ID: 901186357

View in Genome Browser
Species Human (GRCh38)
Location 1:7375869-7375891
Sequence CAGGGTGGACAGAAGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 739
Summary {0: 1, 1: 0, 2: 6, 3: 70, 4: 662}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901186351_901186357 -7 Left 901186351 1:7375853-7375875 CCTTTGTCAACAGAGACAGGGTG 0: 1
1: 0
2: 0
3: 13
4: 150
Right 901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG 0: 1
1: 0
2: 6
3: 70
4: 662
901186350_901186357 -6 Left 901186350 1:7375852-7375874 CCCTTTGTCAACAGAGACAGGGT 0: 1
1: 0
2: 2
3: 20
4: 167
Right 901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG 0: 1
1: 0
2: 6
3: 70
4: 662

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901186357 Original CRISPR CAGGGTGGACAGAAGGGGGC AGG Intronic
900000645 1:13073-13095 CTGGGTCGACAGACAGGGGCTGG + Intergenic
900020358 1:183592-183614 CTGGGTCGACAGACAGGGGCTGG + Intergenic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
900578156 1:3394368-3394390 CTGGGTGGGCGGACGGGGGCTGG - Intronic
900674033 1:3872826-3872848 CAGGGAGGACTGGAGGGGACAGG - Intronic
901001958 1:6153317-6153339 CAGGCTGGGCAGACAGGGGCGGG + Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901648378 1:10728758-10728780 GAGGGGGGACAGCTGGGGGCCGG + Intronic
901843043 1:11965601-11965623 CAGGGTGGGCACATAGGGGCTGG + Intronic
902205911 1:14867911-14867933 CAGGGAGGACAGCAGTGGGCAGG + Intronic
902410904 1:16210990-16211012 GAGGGTGGGAAGAAGGGGACTGG + Intronic
902546497 1:17193742-17193764 CAGGCTGGAGAGCAGGGGGTGGG + Intergenic
902697317 1:18149156-18149178 CAGGCTGGACAGAGGGGCTCAGG - Intronic
903145880 1:21371779-21371801 CAGGGTTGGCAGCAGGGAGCTGG + Intergenic
903233041 1:21933547-21933569 GACGGTGGAAAGAAGGTGGCAGG - Intronic
903759414 1:25687404-25687426 CAGGCTGCAGACAAGGGGGCTGG - Intronic
903800269 1:25961992-25962014 CAGGCTGGACAGATGGTGGGGGG + Exonic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904199967 1:28813051-28813073 CAGGGCGGACAGGAGGGTGCTGG + Intronic
904410291 1:30320873-30320895 AAGTGTGGGCAGAAGGGGGGTGG + Intergenic
904437190 1:30506615-30506637 CAGGGTTGAGGGCAGGGGGCGGG - Intergenic
904615195 1:31745800-31745822 CGGGCTGGGCAGCAGGGGGCAGG - Intronic
904625611 1:31800225-31800247 CAGGGTGGACTGGAGGAGGGAGG - Intronic
904829324 1:33296535-33296557 CAGGGAGGACACAATGGAGCTGG + Intronic
905400737 1:37701235-37701257 CAGGGTGGACACTAGAGGGAGGG + Intronic
905409419 1:37757988-37758010 CAGGGTGGAGACAGAGGGGCTGG - Intronic
905627343 1:39497831-39497853 CAGGTGGGACAGAGTGGGGCCGG + Intronic
905797509 1:40823934-40823956 CAGGGTGGACAGTGGGAGACTGG - Intronic
905977028 1:42183279-42183301 GAGGGTGGAGCGGAGGGGGCGGG + Intronic
906255689 1:44348184-44348206 TAGGGAGGACAGAATGGGGTGGG - Intronic
906323297 1:44829543-44829565 CAGGGTGGATAGGAGGGGGCAGG + Intronic
907553001 1:55319890-55319912 TAGGGTGGAAAGGAGGGAGCAGG + Intergenic
911705361 1:101005661-101005683 CAGGGTGGAAGGCAGGGGGTTGG + Intronic
912247538 1:107976155-107976177 CGGGGTTGACAGGAGTGGGCCGG - Intergenic
912524787 1:110273581-110273603 CAGGGTGGCCATCAGTGGGCAGG - Intronic
912537472 1:110385642-110385664 TGGGGTGAAAAGAAGGGGGCAGG - Intronic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
915364952 1:155309835-155309857 CGGGGTGCCCAGTAGGGGGCTGG - Exonic
915471270 1:156127015-156127037 CAGGGAGGACAGGGTGGGGCAGG - Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
916078306 1:161216020-161216042 CAGGGTTGATAGAAAGTGGCAGG + Intronic
916718556 1:167465201-167465223 CAGGGTGGTGGGGAGGGGGCTGG - Intronic
917176559 1:172242292-172242314 CAGGGTGAACAGCAAGGGGTGGG - Intronic
917249221 1:173038978-173039000 CAGGGTGGAGAAAAGGAGGTAGG + Intergenic
917926696 1:179795058-179795080 CAAGGTGGTAAGAAGGGGGATGG + Intronic
918181151 1:182086779-182086801 CAGGGTTGACAGGAAGGGACAGG + Intergenic
919753530 1:201052979-201053001 GTGGGTGGACAGCAGGGGCCAGG - Intronic
919982487 1:202650969-202650991 CAGAGTGGGAAGAAGGGGCCGGG + Intronic
920050582 1:203162354-203162376 CTGGGTGGTCAGAAGGGTGAGGG + Intronic
920263603 1:204706259-204706281 CAGGGTACACAAGAGGGGGCTGG + Intergenic
920304351 1:205009145-205009167 CAGGGTGGAGAAATGGGAGCCGG - Intronic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
921308922 1:213824043-213824065 CAGGGGGGACAGTAGGAGACTGG - Intergenic
921572952 1:216800371-216800393 CAGGCTGGACAGAAAAGGGAGGG + Intronic
922025356 1:221743474-221743496 CAGGGAGAAGAGTAGGGGGCGGG + Intergenic
922056094 1:222043818-222043840 CAGGCTGGGCAGGAGGGGGAAGG + Intergenic
922567165 1:226608235-226608257 CAGGGAGGAAAGAAGGGAGAGGG + Exonic
922778673 1:228232078-228232100 CAGGGTGGCCAGATGGTGGGGGG - Intronic
923862713 1:237907657-237907679 CAGGGTGGAGAGAAAGGAGAGGG + Intergenic
924438546 1:244067501-244067523 CAGGGGGGACTGGAGGGGACGGG + Intergenic
924643756 1:245857971-245857993 CAGGGAGGACAGCAGGGAGACGG - Intronic
1062822798 10:547558-547580 GAGGGTGGAGAAAAAGGGGCTGG + Intronic
1063247020 10:4231690-4231712 CAGGGGTGGCAGAAGGGTGCTGG + Intergenic
1063577555 10:7275337-7275359 CACGGTGAAGAGAAAGGGGCAGG + Intronic
1064392456 10:14953833-14953855 GAGAGAGGACAGGAGGGGGCCGG - Intronic
1064553929 10:16529386-16529408 CAGGGTGGAGAGATAGGGGAAGG - Intergenic
1065785176 10:29206269-29206291 CAAGATGCACAGAAGGGTGCAGG + Intergenic
1068062471 10:52086183-52086205 CAGGGTGGAAAGGATGGGGAGGG - Intronic
1068360619 10:55972384-55972406 CAGGGTGGAGAGAAGGGGTGGGG - Intergenic
1069860007 10:71464645-71464667 CAGGGTGGTGGGGAGGGGGCTGG + Intronic
1070290321 10:75109573-75109595 CAGGGTGCAGAGGAGGTGGCTGG + Intronic
1070647147 10:78209937-78209959 CTGGGAGGAGGGAAGGGGGCAGG + Intergenic
1070724749 10:78780322-78780344 CAGGGGGCACAGAATGGAGCTGG + Intergenic
1070760945 10:79024098-79024120 AAGGGTAGACAGAGGGGGGGGGG + Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071480532 10:86061669-86061691 CAGGAGGGACAGAAGCAGGCTGG - Intronic
1071822589 10:89293393-89293415 ATGGGTGGAGAAAAGGGGGCCGG - Intronic
1073002335 10:100294911-100294933 CAGGGAGGAGTGAAGGGGACAGG + Intronic
1073331684 10:102674157-102674179 GAGGGAGGAAGGAAGGGGGCAGG + Exonic
1073462870 10:103676642-103676664 GTGGGTGGACAGAGGGGTGCTGG + Intronic
1074132653 10:110595307-110595329 CTGGGTGGGGAGAAGGGAGCAGG - Intronic
1074757469 10:116635119-116635141 CAGGGTGGGCTGGAGGGGGAAGG + Intronic
1075304296 10:121354309-121354331 CAGGGAGGAGAGAAGAGGGCAGG - Intergenic
