ID: 901186687

View in Genome Browser
Species Human (GRCh38)
Location 1:7378100-7378122
Sequence GACTCAGATGTGTCTGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901186687_901186691 1 Left 901186687 1:7378100-7378122 CCTCACTCAGACACATCTGAGTC 0: 1
1: 0
2: 3
3: 32
4: 257
Right 901186691 1:7378124-7378146 GTCCTGGGAGATGGTGTTAGAGG 0: 1
1: 0
2: 2
3: 23
4: 241
901186687_901186690 -8 Left 901186687 1:7378100-7378122 CCTCACTCAGACACATCTGAGTC 0: 1
1: 0
2: 3
3: 32
4: 257
Right 901186690 1:7378115-7378137 TCTGAGTCTGTCCTGGGAGATGG 0: 1
1: 0
2: 5
3: 34
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901186687 Original CRISPR GACTCAGATGTGTCTGAGTG AGG (reversed) Intronic
900631904 1:3640924-3640946 TCCTAAGATGTGCCTGAGTGGGG - Intronic
901186687 1:7378100-7378122 GACTCAGATGTGTCTGAGTGAGG - Intronic
902204203 1:14855416-14855438 GAGTCAGATGTGTGTTGGTGGGG - Intronic
902726088 1:18337137-18337159 GACTCAGAAGTGTCAGAGCTGGG - Intronic
902758504 1:18565433-18565455 GACACTGATGTGGCTGAGAGAGG + Intergenic
903093947 1:20951104-20951126 GATTAAGATGTGGGTGAGTGTGG + Intronic
903311871 1:22465358-22465380 TACTCAGCTGTGGCTGAGTCCGG + Intronic
904295322 1:29516552-29516574 GACTCTGGAGTGTCTGTGTGAGG + Intergenic
904392651 1:30196063-30196085 GCCTCAGATGTGTGGGAGTGGGG + Intergenic
906110305 1:43318066-43318088 GAAGCAGGTGTGTGTGAGTGGGG + Exonic
906830729 1:49028504-49028526 GACTATGATGTGCCTGATTGTGG - Intronic
908124129 1:61013434-61013456 AACTCAGATGTGGATGGGTGGGG - Intronic
908718724 1:67099487-67099509 AACACAGATGGGGCTGAGTGTGG + Intronic
910123442 1:83815434-83815456 AACTCAGATGGGCCTGGGTGTGG + Intergenic
910152116 1:84162244-84162266 GACTATGATATGTCTCAGTGTGG + Intronic
911297544 1:96135875-96135897 GTCTCTGATGTCTCTGAGGGTGG + Intergenic
913252511 1:116923746-116923768 TGCTCAGATGTGGCTCAGTGTGG - Intronic
914950174 1:152107287-152107309 AACTCAGATGTTTCTGGTTGTGG - Exonic
916595469 1:166238135-166238157 AACTATGATGTGTCTGAGTGTGG + Intergenic
918035085 1:180862270-180862292 GACTCATCTGGGTCTGACTGTGG - Intronic
920191869 1:204198965-204198987 GACGCAGTTGTAGCTGAGTGTGG - Intronic
922006966 1:221541120-221541142 GACTCAGATGTGACTGAATCCGG - Intergenic
923820726 1:237437340-237437362 GACCCAGATGTGGCTGGGCGCGG - Intronic
924610877 1:245572826-245572848 GGCTCAGATGTGTCTTTGCGGGG + Intronic
1062819159 10:521329-521351 GATTCTGAGGTGCCTGAGTGGGG + Intronic
1063809320 10:9686013-9686035 GATTCAGAGGTGACTGGGTGTGG + Intergenic
1064288094 10:14010408-14010430 GACTCAGATGTGTGGGAGTCTGG - Intronic
1065607463 10:27433192-27433214 GACTATGATGTGCCTAAGTGTGG - Intergenic
