626657 X:32293414-32293436 GAAGAGAACCAGAAGGAGGGAGG + Intronic
1188918461 X:35941585-35941607 AATCAGGATCATAAGGAGGAAGG - Intronic
1189146313 X:38658662-38658684 AAACAGAAGCAGAAGATGGTGGG - Intronic
1189216660 X:39330930-39330952 AAAGAGAAGAAGAAGCAGGGAGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189367202 X:40397937-40397959 AATCAGAAGCAGACAGAAGAGGG - Intergenic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189438970 X:41017527-41017549 AAACACAAGCAGAAGTCAGAGGG + Intergenic
1189512365 X:41675766-41675788 AAGCTGAAGCAGGAGAAGGAGGG - Intronic
1189596319 X:42570026-42570048 AAAAAGAAGCTGGAGGAAGAGGG + Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189725701 X:43966339-43966361 AAAGAGGAGGAGGAGGAGGAAGG + Intronic
1189751466 X:44226903-44226925 AAAAAGAAAAAGAAGAAGGAAGG + Intronic
1190283718 X:48948387-48948409 AAACAAAGGCAGAAAGAGAAAGG + Intronic
1190394925 X:49972350-49972372 ACACAAAAACAGAGGGAGGAAGG - Intronic
1190415210 X:50174119-50174141 AAAAAGAAGCTGAATGAGGCTGG + Intergenic
1190627610 X:52351986-52352008 AAAGAGAGGAGGAAGGAGGAAGG - Intergenic
1190937384 X:55008912-55008934 AAACAGAATGAGAAAGAGGAAGG - Exonic
1191589530 X:62867000-62867022 AAACAAAAGCAGTAGTAAGAAGG - Intergenic
1191915007 X:66192044-66192066 AAACACTAACAGAAGGAGGAAGG + Intronic
1192030557 X:67508134-67508156 AAACTGAAACATAAAGAGGAAGG - Intergenic
1192095669 X:68207975-68207997 AGAAAGAAGGAAAAGGAGGAAGG - Intronic
1192130219 X:68542879-68542901 AAAAAGAAGAAGAAGAAGGCTGG - Intergenic
1192343271 X:70281300-70281322 CAACAAGAGCAGAAGGTGGAGGG - Intronic
1192474600 X:71429277-71429299 AAAAAAAAGCAGAAGGAAGCAGG + Intronic
1192777522 X:74260347-74260369 ATACAGAGGCAGAGGGAGGGGGG - Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1194469710 X:94278008-94278030 AAACAGAGGAAGAAGGAGACAGG + Intergenic
1194795220 X:98202693-98202715 AAAAAGAAGAAGAAGAAGAATGG + Intergenic
1194847735 X:98832531-98832553 AACAAGAAGAAAAAGGAGGAAGG - Intergenic
1195369718 X:104161551-104161573 AAAAAGAAGAAGAAAGAGGCTGG + Intergenic
1195576843 X:106460925-106460947 GAACATAAGCAGCAGGAGGCGGG - Intergenic
1195696234 X:107669615-107669637 AAAAAAAAGGAGGAGGAGGAGGG - Intergenic
1195965185 X:110423343-110423365 AAAAAGAAAAAGAAAGAGGAAGG + Intronic
1196039828 X:111190194-111190216 AAACACAAGCAGAGTGAGGAGGG + Intronic
1196095939 X:111800035-111800057 AAACTGAAGCAAATGGTGGAAGG + Intronic
1196164427 X:112522904-112522926 AAACAGACTAAGAAGGAGAAAGG - Intergenic
1196714493 X:118798600-118798622 AAACAGAAGCTGGAAGTGGAGGG - Intergenic
1196715653 X:118808455-118808477 AGACAGAGGAACAAGGAGGATGG - Intergenic
1196834516 X:119802066-119802088 AAAGAGAAAAAGGAGGAGGAAGG - Intergenic
1196936741 X:120737813-120737835 AAAGAGAAGCAAAAGGTGAAGGG + Intergenic
1197329975 X:125141639-125141661 TAACAGAAGAGGAATGAGGAAGG + Intergenic
1197428928 X:126334854-126334876 AAACTGAAACGGAAAGAGGAAGG - Intergenic
1197645707 X:129014392-129014414 AAAAAGAAGCAGAAATAGCAGGG + Intergenic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1198133977 X:133728338-133728360 AATGAGAAGGAGAAGGAGAAAGG + Intronic
1198135156 X:133742197-133742219 AATCTGAAGCAGAAGGAAAAGGG + Intronic
1198162803 X:134024237-134024259 AAACAGGAACAGGAGGAGCAGGG + Intergenic
1198183549 X:134233147-134233169 AGACACACACAGAAGGAGGATGG + Intergenic
1198403518 X:136290413-136290435 AAAAAGAAGAAGAAGAAGAAAGG - Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198557801 X:137814308-137814330 AAATAGAACCAGCAGGATGAAGG + Intergenic
1198795007 X:140385273-140385295 AAGCAAAAGCAGAAGAGGGAGGG - Intergenic
1198818751 X:140622389-140622411 AAAAAGAAGAAGAAAGATGAAGG + Intergenic
1199185762 X:144913038-144913060 AAACAGAAGCAACAGCAGGAAGG + Intergenic
1199751592 X:150824495-150824517 AGAAAGAAGAAGAAGAAGGAAGG + Intronic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1200102297 X:153694175-153694197 AAACGGAAGTAGTAGGAGGCCGG - Exonic
1200374737 X:155767650-155767672 AAACAGGAGGAGGAGGAGAAGGG + Intergenic
1200401800 X:156024251-156024273 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201146255 Y:11066994-11067016 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201146552 Y:11067931-11067953 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201300204 Y:12498611-12498633 AATAAGAAGAAGGAGGAGGAGGG - Intergenic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic
1201458996 Y:14201600-14201622 AAAAAGAGGAAGAGGGAGGAAGG + Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1202602485 Y:26608313-26608335 AAACAAATGCAGAAGGAGAAGGG + Intergenic