1075544294 10:123342870-123342892 GAGGCTGGAAAGAAGGAGGCAGG + Intergenic
1075614924 10:123883887-123883909 CAGTGTGCAGAGAAGGGGCCAGG + Intronic
1075712135 10:124536450-124536472 CAGGGTGGAGGGAGAGGGGCCGG - Intronic
1075717554 10:124565857-124565879 CAGTGGGGACAGGAGGGGGAAGG + Intronic
1075721818 10:124591978-124592000 CAAGGTGGGGAGAAGGAGGCAGG - Intronic
1075873172 10:125785967-125785989 CAGGAAGGACACAAGGAGGCTGG + Intronic
1076379521 10:130015527-130015549 CCGGGTGGACAGGAGGCGTCTGG - Intergenic
1076512402 10:131022042-131022064 CATGGTGGAGAGAAGGTGGCTGG + Intergenic
1076644515 10:131943468-131943490 CAGGGTGCACAGCAGGGTGCTGG - Intronic
1076888845 10:133274401-133274423 GAGGGTGGAGGGTAGGGGGCAGG + Intronic
1077231606 11:1460287-1460309 CAGGGTGGGCAGGCGGCGGCCGG - Intronic
1077279217 11:1734554-1734576 CTGGGGGGACGGAAGGGGGTGGG - Exonic
1077365686 11:2160696-2160718 CAGCATGGGCAGAAGGGGGCAGG - Intronic
1077431794 11:2519251-2519273 CATGTTGGAGAGAAGGGAGCTGG - Intronic
1077550063 11:3196280-3196302 CATGCAGGAGAGAAGGGGGCCGG + Intergenic
1077917609 11:6621642-6621664 CAGGGTGGAGAGCTGGGGCCTGG + Exonic
1078539371 11:12200866-12200888 CCTGGTGGACAGAAGGATGCAGG + Intronic
1078672451 11:13377146-13377168 CAGCGTGGACAGCAGGGGCAGGG - Intronic
1080365832 11:31573021-31573043 AAGGAGGGAGAGAAGGGGGCAGG + Intronic
1080520708 11:33065768-33065790 CAGGTTGGCCAGCAGAGGGCGGG - Intronic
1081017826 11:37905980-37906002 CAAGATGGACAGGAGGGGCCAGG - Intergenic
1081535574 11:43993698-43993720 GGGTGTGCACAGAAGGGGGCAGG - Intergenic
1081565766 11:44260157-44260179 CAGGGAAGCTAGAAGGGGGCAGG - Intergenic
1081574470 11:44310518-44310540 AAGAGTGGAGAGGAGGGGGCAGG - Intergenic
1081856744 11:46308719-46308741 CCGTGTGGCCAGCAGGGGGCAGG - Intronic
1081886962 11:46506188-46506210 TAGAGTGGACAGAAGGGAGAAGG + Intronic
1081993081 11:47347915-47347937 AAGGGTGGAGAGATGGGGGAAGG + Intronic
1082957823 11:58890090-58890112 GAGGGTGGAGGGAAAGGGGCTGG - Intronic
1082957934 11:58891591-58891613 GAGGGTGGAGGGAAAGGGGCTGG - Intronic
1082973372 11:59047709-59047731 GAGGGTGGAGGGAAAGGGGCTGG - Intergenic
1082977785 11:59091485-59091507 GAGGGTGGAGGGAAAGGGGCTGG - Intergenic
1083148337 11:60774697-60774719 CAGTGATGACAGAAAGGGGCTGG + Intronic
1083388800 11:62333198-62333220 CAGCGAGGCCAGAAGGGGGATGG + Intergenic
1083609930 11:63999832-63999854 CGGCCTGGGCAGAAGGGGGCAGG + Intronic
1083613601 11:64015809-64015831 GAGGGGGCGCAGAAGGGGGCAGG + Intronic
1083800747 11:65045050-65045072 GAGGGTGGGCAGCAGGGGACAGG - Exonic
1084128994 11:67119167-67119189 CAGGGAGGCCTGAAGGGGGTGGG + Intergenic
1084147024 11:67270415-67270437 CAGGGAAGCCAGAAAGGGGCAGG - Intronic
1084236044 11:67788528-67788550 CAGGGGGAACAGATGTGGGCAGG + Intergenic
1084643071 11:70437369-70437391 CAGGGTGGGCAGACGGGGTCAGG + Intergenic
1085461867 11:76698930-76698952 CTGGGTGGACAGCAGCAGGCAGG - Intergenic
1085522206 11:77145531-77145553 CAGTGTGGACAGGAGGGGAGAGG - Intronic
1086787114 11:90982807-90982829 CAGGCTGGACAGAATGGTGCAGG - Intergenic
1089632433 11:119792056-119792078 CAGGGAGGGCAGAGTGGGGCTGG + Intergenic
1090880858 11:130830519-130830541 AAGGGTGCAAAAAAGGGGGCAGG - Intergenic
1091373737 12:13200-13222 CTGGGTGGACAGACAGGGGCTGG + Intergenic
1091445701 12:543280-543302 GAGGCTGGGCAGAAAGGGGCCGG - Intronic
1091804197 12:3344096-3344118 CAGGGTGGGCCGGCGGGGGCAGG + Intergenic
1092158378 12:6300140-6300162 CAGGCTGGAGTGTAGGGGGCTGG + Intergenic
1092261798 12:6956829-6956851 CAGGGAGGACAGGAGGGGCCTGG - Intronic
1092526428 12:9312716-9312738 CTGGGTGGACAGATGGGGGCTGG + Intergenic
1092540847 12:9419069-9419091 CTGGGTGGACAGATGGGAGCTGG - Intergenic
1094512199 12:31103416-31103438 CTGGGTGGACAGATGGGGGCTGG + Intronic
1095547449 12:43388326-43388348 GAGGGTGAACAGAAGCAGGCAGG - Intronic
1096193947 12:49636917-49636939 CAGCGTATCCAGAAGGGGGCAGG - Exonic
1097811243 12:64021533-64021555 CAGGGTGCACAGTAAGTGGCAGG + Intronic
1097841523 12:64326207-64326229 CAGGGTAGAGAGGAGGGGGGTGG + Intronic
1100379830 12:94051226-94051248 CAGGGTGGACAGGTGGGGACTGG - Intergenic
1101829906 12:108249046-108249068 CAGCATGGATAGAAAGGGGCAGG - Exonic
1102045194 12:109825518-109825540 CAGGGAGGTCAGAACTGGGCAGG + Intronic
1102141982 12:110622663-110622685 CAGTGTGGCCAGAAGAGGGGTGG + Intronic
1102446281 12:113005253-113005275 GATGGTGGACAGAAGGTGGAGGG + Intronic
1102571487 12:113829627-113829649 CAGGGTGGACAGGACGAGGTGGG + Intronic
1103111011 12:118278285-118278307 GAGGGTGGAAAGAAGGAGGAGGG - Intronic
1103155375 12:118680255-118680277 AGGGGTGGACGGAAGGGGGCGGG + Intergenic
1103565709 12:121814357-121814379 CAGGGTGGGCTGGAGGGGGTGGG - Exonic
1103796920 12:123509753-123509775 GAGGGTGGGCAGCAGGGCGCTGG - Intronic
1103948484 12:124539778-124539800 CAGGGTGGAGAGCAGGGTGACGG - Intronic
1103964012 12:124626571-124626593 CGGGGTGGATGGAACGGGGCTGG - Intergenic
1104900047 12:132184737-132184759 CAGGGTGGAGAGAAGCAGGCTGG - Intergenic
1104958930 12:132479028-132479050 CAGAGTGGACTGTAGGAGGCAGG + Intergenic
1104960969 12:132488641-132488663 CTGGGTGGACTGGAGGAGGCTGG + Intergenic
1105271934 13:18884751-18884773 CAGGGTGGGCAGATGAGGTCAGG - Intergenic
1105432760 13:20352157-20352179 CACGGTGGACAGACGGGAGGTGG - Intergenic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1106370458 13:29127551-29127573 CAGGGTGGAAACTTGGGGGCAGG - Intronic
1107011654 13:35676479-35676501 AAGGGTGGAGAGCAGGGGGCAGG - Intergenic
1107276935 13:38688529-38688551 CAGAGTCTTCAGAAGGGGGCTGG - Exonic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1108024848 13:46167131-46167153 CAGGGTGGAAGGTAGGGGGAAGG + Intronic
1109216695 13:59597648-59597670 AAAGGTGGAGAGAAGAGGGCAGG + Intergenic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1110789846 13:79575663-79575685 CAGCATGGACAGATTGGGGCAGG + Intergenic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113285636 13:108845461-108845483 CAGGGCGGACAGCAGGAGGCAGG + Intronic
1113693615 13:112329179-112329201 CAGGGTGGACAGAAGGACCCAGG - Intergenic
1113888212 13:113672093-113672115 CAGGGTGTAGGGAAGAGGGCCGG - Intronic
1114643382 14:24239847-24239869 CACCGTGGCCAGAAGGGGGTAGG + Exonic
1114646145 14:24257272-24257294 GAGGCTGGACAGAAGGTAGCTGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118456090 14:65946746-65946768 CAGGTGGGACAGAATGGGGCAGG + Intergenic
1119163379 14:72471702-72471724 CTGGGTGGTCAGGAGGTGGCTGG - Intronic
1119761061 14:77152167-77152189 CAGGTGGGAAAGAAGAGGGCAGG + Intronic