1066281573 10:33923214-33923236 GGGTCAGATGTGTCTGGGTGGGG + Intergenic
1067056521 10:43055824-43055846 GAGTGACATGTGTTTGAGTGAGG + Intergenic
1068824518 10:61419861-61419883 AGCTGAGATGTGTCTAAGTGTGG - Intronic
1069257239 10:66348011-66348033 CACTAAGGTGTGTCTAAGTGCGG - Intronic
1069635610 10:69923044-69923066 GACTCTGATGTAACTGAGTCAGG + Intronic
1069825263 10:71251015-71251037 GACTCAGATCTGGCTCAGTTGGG + Intronic
1070684495 10:78470919-78470941 GACAGAGAGCTGTCTGAGTGGGG + Intergenic
1071355870 10:84793720-84793742 GACTCAGAAGGGTGTGAGAGTGG - Intergenic
1073906463 10:108286490-108286512 GATTCTAATGTGTCTTAGTGTGG + Intergenic
1074937641 10:118201547-118201569 GATTATGATGTGTCTGGGTGTGG + Intergenic
1075400605 10:122158975-122158997 GTCTCAGGTGTGTCTGTGTCTGG - Intronic
1075833202 10:125428548-125428570 GACTCAGATGTCCCACAGTGGGG + Intergenic
1075900902 10:126042129-126042151 GGCTCAGATGAGTGTCAGTGAGG + Intronic
1075996330 10:126879079-126879101 GTCTCAGATGGGTCTGCGTGGGG - Intergenic
1078954857 11:16181009-16181031 GACCCAGATGTGTCTGTGTGGGG + Intronic
1080334095 11:31175588-31175610 GACACAGGTGTGCATGAGTGTGG - Intronic
1080430563 11:32195164-32195186 GACTCTTCTGTGTCTGATTGAGG - Intergenic
1080813575 11:35730522-35730544 GACTCTGATGTGTCTGGCTATGG - Intronic
1081446838 11:43138949-43138971 GATGCAGATGTGTTTGAGGGTGG - Intergenic
1081862386 11:46340693-46340715 GAGACAGATGTGTCTGAGCTGGG - Intronic
1082659596 11:55894402-55894424 GACAAAGATGTGTCTCAGGGGGG - Intergenic
1082794725 11:57370797-57370819 GGCCCAGATGTGTGTGGGTGTGG - Intergenic
1084110995 11:67014205-67014227 GACTCAGATGTATCTTTTTGGGG + Intronic
1085532358 11:77199456-77199478 GCCTGAGATGTGTCTGAGCTGGG + Intronic
1085753187 11:79180252-79180274 CACTCTCAAGTGTCTGAGTGTGG + Intronic
1085805033 11:79627923-79627945 GACTCAGATGTGACTTTGTAAGG - Intergenic
1086463801 11:87033241-87033263 GTCTCAGAGGTTTGTGAGTGTGG + Intergenic
1087577950 11:100013177-100013199 GACTCAGAAGTGTGGGAGGGTGG + Intronic
1088369084 11:109069009-109069031 GACTATGATGTTTCTGGGTGTGG - Intergenic
1088961569 11:114671473-114671495 TACTATGATGTGTCTGGGTGTGG - Intergenic
1088998199 11:115022419-115022441 GATTATGATGTGTCTCAGTGTGG - Intergenic
1089356635 11:117858201-117858223 AACGCAGCTGTGTGTGAGTGGGG - Intronic
1091883968 12:4002763-4002785 GGCTCAGCTGGGTCTGAGTCAGG + Intergenic
1092108445 12:5941685-5941707 GACTCTGATGTATCTAGGTGTGG - Intronic
1092319857 12:7460568-7460590 GCCTCAGGTGTGACTCAGTGTGG + Intronic
1092379352 12:7982365-7982387 GACTTAGTTGTATCTGGGTGTGG + Intergenic
1094281588 12:28746008-28746030 GACTCTGATGTGTCTACGAGTGG + Intergenic