1119879696 14:78090556-78090578 CAGAGTGGAAAGCAGGGGTCTGG + Intergenic
1120976582 14:90254224-90254246 TAGGGTGGACAGAGGGGGCGGGG - Intergenic
1121007969 14:90502307-90502329 GAGGGTGGAGAGGAGGGGGCTGG - Intergenic
1121260008 14:92559161-92559183 CAAGGAAGAGAGAAGGGGGCCGG - Intronic
1121439891 14:93941973-93941995 GAGGTTGGACAGAAGGTGGGTGG + Intronic
1121724811 14:96139554-96139576 CAGAGTGGACAGTGGTGGGCTGG - Intergenic
1122076931 14:99242024-99242046 AAGGGTGGGTAGAAGGGGACAGG + Intronic
1122227336 14:100287365-100287387 AAGGGCAGAGAGAAGGGGGCAGG - Intergenic
1122266325 14:100548598-100548620 CAGGGTGCCCAGAAGGGGCAGGG - Intronic
1122634470 14:103123593-103123615 CGGCGGGGACAGGAGGGGGCTGG + Exonic
1122773748 14:104108241-104108263 GGTGGTGGACAGGAGGGGGCGGG + Intronic
1122884611 14:104705477-104705499 CAGTGTGGGCTGAAGGGGGCCGG + Intronic
1122886398 14:104712327-104712349 CAGGGTGCACAGTGGGGTGCCGG + Intronic
1122896508 14:104760187-104760209 CCTGGAGGACAGAAGAGGGCAGG + Intronic
1122899158 14:104775033-104775055 CAGGGTGGAGATGAGGGTGCGGG - Intronic
1123113134 14:105882242-105882264 CAGGGTGGAGAGGAGGTGGGCGG + Intergenic
1123115480 14:105892392-105892414 CAGGGTGGAGAGGAGGTGGGCGG + Intergenic
1124101390 15:26697487-26697509 CAGGGTGGAGGGAAGGAGACAGG - Intronic
1124159646 15:27256502-27256524 CGGGGAGAAGAGAAGGGGGCTGG + Intronic
1125037962 15:35149065-35149087 AAGGGAGGAGAGAAGGGGGATGG - Intergenic
1126827864 15:52569257-52569279 CAGAGTGGACAGGAAAGGGCGGG - Intronic
1127323810 15:57874479-57874501 CTGGGTGCAGAGGAGGGGGCTGG - Intergenic
1127674366 15:61226832-61226854 CAGGAGGGACAGACAGGGGCTGG + Intronic
1128291089 15:66478978-66479000 CAGGGTGGGTAGAAGAGGACAGG + Intronic
1129077661 15:73011049-73011071 CAGGGTGGAAAGAAGTGTGCTGG + Intergenic
1129200100 15:73993585-73993607 CAGGGTGGAGAGCAGGGGTTGGG - Intronic
1129256696 15:74337861-74337883 CAGGCTGGGCAGAAAGGAGCAGG + Exonic
1129342055 15:74892568-74892590 GAGGGTGGACAGCAGGGGCTAGG + Intronic
1129453586 15:75664179-75664201 CAGTGTGAACACAAGGGTGCTGG + Intergenic
1129459626 15:75694038-75694060 CACGGTGGAAACAATGGGGCCGG - Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129869186 15:78929847-78929869 CAGGGTCGACACGAGGGGTCAGG - Intronic
1130088347 15:80797392-80797414 CAGGGAGGACAGAGGCGTGCAGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130272357 15:82458645-82458667 CACGGTGGAAACAATGGGGCCGG + Intergenic
1130284139 15:82541301-82541323 CAGAGTTGGAAGAAGGGGGCAGG - Intronic
1130464708 15:84185998-84186020 CACGGTGGAAACAATGGGGCCGG + Intergenic
1130485960 15:84398710-84398732 AGTGCTGGACAGAAGGGGGCAGG + Intergenic
1130487977 15:84408806-84408828 CACGGTGGAAACAATGGGGCCGG - Intergenic
1130499558 15:84487539-84487561 CACGGTGGAAACAATGGGGCCGG - Intergenic
1130587000 15:85190612-85190634 CACGGTGGAAACAATGGGGCCGG + Intergenic
1130652069 15:85767888-85767910 CTGGGTGGGCAGCAGGTGGCTGG - Intronic
1131158028 15:90086973-90086995 CTCTGTGGACAGCAGGGGGCAGG - Intronic
1131179048 15:90227958-90227980 CAGGTTGGAGAGGAGCGGGCAGG - Exonic
1131272770 15:90957072-90957094 CAGGGTGGCCAGAATGGAGGCGG - Intronic
1131449289 15:92525872-92525894 AAGGGAGGAAAGAAGGGGGAAGG - Intergenic
1131569683 15:93522121-93522143 CAGAGTAGACAGAAAGGGGCTGG - Intergenic
1131835612 15:96387800-96387822 CGGGATGGAGAGAAGGGGACAGG + Intergenic
1132113272 15:99117664-99117686 CAGGATGGAGAACAGGGGGCAGG - Intronic
1132184695 15:99792743-99792765 CAGGGTGGGCAGGCAGGGGCAGG + Intergenic
1132197443 15:99926368-99926390 CAGGGTGCTCGGGAGGGGGCGGG + Intergenic
1132294699 15:100726589-100726611 CAGGGTGGGCATATGTGGGCAGG - Intergenic
1132386487 15:101404353-101404375 CTGGGTGGAGAGGAGGGGTCGGG + Intronic
1132432288 15:101771911-101771933 CAGGGTGGGCAGGCAGGGGCAGG - Intergenic
1132452862 15:101977872-101977894 CTGGGTCGACAGACAGGGGCTGG - Intergenic
1132454033 16:12754-12776 CTGGGTGGACAGACAGGGGCTGG + Intergenic
1132607108 16:798237-798259 CAGGATGGAGTGAATGGGGCCGG + Exonic
1132607180 16:798481-798503 CAGGATGGAGTGAATGGGGCTGG + Exonic
1132614328 16:832744-832766 CAGGGTGGACGGGGCGGGGCGGG - Intergenic
1132646645 16:1002292-1002314 CAGGGAGCCCAGAAGGGGGCTGG - Intergenic
1133326378 16:4944742-4944764 CCGAGGGGACAGGAGGGGGCTGG + Intronic
1133333950 16:4994712-4994734 GAGCGTGCACAGGAGGGGGCAGG - Intronic
1133392053 16:5418663-5418685 GAGGGAGGAAAGAAGGGGGAAGG - Intergenic
1133780630 16:8936304-8936326 CAAGGTGAACTGATGGGGGCGGG - Intronic
1134241581 16:12510731-12510753 CAGGCTGGACAGCTGGGGGGTGG - Intronic
1134411319 16:14004881-14004903 CCAGGTGGACAGATGGGAGCTGG - Intergenic
1134493363 16:14712380-14712402 CAGGGGGGAGGGAAGGGGACGGG - Intronic
1134498744 16:14751504-14751526 CAGGGGGGAGGGAAGGGGACGGG - Intronic
1134525297 16:14938133-14938155 CAGGGGGGAGGGAAGGGGACGGG - Intronic
1134547597 16:15122775-15122797 CAGGGGGGAGGGAAGGGGACGGG + Intronic
1134581829 16:15377581-15377603 CAGGGCGGAGGGAAGGGGACGGG + Intronic
1134712885 16:16336617-16336639 CAGGGGGGAGGGAAGGGGACGGG - Intergenic
1134720751 16:16379935-16379957 CAGGGGGGAGGGAAGGGGACGGG - Intronic
1134946676 16:18331950-18331972 CAGGGGGGAGGGAAGGGGACGGG + Intronic
1134953935 16:18372065-18372087 CAGGGGGGAGGGAAGGGGACGGG + Intergenic
1135312758 16:21418943-21418965 CAGGGGGGAGGGAAGGGGACGGG + Intronic
1135365675 16:21851213-21851235 CAGGGGGGAGGGAAGGGGACGGG + Intronic
1135446133 16:22519939-22519961 CAGGGGGGAGGGAAGGGGACGGG - Intronic
1136109090 16:28053454-28053476 CTGGGAGGACAGAGGGGGACTGG + Intronic
1136151901 16:28356661-28356683 CAGGGGGGAGGGAAGGGGACGGG + Intronic
1136168136 16:28470498-28470520 CAGGGGGGAGGGAAGGGGACGGG + Intronic
1136194836 16:28644508-28644530 CAGGGGGGAGGGAAGGGGACGGG - Intronic
1136211178 16:28758622-28758644 CAGGGGGGAGGGAAGGGGACGGG - Intronic
1136255898 16:29038573-29038595 CAGGGGGGAGGGAAGGGGACGGG - Intergenic
1136309434 16:29397702-29397724 CAGGGGGGAGGGAAGGGGACGGG + Intronic
1136322876 16:29499458-29499480 CAGGGGGGAGGGAAGGGGACGGG + Intronic
1136437560 16:30239426-30239448 CAGGGGGGAGGGAAGGGGACGGG + Intronic
1136520895 16:30795093-30795115 CAGGGAGAAGTGAAGGGGGCTGG - Intergenic
1136551561 16:30985027-30985049 CAGAGTGGGCTGAAGGGGTCTGG - Exonic
1137068895 16:35881228-35881250 CATGGTGGCCAGAAGGAGGTAGG - Intergenic
1137610214 16:49812902-49812924 CAGGGAGGACAGTGGGTGGCTGG + Intronic
1137707707 16:50547501-50547523 CAGTGTCCCCAGAAGGGGGCAGG + Intergenic