1095750184 12:45701888-45701910 CACTATGATGTGTCTAAGTGTGG + Intergenic
1096238853 12:49948733-49948755 GACTCAGAGGGGTCTGGCTGGGG - Intergenic
1097430671 12:59501570-59501592 GAATCAGATGTCAGTGAGTGGGG - Intergenic
1097661340 12:62434914-62434936 TTCGCAGCTGTGTCTGAGTGGGG + Intergenic
1099059502 12:77888822-77888844 GAGTCATATGTGTGTGACTGTGG + Intronic
1099386941 12:82025720-82025742 GACTCAGATCGGTGGGAGTGTGG + Intergenic
1101324918 12:103706897-103706919 GGCACAGGTGTGTGTGAGTGTGG + Exonic
1101775939 12:107793859-107793881 GAGTGAGAGGTGTCTGAGTGTGG - Intergenic
1105474458 13:20718599-20718621 GGGGCAGGTGTGTCTGAGTGTGG - Intronic
1105474500 13:20718828-20718850 GGGGCAGGTGTGTCTGAGTGTGG - Intronic
1107631571 13:42348489-42348511 AGCTCAGCTGTGTCTCAGTGAGG - Intergenic
1111078275 13:83267260-83267282 GACTCAGATATATCTGAGTGTGG - Intergenic
1111573811 13:90123348-90123370 GACTATGCTGTGTCTGGGTGTGG - Intergenic
1114369729 14:22073452-22073474 TGCTATGATGTGTCTGAGTGTGG + Intergenic
1114621320 14:24098069-24098091 GACTGAGATGTGATTGGGTGGGG + Intronic
1114675581 14:24437958-24437980 GTCTCAGGTGTGTCTGCCTGTGG + Exonic
1114909558 14:27173121-27173143 GACTATAATGTGTCTGAGTGTGG + Intergenic
1116304129 14:43228750-43228772 GACTCAGATGTGTATAAAAGCGG - Intergenic
1117636380 14:57748508-57748530 GACTCAGCTGTTGTTGAGTGAGG - Intronic
1120242046 14:81960657-81960679 GAGTCAGTTGTGTGTAAGTGGGG - Intergenic
1120736818 14:88062588-88062610 GACTCTGATGTGTCTTGCTGTGG - Intergenic
1121138272 14:91518328-91518350 GACTCAGAGGAGCCTGACTGAGG + Intergenic
1121483138 14:94293471-94293493 GATTCAGCTCTGTCTGGGTGGGG + Intergenic
1122391316 14:101387530-101387552 GACTTAAATGTGGCTGGGTGCGG - Intergenic
1123412518 15:20072370-20072392 GACGTACATGTGTCTGTGTGTGG + Intergenic
1123521860 15:21079483-21079505 GACGTACATGTGTCTGTGTGTGG + Intergenic
1123705633 15:22949100-22949122 GACCGTGATGTGTCTGGGTGTGG - Intronic
1123975463 15:25549529-25549551 GACTAAGATGTGTCTTGGTGTGG - Intergenic
1125967745 15:43887807-43887829 TACTAAGATGTATCTGAATGAGG - Intronic
1127342133 15:58058216-58058238 GACTGAGATGTGTGTGATAGTGG - Intronic
1128284189 15:66422678-66422700 GACTATGATGTGTCTAGGTGTGG + Intronic
1130392539 15:83471853-83471875 GACTATGATGTGTCTTGGTGTGG + Intronic
1132049542 15:98595770-98595792 TTCTCAGATATGGCTGAGTGCGG + Intergenic
1132366529 15:101261810-101261832 GACTTATACGTGCCTGAGTGTGG - Intergenic
1132464168 16:70080-70102 GACTCAGTTGGGTCTGACAGGGG + Intronic
1135737211 16:24941675-24941697 GACCCAGATGTACGTGAGTGGGG - Intronic
1135973774 16:27091721-27091743 GACTGTGATGTGTCTTGGTGTGG - Intergenic
1137907893 16:52343156-52343178 GATTTTGATGTATCTGAGTGTGG - Intergenic
1138878327 16:60979610-60979632 TGCTCAGCTCTGTCTGAGTGGGG - Intergenic
1140703075 16:77600814-77600836 GAGTAAGATGTGTCTTGGTGTGG - Intergenic
1144503074 17:15806424-15806446 CACTCAGATGGCTCTGAGTGTGG - Intergenic
1144740939 17:17581899-17581921 GACTATCATGTCTCTGAGTGGGG - Intronic
1145165256 17:20609130-20609152 CACTCAGATGGCTCTGAGTATGG - Intergenic
1147568468 17:41552255-41552277 GAGTGAGCTGTGTCTGAGTTGGG - Intergenic
1147947024 17:44086169-44086191 GACACAGACGTGCCTGAGGGTGG - Intronic
1149154087 17:53605645-53605667 CACTGAGGTGTGTCTGAGTGTGG - Intergenic
1150628672 17:66860327-66860349 GACTATGATGTGTCTGGGTGTGG - Intronic
1150870090 17:68898033-68898055 TACTCTGATGTGTCTGGGTTTGG - Intronic
1151342760 17:73482341-73482363 GATACAGATGTGTCTGAAAGCGG + Intronic
1151690776 17:75683849-75683871 AACTCAGATGTGACTCACTGGGG + Intronic
1152465483 17:80463998-80464020 GACTTAGCTGTGCGTGAGTGTGG + Intergenic
1152884278 17:82840213-82840235 GACTCAACTGTCTGTGAGTGCGG + Exonic
1153917486 18:9758758-9758780 GTCTCAGCTGTGTGCGAGTGTGG + Intronic
1155990460 18:32274205-32274227 GATTCAGAAGTGACAGAGTGAGG + Intronic
1157783451 18:50460510-50460532 AACTCAGATGTGACTGAAAGGGG + Intergenic
1158232926 18:55278855-55278877 GACCAAGATGTGGCCGAGTGCGG - Intronic
1158432963 18:57407494-57407516 GACTATGATTTGTCTTAGTGTGG - Intergenic
1159692427 18:71505530-71505552 GCCTGACATGTGTCAGAGTGGGG + Intergenic
1160127246 18:76187191-76187213 GACTAACATGTTTCTGAGTATGG + Intergenic
1160302601 18:77698758-77698780 GACTCTGATGCATCTCAGTGTGG - Intergenic
1160589049 18:79930135-79930157 GACTGTGATGTGTCAGGGTGTGG - Intronic
1162971246 19:14182675-14182697 GGCTCAGATGGGTCTGGGGGTGG + Intronic
1165537396 19:36460747-36460769 GATTATGATGTGTCTGAGTATGG - Intronic
1166756710 19:45196946-45196968 GACTCAGAAGAGTTTGAGTGGGG + Intronic
1166985018 19:46654636-46654658 GTCTCACATGGGTCTGAGTGAGG + Intronic
1167734778 19:51287140-51287162 TACTTTGATGTGACTGAGTGTGG + Intergenic
1168311978 19:55465047-55465069 GGCACAGGTGTGTCTGAGGGTGG - Intergenic
926158894 2:10474383-10474405 GACACAGATGTGCCAGAGAGAGG + Intergenic
926953003 2:18264357-18264379 GACTGATATGTGTGTGAATGGGG + Intronic
927332888 2:21886816-21886838 GGGTAAGATGTGTCTGTGTGAGG - Intergenic
927407769 2:22791575-22791597 GTCTCAGGTGTGTCTAAGTCAGG - Intergenic
927432368 2:23037773-23037795 AACACAGATGTTTGTGAGTGGGG - Intergenic
927831703 2:26356956-26356978 GACTCACGTGTGTGTGTGTGTGG - Intronic
927881646 2:26693423-26693445 GACTCCGAAGTGTGTGAGAGGGG + Intronic