1137734576 16:50714215-50714237 CAGGGTGTGCAGAAGGGCTCTGG + Intronic
1138305706 16:55972574-55972596 CAGGGTTGAGAGATGGGGCCTGG - Intergenic
1138597622 16:58037506-58037528 CATGGTGGACATATGGCGGCTGG - Exonic
1139375054 16:66491641-66491663 CAGGGTGGAGGGATGGGGGCGGG + Intronic
1139923440 16:70473324-70473346 CAGCGTGGCCAGCAGGGGCCCGG - Exonic
1140253600 16:73316367-73316389 TGGGGTGGACATAAAGGGGCAGG - Intergenic
1140299057 16:73738786-73738808 CAGCCTGTAGAGAAGGGGGCAGG - Intergenic
1140365587 16:74377892-74377914 CAGGGGGGAGGGAAGGGGACGGG - Exonic
1140627982 16:76817832-76817854 CAGGGCGGGCAGAAGTGGGGAGG - Intergenic
1141174623 16:81710793-81710815 CGGGGTGGACTGGAGAGGGCGGG - Exonic
1141519845 16:84571468-84571490 AAGGGTGGAGAGCAGTGGGCTGG - Intronic
1142581988 17:948880-948902 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142581996 17:948899-948921 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582004 17:948918-948940 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582012 17:948937-948959 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142614006 17:1124702-1124724 CAGAGTGAACAGAGGAGGGCTGG + Intronic
1142698191 17:1644953-1644975 CAGGTTGGAAAGACGGGAGCAGG + Intronic
1142898696 17:2998958-2998980 GAGGGTGGAGAGGAGGGGCCTGG + Intronic
1143023404 17:3928106-3928128 CGGGCTGGAGAGAAGTGGGCTGG - Intronic
1143465534 17:7133956-7133978 TGGGGTGGCCAGAAGGGGGATGG + Intergenic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1144148589 17:12421721-12421743 CATGGAGGTCAGAAGAGGGCAGG + Intergenic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1144672047 17:17138340-17138362 CCAGGTGGAGAGAAGGCGGCTGG + Intronic
1144946022 17:18969856-18969878 CAGGGAGGAAAGAAGAGAGCTGG + Exonic
1145950378 17:28812469-28812491 CAGGGTGGAGGTGAGGGGGCGGG - Intronic
1146279908 17:31538245-31538267 GAGGGTGGGCAGAAGAGGCCTGG + Intergenic
1146285487 17:31571652-31571674 TGGGGTGGACAGAAGGAGGGCGG + Intronic
1146354932 17:32125984-32126006 CTGGGGGGAGAAAAGGGGGCCGG - Intergenic
1146482187 17:33213705-33213727 CTGGGTGGAAAGAAGGGGAAAGG - Intronic
1147142112 17:38465819-38465841 ATTGGTGGACATAAGGGGGCAGG + Intronic
1147445413 17:40472291-40472313 CAGGCTGGGGAGAAGGGTGCTGG - Intergenic
1147628264 17:41913911-41913933 GAAGCTGGTCAGAAGGGGGCAGG + Intronic
1147646544 17:42037842-42037864 CAGGGAGGCCAGCAGGGGGCTGG + Exonic
1148049652 17:44763461-44763483 CAGGCTGGACAGAAGTGAGGGGG - Intronic
1148287839 17:46411576-46411598 CAGGTTGGCCAGAAGTGGGATGG + Intergenic
1148310008 17:46629156-46629178 CAGGTTGGCCAGAAGTGGGATGG + Intronic
1148543925 17:48502503-48502525 CAGTTTGGCCAGAAGGTGGCTGG + Intergenic
1148736149 17:49865967-49865989 CAGGAGGGAGAGAAGGCGGCAGG + Intergenic
1148804937 17:50259261-50259283 AAGGGTGGCCAGGAGAGGGCAGG + Intergenic
1149154809 17:53615030-53615052 CAGGGTGGAAAGGAGGGAGTGGG + Intergenic
1149485188 17:57037013-57037035 CTGGGTGGAGAAAAGGAGGCTGG + Intergenic
1149557005 17:57580466-57580488 CGGGGTGGAAGGAAGGGGCCAGG - Intronic
1150134974 17:62690550-62690572 CAGGCTGCAGAGAAGAGGGCTGG + Intronic
1150231016 17:63550573-63550595 AAGGGAGGAGAGGAGGGGGCGGG - Exonic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1151766966 17:76137731-76137753 CGGGGTGGGCAGCAGGGTGCTGG + Exonic
1151817172 17:76477083-76477105 CAGGGTGCTCAGAAGGGGCTTGG + Intronic
1152218698 17:79049143-79049165 CAGTGGGGGCAGAAGGGGTCTGG - Exonic
1152341541 17:79728570-79728592 CGGGGTGCACAGAAGGGGCCTGG - Intergenic
1152592132 17:81218880-81218902 CAGGGCAGAGAGAAGGGGTCTGG - Intronic
1152599131 17:81252693-81252715 CACGGGGGACAGATGGGGTCAGG + Intronic
1153432397 18:5032161-5032183 CAGGGTGGGGAGCAGGGTGCAGG - Intergenic
1154024569 18:10695440-10695462 CAGGGTGGCCAGAAGCTGTCAGG - Intronic
1154028073 18:10725893-10725915 CAGGCTGGGCAGGAGGGTGCAGG + Intronic
1154129769 18:11726894-11726916 CTGGTTGGACAGAATGGGACAGG + Intronic
1155280484 18:24234524-24234546 CAGGGGGGACGCCAGGGGGCTGG + Intronic
1155297450 18:24397977-24397999 CAGGCGGGACAGGAGCGGGCCGG - Intergenic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1157335512 18:46734403-46734425 CAGGGTGGAGAGCAGGGGTGGGG - Intronic
1157888337 18:51390127-51390149 AAGGGTGGAGAGAAGAAGGCAGG - Intergenic
1157939749 18:51915124-51915146 CAGAGTGGACTGGAGGGAGCAGG + Intergenic
1159798697 18:72870489-72870511 CAAAGAGGACAGAAGAGGGCAGG - Intergenic
1160477944 18:79209611-79209633 CAGAATGGACAGGATGGGGCCGG - Intronic
1160508876 18:79442294-79442316 GAGGGTGGACAGAGGTGGGGAGG - Intronic
1160513077 18:79463358-79463380 CAGGGTGCTCAGAAGGGTCCTGG + Intronic
1160534459 18:79584787-79584809 CAGCCTGGGCAGAAGGGGCCGGG + Intergenic
1160710750 19:549936-549958 CAGCATGGACAGAGGTGGGCTGG - Intergenic
1160859363 19:1231118-1231140 CGGGCTGGCCAGAAAGGGGCGGG + Exonic
1160914009 19:1488152-1488174 CAGGGTGGGTAGACGGGGACGGG - Intronic
1160965327 19:1744781-1744803 CAGGGTGGACCGGTGGGGGAGGG - Intergenic
1161286921 19:3473201-3473223 CAGGCTGGAGTGCAGGGGGCAGG - Intergenic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161610129 19:5237828-5237850 CAGGAAGGAGGGAAGGGGGCCGG + Intronic
1161950221 19:7463678-7463700 CACGGCACACAGAAGGGGGCAGG + Intronic
1162018267 19:7857160-7857182 CAGGGTGCAGGGAAGGGGCCAGG - Intronic
1162526578 19:11209962-11209984 GAGGGTGGACAGGTGAGGGCGGG - Intronic
1162832163 19:13292136-13292158 CAGGGTGGACAAAATGAGGGTGG - Intronic
1162926348 19:13932198-13932220 CAGGCTGGTATGAAGGGGGCAGG - Intronic
1162964404 19:14149159-14149181 CAGGCTGGAGAGGAGGGGGCCGG + Exonic
1163081876 19:14950150-14950172 CAGAGAGGAGGGAAGGGGGCTGG - Intronic
1163555404 19:17989496-17989518 CATGGTGCATAGAAGGGGCCTGG + Intronic
1164441814 19:28284865-28284887 GAGGGTGGAGAGAAGGAGGGTGG + Intergenic
1164441822 19:28284880-28284902 GAGGGTGGAGGGAAGGGGGGTGG + Intergenic
1164564303 19:29314921-29314943 CAGGGTGGAGAGGAGGAGGCTGG + Intergenic
1164646582 19:29862734-29862756 TAGTGTGGACTGAAGGGGACAGG + Intergenic
1164956612 19:32392129-32392151 CAGGGAGGAAAGAAGGGGGAGGG + Intergenic
1165373740 19:35426849-35426871 CAGGATGGGCAGGAGGGGGTGGG - Intergenic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165639173 19:37369873-37369895 CAGTGGGAACAGAAGGGGACTGG - Intergenic
1165956545 19:39504933-39504955 CAGTGTAGACAGAAGCGAGCAGG + Intronic
1166136033 19:40777911-40777933 CAGGATTGACAGAAAGAGGCTGG - Intronic
1166322701 19:42028483-42028505 CAGGAGGGGCAGAAGGTGGCTGG - Intronic
1166337213 19:42115620-42115642 AGGGGTGGACAGGAGTGGGCTGG + Intronic
1166416167 19:42596100-42596122 CACGAAGGACAGCAGGGGGCAGG + Intronic
1166538351 19:43590227-43590249 CAGGCTGGACAGGAGTGGGAAGG + Exonic
1166704988 19:44903549-44903571 CAGGGTGGACTGACCGGGGATGG - Exonic
1166707188 19:44914588-44914610 GTGGGTGGACAGAGGGAGGCAGG + Intronic
1167007196 19:46783836-46783858 GAGGGTGGATGGAAGGGGGCAGG + Intronic
1167472294 19:49682075-49682097 CAGGGTGGCCAGGCGGGGCCGGG + Intronic
1167713744 19:51127506-51127528 CAGAGGGGACAGGATGGGGCCGG + Intronic
1168148824 19:54434220-54434242 CATGGAGGACAGACGGGGGTAGG - Intronic
1168179477 19:54651059-54651081 GAGGGTGGAGAGGAGGGGGATGG - Intronic
1168292487 19:55363240-55363262 CAGGGTGGACAGCAGGGGTCTGG + Exonic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168307235 19:55442357-55442379 CCGGGTGGTTGGAAGGGGGCCGG - Exonic
924989029 2:295429-295451 GAGGGTGGGCAGAAGGAGGCAGG - Intergenic
925389614 2:3486363-3486385 CAGGGTGACCAGAAGGAGCCAGG - Intergenic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926214947 2:10900381-10900403 GAAGGTGGACACCAGGGGGCGGG - Intergenic
926364366 2:12119745-12119767 GGGGGTGGACAGAAGTGAGCTGG - Intergenic
926801933 2:16666305-16666327 TAGGGTGGGCAGAAAGGGACTGG - Intronic
927857293 2:26535643-26535665 CAGTGTGGAGAGACTGGGGCAGG - Intronic
928629654 2:33177961-33177983 CAGGGGGTACAGAGGGGTGCAGG - Intronic
929450659 2:42034923-42034945 CTGGGAGGACAGAAGGGTGGTGG + Intergenic
929464182 2:42129891-42129913 CATGAGGGACAGAAGGAGGCAGG + Intergenic
929607532 2:43244911-43244933 TAGGGAGGAAAGAAGAGGGCTGG - Intronic
931864011 2:66390485-66390507 CAGGGTAGAAAGAGGGGGGCTGG - Intergenic
932839077 2:75064837-75064859 CAGAGTGGAGACAAGTGGGCAGG + Intronic
933438728 2:82282598-82282620 TAGGGAGGCCAGAAGGGGGATGG + Intergenic
934511319 2:94946667-94946689 GAGGGTGGCGAGAAGGGAGCAGG - Intergenic
935065148 2:99641037-99641059 CAGGGTGGACAGGGAGTGGCAGG - Intronic
935191952 2:100785155-100785177 CAGGGTGGCCATCAGGGTGCAGG - Intergenic
935217417 2:100985258-100985280 AAGGATGGACAGATGGCGGCTGG - Intronic
935603008 2:104941759-104941781 CAGGCTGGACAGGAGTGAGCAGG - Intergenic
936060616 2:109293470-109293492 CAGTGGAGAGAGAAGGGGGCAGG - Intronic
936460083 2:112707555-112707577 CAGAGTGGACAGAAGAGAACTGG - Intergenic
936569079 2:113600343-113600365 CTGGGTGGACAGACAGGGGCTGG - Intergenic
936674861 2:114702999-114703021 CAGGGTGGGAAGAAGGGGAGGGG + Intronic
937953746 2:127407999-127408021 CAGGGGGAAGAGGAGGGGGCGGG - Intergenic
938062343 2:128263240-128263262 CTGGCAGGATAGAAGGGGGCAGG + Intronic
938436226 2:131285154-131285176 CAGGGTGGGCAGTGGGGTGCAGG + Intronic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
940790395 2:158025241-158025263 CAGGGTGGAGGGAAGGGTGTGGG + Intronic
941170033 2:162125265-162125287 CAGGGAGGAGGGAGGGGGGCTGG - Intergenic
941623420 2:167804468-167804490 TGGGGTGGGCAGAAGGGGGAGGG - Intergenic
945395244 2:209307853-209307875 CTGGGAGTGCAGAAGGGGGCAGG + Intergenic
945983836 2:216339033-216339055 CAGGTTGGACAGAAAGGAGCGGG + Intronic
946016309 2:216606822-216606844 AAGGGGGGCCAGGAGGGGGCCGG - Intergenic
946030204 2:216697622-216697644 AAGGGTAGAGAGAAGGGGGGAGG + Intergenic
946226607 2:218267217-218267239 TAGAGTGGACAGAAGGGGGAAGG - Intronic
946277533 2:218642731-218642753 CAAAGTGGACAGAAGTGGGTAGG + Exonic
947722939 2:232380341-232380363 CAGGGGGCACAGCAGGGGGAGGG + Intronic
947734293 2:232446734-232446756 CAGGGGACACAGAAGAGGGCAGG - Intergenic
947791892 2:232873361-232873383 CACGGGGGACAGATGGGGACAGG + Intronic
948223515 2:236291421-236291443 GAGGGTGGACTACAGGGGGCAGG + Intergenic
948456154 2:238105578-238105600 GAGGATGGACAGGAGGCGGCCGG + Intronic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
948785469 2:240350169-240350191 AAGGGTGGCCAGGATGGGGCAGG + Intergenic
948786786 2:240356853-240356875 CAGGGTCGGCAGGAGGGGACGGG + Intergenic
949003001 2:241628129-241628151 CAGAATGGAGAGAAGGGGGCTGG - Intronic
949065221 2:241986215-241986237 CCGGGTGGACAGGAGCGGGGGGG + Intergenic
1168910566 20:1443652-1443674 CTGGGTGTGCACAAGGGGGCAGG + Exonic
1168967335 20:1906795-1906817 CAGGGTGGTAAGAAGAGGTCAGG + Intronic
1170585446 20:17730752-17730774 CAGAGTGGACAGAAAGGAGTTGG - Intronic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1171473169 20:25388446-25388468 CAAGGTCGACAGGAGTGGGCTGG + Intronic
1171872063 20:30536452-30536474 TAGGGTGGAGGGAAGGGGGAGGG - Intergenic
1172162020 20:32875403-32875425 CAGGGGGCACAGAAGGGAGATGG - Intronic
1172408393 20:34705391-34705413 CAGTGAGGACAGAAGGGGTCAGG - Exonic
1172539342 20:35699100-35699122 CAGGGTGGACAGGAAGGCTCCGG + Intronic
1172645548 20:36467064-36467086 CAGGGCCGAGAGAAGGGGGGGGG - Intronic
1172763692 20:37339510-37339532 CAGGGTGGAAAGAGGGGTGGGGG - Intergenic
1173040107 20:39454139-39454161 CAGGGTGCACAAATGTGGGCAGG - Intergenic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173527686 20:43745397-43745419 CAGGGTGGAAAGATGGGTGGAGG + Intergenic
1173575958 20:44113100-44113122 CAGGGTGGGAGGAAGGGGGATGG + Exonic
1173881578 20:46417076-46417098 CAGGGTGGATGGGAGGGAGCTGG - Intronic
1174172681 20:48627236-48627258 CAGGGTGGAGGGCACGGGGCGGG + Intronic
1174408314 20:50317417-50317439 CAGGGAGGACGAAAGGGAGCTGG - Intergenic
1174408686 20:50320043-50320065 CAGGGAGGACGAAAGGGAGCTGG - Intergenic
1175050155 20:56147912-56147934 CAGTGGGGACGGAAGGGGGACGG - Intergenic
1175158975 20:56994085-56994107 CAGGGAGGTCAGAGAGGGGCAGG - Intergenic
1175178443 20:57128014-57128036 CTGGGCAGACAGAAGGGAGCAGG - Intergenic
1175289742 20:57867879-57867901 CAAGGTGGGCAGAGGTGGGCAGG - Intergenic
1175303078 20:57956790-57956812 CAGTGAGGGCAGAAAGGGGCTGG - Intergenic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1175852963 20:62103783-62103805 CAGGGTGGACCCAGGGTGGCAGG + Intergenic
1175882706 20:62270116-62270138 CAGGGTGGACGGAGGGTGGGCGG - Intronic
1175922203 20:62455544-62455566 CAGGGTGCAGAGAAGGGGCCTGG - Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1176056477 20:63151648-63151670 CTGGGTGGACGGCACGGGGCTGG - Intergenic
1177228915 21:18293617-18293639 CAGAGTGGATGGAAGGGGGTGGG - Intronic
1177751403 21:25288737-25288759 AGAGGTGGGCAGAAGGGGGCAGG + Intergenic
1178258856 21:31080174-31080196 CAGGGTAGAGAGAGGTGGGCTGG + Intergenic
1178372993 21:32042709-32042731 CAGGGCGGGCAGAAGGGGGTGGG + Intronic
1179136099 21:38681353-38681375 CAGGATCGAGAGAAGGGGGGAGG - Intergenic