932233507 2:70102430-70102452 TACTAAGATGTGGCTGGGTGTGG - Intergenic
932858021 2:75258970-75258992 CACTCTGATATGTCTGAGTGTGG + Intergenic
932894604 2:75626674-75626696 GCCTCAGAGGCATCTGAGTGTGG + Intergenic
933196890 2:79400834-79400856 GACTGTAATGTGTCTCAGTGTGG - Intronic
935061346 2:99610740-99610762 GACTCTGATGAGTCTGGGTGGGG + Intronic
935170915 2:100611065-100611087 GAATCTGATGAGCCTGAGTGTGG + Intergenic
935390665 2:102549498-102549520 GACTCTGATGTGTCTAGGTGTGG - Intergenic
936340750 2:111630617-111630639 GGCTATGATGTGTCTGGGTGTGG + Intergenic
936365447 2:111850360-111850382 GACTGACATGTCTCTCAGTGAGG + Intronic
936558408 2:113515621-113515643 GATGCAGATGTGTTTGAGTGTGG + Intergenic
940024211 2:149188266-149188288 GACTCAGAGGTGTCAGATTCTGG + Intronic
940120558 2:150260006-150260028 GACTCATTAGTGTCTGAATGTGG + Intergenic
941425316 2:165337516-165337538 GACTAAGATGTGCCTAAGTATGG - Intronic
941661913 2:168203882-168203904 GACTCAGCTCTGGCTGGGTGCGG - Intronic
942157122 2:173141762-173141784 AACTATGATGTGACTGAGTGTGG - Intronic
942792253 2:179774141-179774163 GACTGTGATGTGTATGAATGTGG + Intronic
943679598 2:190754389-190754411 GATTATGATGTGTTTGAGTGTGG + Intergenic
946051478 2:216866314-216866336 GACCCAGATGCTTTTGAGTGTGG + Intergenic
946089473 2:217207977-217207999 GACTCAGCTGCTTCTGTGTGCGG + Intergenic
946440535 2:219691524-219691546 GATTCAGGGGTGACTGAGTGAGG - Intergenic
946610890 2:221456576-221456598 GCCTCAGAAGTGACTGAGTCTGG + Intronic
947195646 2:227564172-227564194 CACTGTGATGTGTCTGAATGTGG + Intergenic
947360812 2:229343553-229343575 CACTCAGATGTGATTGGGTGGGG + Intergenic
948763218 2:240205288-240205310 TACTCAGCTGTGTTTGTGTGAGG + Intergenic
1169290982 20:4352495-4352517 GACTATGATGTATCTGAGTATGG + Intergenic
1169561559 20:6806377-6806399 GACTATGATGTGTCTAGGTGTGG - Intergenic
1171935322 20:31269616-31269638 GTCTGAGATGTGTGTGTGTGAGG - Intergenic
1172371716 20:34398351-34398373 ATCTGAGATGTGGCTGAGTGAGG - Intronic
1172428740 20:34873445-34873467 GAGTCAGAAGTGTCGGGGTGCGG - Intronic
1173236519 20:41250727-41250749 AATTAAGATGTGTCTTAGTGTGG - Intronic
1173653381 20:44682143-44682165 CACACATGTGTGTCTGAGTGTGG - Intergenic
1174162187 20:48559354-48559376 GACTCAGCTGGGCCTGGGTGGGG - Intergenic
1174290315 20:49503737-49503759 GACTCAGTTCTGTCTGTGAGAGG + Intergenic
1176167416 20:63681377-63681399 GACTCAGAAGTCCCTGACTGGGG + Intronic
1178823913 21:35999403-35999425 AACTCAGATTTCTCTAAGTGGGG - Intronic
1180003404 21:45005917-45005939 GATTATGATGTGTCTGGGTGTGG + Intergenic
1180029038 21:45189901-45189923 GATTAAAATGTGTCTTAGTGTGG + Intronic