1179292328 21:40029564-40029586 GAGGGTGGAGAGTAGGAGGCGGG + Intronic
1179750818 21:43466534-43466556 CAGGGTGGTCGGAGGGGGGGGGG - Intergenic
1179884820 21:44309372-44309394 CAGGGGTGAGAGGAGGGGGCGGG + Intronic
1180061670 21:45388495-45388517 CAGGGTGGCCAGAAGAGGACAGG + Intergenic
1180074956 21:45457534-45457556 CTGGCTGGACAGTTGGGGGCAGG + Intronic
1180256978 21:46636152-46636174 AAGGGGGGTGAGAAGGGGGCAGG - Exonic
1180782436 22:18528729-18528751 CAGGGCGGGCGGAAGGGGGCGGG + Intronic
1181125989 22:20702756-20702778 CAGGGCGGGCGGAAGGGGGCAGG + Intergenic
1181239326 22:21468064-21468086 CAGGGCGGGCGGAAGGGGGCAGG + Intergenic
1181458122 22:23070850-23070872 GAGGGTGGACAGAGGGCGCCGGG + Intronic
1181627604 22:24132346-24132368 CAGGGTGGGGAGAAAGGGGTGGG - Intronic
1181851871 22:25755153-25755175 GAGGGTGGACAAAAGGGGAGAGG - Intronic
1182218715 22:28741310-28741332 TAGGGTGGCCAGAAGTGGGTAGG - Intronic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1183327752 22:37203653-37203675 CAGGGTGCACAGTAGGTGGTCGG - Intergenic
1183409200 22:37645120-37645142 GAGGGTGGAGTGAAGCGGGCAGG + Intronic
1183458643 22:37936381-37936403 CAGGAGGGACAGAGTGGGGCAGG - Intronic
1183547119 22:38460274-38460296 CAGGGTGGGCACCAGGGGCCAGG - Intergenic
1183620408 22:38968708-38968730 TAGGGTGCACAGAGCGGGGCTGG + Intronic
1184036326 22:41919992-41920014 CAAGGTGGCCGGAAAGGGGCGGG - Intergenic
1184046975 22:41977689-41977711 CAGGGTGGAAGGAAGAGGGGGGG + Intronic
1184172115 22:42765851-42765873 CATGGTTGACAGAATGGGGTGGG - Intergenic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184406705 22:44304628-44304650 CAGGAGGGCCAGAAGGAGGCTGG - Intronic
1184514392 22:44953015-44953037 CCAGGGGGACAGAAGTGGGCTGG + Intronic
1184551970 22:45209357-45209379 GAGGGTGGCCTGCAGGGGGCAGG - Intronic
1184555979 22:45233314-45233336 CAGGGTGGGCAGACTGAGGCAGG + Intronic
1184742959 22:46439717-46439739 CAGGGTGCTCAGAACGGGGTTGG - Intronic
1185061212 22:48607860-48607882 CAGGGTGGTCAGAAAAGGGCAGG - Intronic
1185128194 22:49023300-49023322 CAGGGTAGACAGGAGGGGAGAGG + Intergenic
1185327934 22:50236643-50236665 GAGGGTGGGCTGGAGGGGGCAGG + Intronic
1185330185 22:50248913-50248935 GAGGGTCGACAGAGAGGGGCTGG + Intronic
1185362154 22:50414780-50414802 CTAGGTGGAGAGATGGGGGCCGG - Intronic
1185394663 22:50580617-50580639 CAGGGAGGCCAGTTGGGGGCAGG + Exonic
949481881 3:4502172-4502194 CGAGGTGGACAGACGGGGGTGGG - Intronic
949926166 3:9043452-9043474 ATGGGTGAACAGAAGGGGGCAGG + Intronic
949961288 3:9314633-9314655 CAGGGTGGGGAGAGGAGGGCAGG - Intronic
949961296 3:9314652-9314674 CAGGGTGGAGAGAGGAGGGCAGG - Intronic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
950202805 3:11056889-11056911 GAGGCTGGACTGGAGGGGGCGGG - Intergenic
950404584 3:12796802-12796824 CGGGAAGGAGAGAAGGGGGCCGG - Intronic
950808782 3:15632008-15632030 CAGCAAGGACAGCAGGGGGCTGG - Intronic
950896329 3:16454978-16455000 CATGGTGGAGAGGAGGAGGCTGG - Intronic
951702451 3:25509943-25509965 CAGGGTGGACAGGAGTTGGTTGG - Intronic
951747877 3:25999361-25999383 CAGGGTGAGCACAAGGGGTCAGG - Intergenic
952132950 3:30385298-30385320 CAGTGTGGAGGGAAGGGGGAAGG + Intergenic
953193873 3:40713921-40713943 CAGGCTGGGCAGAAAGTGGCTGG - Intergenic
953410422 3:42687796-42687818 TGGGGTGGAGAGGAGGGGGCAGG + Intronic
953422154 3:42762463-42762485 CAGGGTAGGCTGGAGGGGGCTGG + Intronic
953984457 3:47430768-47430790 AGGTGTGGACTGAAGGGGGCAGG + Intronic
954317955 3:49811520-49811542 CAGGGTGGATGGAGGGTGGCTGG - Intronic
954613519 3:51958269-51958291 AGGGGTGGCGAGAAGGGGGCAGG + Exonic
955758272 3:62249396-62249418 CAGGGTGGAGGGAAGGGGGTGGG + Intronic
955945215 3:64187387-64187409 AAGGGAGGGAAGAAGGGGGCAGG - Intronic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
956642857 3:71431034-71431056 CATGGTGGACAGAACCAGGCAGG + Intronic
956710118 3:72031712-72031734 CAGGGAGTACAGGAGAGGGCAGG - Intergenic
960248151 3:115422374-115422396 CAGGATGGACAGAAGGGCAAAGG + Intergenic
960945129 3:122961159-122961181 GTGGATGGACAGTAGGGGGCTGG - Exonic
961314212 3:126023419-126023441 CAGGGAGGGCAGGAGGGAGCTGG + Intronic
961603675 3:128078191-128078213 ATGGGGGTACAGAAGGGGGCTGG - Intronic
961635574 3:128330700-128330722 CAGCCTGGGCACAAGGGGGCAGG + Intronic
961723983 3:128913911-128913933 AAGGCTGCACAGAAGGGGGGTGG - Intronic
962327671 3:134449456-134449478 CTGAATGGACAGCAGGGGGCAGG - Intergenic
962436662 3:135373285-135373307 CAGGATGCACTGAAGAGGGCTGG - Intergenic
963925267 3:150944471-150944493 CAGAGGGGAGAGATGGGGGCTGG + Intronic
964904752 3:161706934-161706956 GAGGGTGGACAGAAGCAGGGTGG + Intergenic
966855679 3:184192598-184192620 AAGGTTGGAGAGAATGGGGCTGG + Exonic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
968080089 3:195839903-195839925 CAGGGAGGGCAGATGAGGGCAGG - Intergenic
968593978 4:1473070-1473092 CAGGGTGGGCAGGTGGGGGGTGG - Intergenic
968598101 4:1495699-1495721 CAGCTTGGACAGGCGGGGGCAGG + Intergenic
968637808 4:1691104-1691126 CAGGCTGGACTGAAAGGGCCAGG - Intergenic
969293119 4:6253114-6253136 CAGGGAGGAAGGAAGGGGGACGG + Intergenic
969355206 4:6621020-6621042 CAGTGTGGTGAGAAGGAGGCTGG + Intronic
969991512 4:11268789-11268811 CAGGATGGAAAGAAGGGGTAGGG - Intergenic
970525414 4:16927181-16927203 CTGGGTGGACATCAGGTGGCAGG + Intergenic
972570122 4:40303100-40303122 CAGGAAGGAGAGAAGGAGGCCGG + Intergenic
973844107 4:54893472-54893494 TAAGGTGGACTGAAGGAGGCTGG - Intergenic
974857366 4:67476706-67476728 CAGGGTAGGCAGCAAGGGGCAGG + Intronic
975292153 4:72689406-72689428 CAGTGGGAAAAGAAGGGGGCAGG + Intergenic
976126384 4:81837750-81837772 CAGGGTGGAGGGAATGGGGAAGG - Intronic
977852633 4:101848360-101848382 CATGGCGGACAGGAGGAGGCAGG - Intronic
981081797 4:140644300-140644322 CGGGGTGGACAGCAGGGAGTGGG + Intronic
981429849 4:144646036-144646058 CAGGGTGGAGGGAAGGGGAGGGG - Exonic
981552145 4:145952870-145952892 CAGGGTGGAGGGATGGTGGCAGG - Intergenic
981811828 4:148784265-148784287 CAGGATGGACTGATGGTGGCGGG + Intergenic
982224998 4:153156958-153156980 CAGGGTGGGCAGGCAGGGGCGGG - Intronic
982488446 4:155998321-155998343 GAGGGTGGAAAGAAGGGTGAAGG - Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983764662 4:171463697-171463719 CAGGGTGGAGGGTAGGGGGAGGG + Intergenic
984260797 4:177442141-177442163 CAGGGCGGACGGAAGAGCGCCGG - Intronic
984433507 4:179679795-179679817 TGGGGTGGACGGAAGGGGGAGGG - Intergenic
985680103 5:1251719-1251741 GAGGTTGGACAGAACAGGGCGGG - Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986046557 5:4043925-4043947 CAGTGTGGACTGAAGGGTTCTGG + Intergenic
986278686 5:6304757-6304779 CATGGTGGACAAAAGGGGTGAGG + Intergenic
986729364 5:10623806-10623828 CTGGGTGGACAGGAGGAGGCGGG + Intronic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987550583 5:19375159-19375181 CAGGGCGGAGGGAAGGGAGCAGG + Intergenic
988918433 5:35919487-35919509 CAGGGTGGAAAGATGGTGCCGGG + Intronic
989273457 5:39558814-39558836 CAGAGTGGAAGGAAAGGGGCAGG + Intergenic
990662527 5:58033179-58033201 CAGGGTGGGCAGAAATGGGCAGG + Intergenic
992218642 5:74549745-74549767 CAGGTGGGACAGAAAGGGGGCGG - Intergenic
992551692 5:77865872-77865894 CAGAGTGGACAAACGGAGGCTGG - Intronic
993831885 5:92770546-92770568 CAGGGTGGGCGGTAGGGGGTTGG + Intergenic
994037765 5:95222211-95222233 CAGTGTGGAGAGAAGAAGGCAGG - Intronic
995531402 5:113095223-113095245 AAGGGTGGACAGAAGGCTACAGG + Intronic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
998165132 5:139838473-139838495 GAGGGAGGACACATGGGGGCTGG - Intronic
998212306 5:140209174-140209196 GAGAGAGGACAGAAGGGGACTGG + Intronic
998415920 5:141945930-141945952 CAGAGTGGCCAGACGGGGACAGG + Intronic
999247173 5:150161337-150161359 GAGGATGGACGAAAGGGGGCAGG + Intergenic
999269092 5:150286059-150286081 CAGTGTGGACTGAAGTGGTCAGG - Intronic
999459557 5:151746278-151746300 CAGGATGGACCAAAGGGGGCAGG - Exonic
1001034561 5:168288384-168288406 GAGGGTGGCCAGGAGAGGGCTGG + Intergenic
1001567109 5:172706912-172706934 AAGGGGGCACAGCAGGGGGCGGG + Intergenic
1001692496 5:173643478-173643500 CGGGGAGGAGAGAAGGGGACTGG + Intergenic
1001858286 5:175031755-175031777 CAGGTTGGAAAGAAAGGAGCTGG - Intergenic
1001933251 5:175687667-175687689 AGGGGTGGACAGTAGGGGTCAGG - Intergenic
1002564018 5:180100029-180100051 CAGTGTGGAGAGGTGGGGGCAGG - Intergenic
1002638775 5:180620716-180620738 CTGCGTGGGCAGAAAGGGGCCGG + Intronic
1002705647 5:181159763-181159785 CAGTATGGACTGCAGGGGGCTGG + Intergenic
1002847227 6:957670-957692 CAGGATAGGCTGAAGGGGGCAGG - Intergenic
1004561819 6:16760073-16760095 CAGGGGGCAGGGAAGGGGGCCGG - Intronic
1004859977 6:19793906-19793928 GAGGGAGGACAGAAGAAGGCAGG + Intergenic
1005520606 6:26597634-26597656 GAGGGTGGAAAGAAGAGGGGCGG - Intronic
1006170728 6:32090728-32090750 CAGGGTGAATAGGAGAGGGCTGG - Intronic
1006391434 6:33761309-33761331 CAGGCAGGAGAGAAGGGGACGGG - Intergenic
1006634957 6:35455642-35455664 GGCGGTGGACAGATGGGGGCTGG - Intronic
1006841082 6:37028182-37028204 CAGGGTGGGGAGAGGTGGGCAGG - Exonic
1006844191 6:37051235-37051257 CAGGGTGGGCAGGAGAGGGCTGG - Intergenic
1006947057 6:37791624-37791646 CAGGCTGGCCACATGGGGGCGGG + Intergenic
1007113244 6:39325789-39325811 CAGGGTGGACAAAAGCCTGCAGG - Intergenic
1007167657 6:39840487-39840509 CGGGGTGGTCCGAAGGGGGAAGG + Intronic
1007351564 6:41277345-41277367 CAGGGGGCAGAGACGGGGGCAGG + Intronic
1007382930 6:41502416-41502438 CAGAGTGAACAGGAGCGGGCAGG + Intergenic
1007385545 6:41518067-41518089 CAGGGAGGAAAGAAGGGAGAGGG - Intergenic
1007599213 6:43071468-43071490 CAGGCTGGACTGAAGGGGTCTGG - Intronic
1007637138 6:43306389-43306411 CAGGGTGGGCAGCAAGGGGGAGG - Intronic
1007756111 6:44100881-44100903 GAGGGAGGAGAGAAGGTGGCTGG - Intergenic
1007957882 6:45933746-45933768 CTGGGTGGACAGAGAGGGGCAGG + Intronic
1008614907 6:53217457-53217479 CAGGGTGGACAGCAGTGGTGTGG + Intergenic
1010449984 6:75991603-75991625 AAGGTTGTTCAGAAGGGGGCTGG - Intronic
1012603668 6:101130889-101130911 CTGGGTGGCAAGAAGGGGGAAGG + Intergenic
1013948332 6:115749717-115749739 CAAGGGGTACATAAGGGGGCGGG - Intergenic
1014566056 6:122948823-122948845 CACGTAGGACAGAAGGGGGTGGG + Intergenic
1014676815 6:124377985-124378007 CAGGGTTGACACAATGTGGCAGG - Intronic
1016896017 6:149053981-149054003 CAGGGGTGACAGATGGTGGCAGG - Intronic
1017774196 6:157668147-157668169 CTGGGATGACAGCAGGGGGCAGG - Intronic
1018066614 6:160129026-160129048 CAGTGTGGAGGGACGGGGGCAGG + Intronic
1018654662 6:166024109-166024131 CAGGATGGACAGTAGAGGGAGGG + Intergenic
1018867975 6:167760077-167760099 CAGGGTGGACTGGGGTGGGCTGG + Intergenic
1019210692 6:170402113-170402135 CAGGATGGACCTAAGGAGGCAGG + Intronic
1019384453 7:746677-746699 CAGGGTGGGCAGGGGGTGGCAGG - Intronic
1019527472 7:1487233-1487255 CTTGGTGGCCAGAAGAGGGCAGG - Intronic
1019540857 7:1550399-1550421 CAGGGAGCACAGAGGGGGACCGG + Intronic
1019552170 7:1608447-1608469 CAGGCTGGACAGGAGTGGCCAGG + Intergenic
1019654152 7:2179572-2179594 CAGAGGGAACAGAATGGGGCTGG + Intronic
1019730654 7:2627628-2627650 GAGGGAGGACAGAAGGAGGGAGG + Intergenic
1019925927 7:4191745-4191767 CAGGGTGGACAGGGGGCTGCAGG + Intronic
1020092392 7:5348946-5348968 CAGGGTGGTGGGCAGGGGGCTGG + Intronic
1020112495 7:5455515-5455537 CAGGGAGGACAGGAGGGGCTGGG - Intronic
1020117959 7:5487010-5487032 CAGGGCGCAAAGCAGGGGGCGGG + Intronic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1021964627 7:25905517-25905539 CAGGGTGGACAGCTGGTGCCCGG + Intergenic
1022129945 7:27395786-27395808 CAGCAGGGAGAGAAGGGGGCAGG + Intergenic
1022590360 7:31655416-31655438 CAGTTTGGAGAGAAGGTGGCTGG - Intronic
1022839777 7:34152513-34152535 CAGGGAGGACAGCAGCTGGCTGG - Intronic
1022902492 7:34824902-34824924 CAGGGTGGGATGAAGAGGGCAGG - Intronic
1023402982 7:39803893-39803915 GGGGGTGGGCAGAAGTGGGCAGG + Intergenic
1023461068 7:40397836-40397858 CAGAGTGGACAGAAGGGATATGG - Intronic
1023781616 7:43661013-43661035 CAGGGTGGACAGGAAGTGCCAGG - Intronic
1024646354 7:51374244-51374266 GGGGGTGGGCAGAAGTGGGCAGG - Intergenic
1024890174 7:54191079-54191101 CAGGGAGGAGAGAGGGGGCCAGG + Intergenic
1024991231 7:55235732-55235754 CTAGGTGGGAAGAAGGGGGCAGG - Intronic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1025611370 7:63077945-63077967 CAGAGTGGGCAGCAGCGGGCAGG + Intergenic
1026605296 7:71810762-71810784 CAGGGTTGACAGCAGATGGCTGG - Intronic
1026911647 7:74094763-74094785 CTCGGTGCACAGCAGGGGGCCGG - Intronic
1026930762 7:74221810-74221832 TTGGGTGGACAGAAGGAGGCTGG + Intronic
1029274290 7:99395041-99395063 CAGGATGGACAGCAGTGGGGAGG - Exonic
1029420237 7:100468244-100468266 CAGAGTGGAGGGGAGGGGGCCGG + Intronic
1029954133 7:104619856-104619878 CAGGTGGGGCAGCAGGGGGCGGG + Intronic
1030329083 7:108253854-108253876 CAGGGATGACAGAAGGTTGCTGG + Intronic
1030380365 7:108803965-108803987 CAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1031693728 7:124822167-124822189 CAGTGTTTACAGAAAGGGGCAGG + Intergenic
1032462504 7:132122405-132122427 CAGGGTGGAGGCAAGGGGGAGGG - Intergenic