1181269772 22:21652334-21652356 GAGTCAGCTGTGTCTGAGGAGGG + Intronic
1181855594 22:25779554-25779576 GAATCGCATGTGTCTGAGGGTGG + Intronic
1183274211 22:36881981-36882003 GACTATGATGTGTTTAAGTGTGG - Intergenic
1183818817 22:40327223-40327245 GACGCACATGTGTGTGTGTGTGG + Exonic
949485193 3:4531408-4531430 GCCTCCTTTGTGTCTGAGTGTGG + Intronic
952272616 3:31847696-31847718 AAGTCAGAAGTGTCTCAGTGAGG + Intronic
953672397 3:44974559-44974581 CACTTAGATGTGTTTGTGTGTGG - Intronic
954877291 3:53810411-53810433 TGCTCAGAAGTGTCTGATTGAGG - Intronic
955887872 3:63619632-63619654 AACTCAGATTTTTGTGAGTGTGG - Intergenic
955922782 3:63974915-63974937 GCATCAGATGTGTTTGGGTGTGG + Intronic
956024484 3:64968241-64968263 TACTATTATGTGTCTGAGTGTGG + Intergenic
959761213 3:109967589-109967611 GAGTCAGATGCTTCTGATTGAGG - Intergenic
960088440 3:113615056-113615078 GATTCAGATGTGTCTGACACAGG + Intronic
960292879 3:115907615-115907637 GGGTCAGATGGGTCTGACTGGGG - Intronic
961636110 3:128334143-128334165 GACTCAGATGTGGCAGAGGCAGG - Intronic
964309444 3:155376986-155377008 GAAACACATGTGTGTGAGTGTGG + Intronic
966305829 3:178533685-178533707 TTCTCAGATGGGTCTGAGTTAGG + Intronic
969102045 4:4776690-4776712 AACCCAGATCTGCCTGAGTGTGG + Intergenic
969545924 4:7827718-7827740 GACTGCGATGTGTCTCAGTGCGG - Intronic
969701453 4:8769966-8769988 GACGCAGATGTCTTTGGGTGTGG + Intergenic
972520944 4:39856015-39856037 GACCCTGATGTGTCTCAGTGTGG - Intronic
972733368 4:41816579-41816601 AGCTGAGATCTGTCTGAGTGTGG - Intergenic
973272660 4:48277537-48277559 GACTATGATGTGTCTCAGTGTGG - Intergenic
974664080 4:64935635-64935657 GGCTCTGATGGGTCTCAGTGTGG - Intergenic
975045404 4:69797103-69797125 GACCAAGATGAGACTGAGTGAGG + Intergenic
975164869 4:71167160-71167182 GACTCACATGTGCCTGTGTTGGG + Intergenic
976553284 4:86421476-86421498 CACTCACAAGTGTCTTAGTGAGG + Intronic
976963993 4:91012496-91012518 GACAAAGCTGTGTCTGGGTGGGG + Intronic
977039080 4:91991920-91991942 CACTATGATGTGTCTGGGTGTGG - Intergenic
977055581 4:92186485-92186507 GTCTAGGATGTGTCTGAGTTGGG + Intergenic
980613769 4:135192697-135192719 GTCTCAGAGGTGTCTGAGAGAGG + Intergenic
980900672 4:138902206-138902228 GTCTCAGAAGTGTCTTGGTGGGG - Intergenic
982112778 4:152071872-152071894 GAGTGAACTGTGTCTGAGTGTGG + Intergenic
982307277 4:153945828-153945850 GACTCTGATGTGTCTCAATGTGG + Intergenic
983120248 4:163874438-163874460 GACTGAGATTTGTATTAGTGGGG + Intronic
983426170 4:167586409-167586431 AAATCATATGTGACTGAGTGCGG + Intergenic
984048654 4:174835791-174835813 GACTCAGAGGAGTCTGACTCAGG + Intronic
985818325 5:2143086-2143108 GACTCAGATGTGGAGGAATGAGG - Intergenic