1032485758 7:132286311-132286333 CAGGGTGGACAGACAGGGCCAGG - Intronic
1032499612 7:132390700-132390722 GTTGGTGGGCAGAAGGGGGCTGG - Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1033647972 7:143319584-143319606 GAGGGTGGAGAGTAGAGGGCAGG + Intronic
1034276718 7:149827069-149827091 CAGTGTGGACAGACAGGGGAGGG - Intergenic
1034404781 7:150896180-150896202 TGGGGTGGACAGCAGGGGACAGG + Intergenic
1034433766 7:151053528-151053550 CAGGGTGGAGAGGAAAGGGCTGG - Intergenic
1034455558 7:151168005-151168027 CTGGGTGGAGGGAAGGGGACCGG - Intronic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034884998 7:154792596-154792618 CAGGATGGAGAGCAGGGGGGAGG + Intronic
1035161639 7:156954801-156954823 TAGGCTGGACAGAACAGGGCTGG - Intronic
1035235802 7:157497070-157497092 CAGGGTGGGCAGGGAGGGGCAGG - Intergenic
1037498445 8:19462966-19462988 CAGGGTGGAGAGTAGGAGGAGGG - Intronic
1039560690 8:38510339-38510361 CAGGGTGGAAAGGAGGGAGGGGG + Intergenic
1039744610 8:40413071-40413093 GAGGGTGGCCAGACGGGGGTTGG - Intergenic
1040987528 8:53312789-53312811 CAGGGTGGACAGTATGTGACAGG - Intergenic
1041145571 8:54872767-54872789 CAGGGTGGGGAGAAAGGGGCAGG - Intergenic
1041577296 8:59413508-59413530 AAGGGTGGAGAGAGGGAGGCAGG + Intergenic
1042540864 8:69906016-69906038 CAGGCTGTGCAGAATGGGGCAGG - Intergenic
1045920936 8:107528374-107528396 CAGGGGGGATAAAATGGGGCAGG - Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047355663 8:124119334-124119356 CAGGTTGGACAGATGGAGGGTGG + Intronic
1048274650 8:133057088-133057110 CCCAGTGGAAAGAAGGGGGCGGG - Intronic
1048378881 8:133846496-133846518 TGGGGTGGACAGATTGGGGCTGG + Intergenic
1048531314 8:135253013-135253035 CTGTGTGGGCAGCAGGGGGCTGG - Intergenic
1049247504 8:141570611-141570633 CAGGGTGCACAGGAGGGCACAGG + Intergenic
1049359174 8:142203856-142203878 CAGGGTGGTCAGCAGGGGCGGGG + Intergenic
1049359184 8:142203880-142203902 CAGGGTGGTCAGCAGGGGCGGGG + Intergenic
1049470426 8:142772883-142772905 AAAGGTGGACAGAAGGAGGCAGG + Intronic
1049530450 8:143151920-143151942 CAGGGTGGACGGAAGGTGGCGGG - Intergenic
1049630513 8:143652657-143652679 CAGTGGGGACAGGAGGAGGCAGG + Exonic
1049767761 8:144362852-144362874 CAGGGTGGACAGGAGAGGGCAGG - Intergenic
1049883451 9:13186-13208 CTGGGTGGACAGACAGGGGCTGG + Intergenic
1050525618 9:6543879-6543901 CAAGGAGGACAGGAGGGGGGGGG + Intronic
1052366967 9:27622913-27622935 CAGGGTGAAGAGAATGGGGGAGG + Intergenic
1052834379 9:33239808-33239830 CAGGAGGCAGAGAAGGGGGCTGG - Intronic
1052834515 9:33240574-33240596 CTGTGGGGACAGAAGGGAGCAGG + Intronic
1053495446 9:38545387-38545409 CAGGGTGGGCAGCAGGGTGCAGG - Intronic
1053654056 9:40197600-40197622 GAGGGTGGCGAGAAGGGAGCAGG + Intergenic
1053904443 9:42826776-42826798 GAGGGTGGCGAGAAGGGAGCAGG + Intergenic
1054366171 9:64343816-64343838 GAGGGTGGCGAGAAGGGAGCAGG + Intergenic
1054530542 9:66178738-66178760 GAGGGTGGCGAGAAGGGAGCAGG - Intergenic
1054673801 9:67833546-67833568 GAGGGTGGCGAGAAGGGAGCAGG + Intergenic
1054766254 9:69045002-69045024 CAGGGTGGTTAGCAGGAGGCTGG - Intronic
1057489673 9:95511223-95511245 CGGGGAGGAAGGAAGGGGGCGGG - Intronic
1057671747 9:97096771-97096793 CAGAGAGGAAAGAATGGGGCAGG - Intergenic
1058102542 9:100933264-100933286 CGGGGAGGGAAGAAGGGGGCAGG - Intergenic
1058157376 9:101530596-101530618 GATGGTGAACAGAAGGTGGCTGG + Intronic
1058743429 9:107966689-107966711 CTGGGAGGACAGAGGAGGGCTGG + Intergenic
1059671652 9:116497714-116497736 CAGGCTGGGGAGAAGGGGGAGGG + Intronic
1059680012 9:116576761-116576783 CAGGGTGTACAGAAGTGTTCTGG + Intronic
1060298952 9:122362820-122362842 CTGGATGGAGAGAAGGGGGAGGG - Intergenic
1060481988 9:124021901-124021923 CTGGGTGGGCAGGTGGGGGCGGG + Intronic
1060529467 9:124339873-124339895 GAGGGTGGACAGCAGTGGGCGGG + Intronic
1060540486 9:124426820-124426842 CAGAGGGGACAGAAGGGTTCTGG - Intergenic
1061232329 9:129322011-129322033 CAGAGTGGGCAGAAGAGGACGGG - Intergenic
1061359575 9:130132421-130132443 CAGGGTGGACACAGGACGGCAGG - Intronic
1062050273 9:134443492-134443514 CAGCGTCGCCAGCAGGGGGCAGG - Intergenic
1062079952 9:134618571-134618593 CAGGGTGGACATGAGGCTGCGGG + Intergenic
1062361895 9:136192363-136192385 AAGGGTGGACAGGAGCGGGTGGG - Intergenic
1203761226 EBV:13643-13665 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203762155 EBV:16715-16737 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203763084 EBV:19787-19809 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203764013 EBV:22859-22881 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203764942 EBV:25931-25953 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203765871 EBV:29003-29025 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203766800 EBV:32075-32097 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203767729 EBV:35147-35169 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203781606 EBV:104132-104154 CAGGGTGGACAGCAGCGTCCTGG - Intergenic
1186212325 X:7262408-7262430 CAGGGTGGAGACATGGGGCCTGG - Intronic
1187809820 X:23163290-23163312 AAAGCTGGACAGAAGTGGGCTGG + Intergenic
1188203374 X:27321194-27321216 ATGGTTGGACTGAAGGGGGCTGG - Intergenic
1189185056 X:39047635-39047657 CAGGGAGGAGAGAAGGTGGTGGG - Intergenic
1189382861 X:40514062-40514084 CAGGGTGGAGTGAAGGAGGGAGG + Intergenic
1190332606 X:49245134-49245156 AAAGGTGGACAGAAGGGGAGGGG - Intronic
1192848681 X:74931011-74931033 CATGTTGGACAAATGGGGGCAGG - Intergenic
1193746658 X:85290102-85290124 AAGGGTGGAGAGATGGCGGCAGG - Intronic
1196287068 X:113895482-113895504 GAGGGAGGACAGAAGGGGAGAGG - Intergenic
1197621059 X:128749471-128749493 TAGAGGGGACAGAATGGGGCTGG + Intergenic
1197765477 X:130057073-130057095 CAGGGAGGCCAGAACGGGGTGGG - Exonic
1198394617 X:136208946-136208968 GAGGGTAGAAAGAAGGGGGTGGG + Intronic
1199715727 X:150506267-150506289 AAGGGAGGACAGAAGAGGGGAGG - Intronic
1200049125 X:153419396-153419418 CAGGCTAGACGGATGGGGGCCGG + Intronic
1200402365 X:156026963-156026985 CTGGGTGGACAGACAGGGGCTGG - Intergenic
1200842058 Y:7792447-7792469 CATGGTGGAGAGTAGGAGGCTGG - Intergenic
1200878884 Y:8190607-8190629 CATGTTGGCCAGGAGGGGGCTGG + Intergenic
1201291055 Y:12421144-12421166 TATGGAGGACAGACGGGGGCGGG - Intergenic
1202368493 Y:24182574-24182596 CATACTGGACAGAAGGGGGCAGG + Intergenic
1202370511 Y:24192675-24192697 CAAGGTGGAAACAATGGGGCCGG - Intergenic
1202500273 Y:25477442-25477464 CAAGGTGGAAACAATGGGGCCGG + Intergenic
1202502292 Y:25487543-25487565 CGTACTGGACAGAAGGGGGCAGG - Intergenic