987384563 5:17316750-17316772 GCCTCAGATGGGAATGAGTGTGG - Intergenic
992426785 5:76665954-76665976 GAGTCAGATGTCTCTCAGAGTGG + Intronic
992987431 5:82247099-82247121 GACTATGATGTGTCTAGGTGTGG + Intronic
993008183 5:82451021-82451043 GACTCAGCTGAGTCTGAGATGGG - Intergenic
1000619504 5:163467085-163467107 GTTTCAGATGTTTCTAAGTGGGG - Intronic
1001091622 5:168746250-168746272 GCATCAGATGTGTGTGGGTGTGG + Intronic
1001146507 5:169189155-169189177 GACTCATGTGTGTATTAGTGGGG - Intronic
1001689658 5:173623651-173623673 GGCTCAGGTGTGGCTGGGTGTGG + Intergenic
1003295960 6:4828576-4828598 GATTATGATGTGTCTCAGTGTGG + Intronic
1003557804 6:7156515-7156537 AACCCAGATGTGGCTCAGTGCGG - Intronic
1004952410 6:20688727-20688749 GACTCAGATATGGCAGAATGTGG - Intronic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1007473117 6:42103637-42103659 GACTCCTCTGTGTCTGAGTCAGG + Exonic
1007938450 6:45754697-45754719 TTCCCAGGTGTGTCTGAGTGTGG + Intergenic
1008349697 6:50475135-50475157 GACTAAGATGTGTCTTGGTATGG - Intergenic
1009818650 6:68770828-68770850 CAGTCAGGTGTGTCTGACTGTGG - Intronic
1010408552 6:75534229-75534251 GACTATGATGTGTCTAAGTGTGG - Intergenic
1010507334 6:76676186-76676208 AACACAGAAGTGTCTGGGTGTGG + Intergenic
1012057161 6:94427688-94427710 GATTCTGATGTGTCTCAGTATGG + Intergenic
1012969498 6:105712904-105712926 GATTCAGATGAGTCCGGGTGTGG + Intergenic
1016855114 6:148660663-148660685 AACTATGATGTGTCTGTGTGTGG - Intergenic
1017796928 6:157853401-157853423 GACTATGATGTGTCTTTGTGTGG + Intronic
1020146171 7:5645190-5645212 GACTCTGATGTGTCGTGGTGTGG + Intronic
1022395596 7:29985577-29985599 AACACAGATGTGTCAGAATGAGG + Intronic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1023247872 7:38225851-38225873 GACACGGATGTGTCTGCATGTGG + Intronic
1023504859 7:40888849-40888871 GACTCAGATGCACCTGGGTGTGG + Intergenic
1023646403 7:42320917-42320939 GTCTAAGATGTGTCTAAGAGTGG + Intergenic
1023738873 7:43259999-43260021 GACTATGATGTGCCTGGGTGTGG - Intronic
1024648180 7:51385799-51385821 GACTCAGGTGAGTATGGGTGTGG + Intergenic
1026243510 7:68597785-68597807 GACTCAAATGTGGCTGGGTGGGG - Intergenic
1028708227 7:93875340-93875362 GGCTCAGATGTGTCTGAATGAGG + Intronic
1029218566 7:98970010-98970032 GAGTCAGAGGTGCCTGAGTGAGG + Intronic
1030351198 7:108489903-108489925 CACTTAGATGTGTCTCAATGTGG - Intronic
1030901714 7:115132666-115132688 GTCTCAAATGTGTTGGAGTGGGG + Intergenic
1032361058 7:131255323-131255345 TACTCTGATGTGTCTGGGTATGG - Intronic
1035420480 7:158725479-158725501 AACTAAGATGTGCCTGCGTGTGG + Intergenic
1036588774 8:10148898-10148920 AACTCCGATGAGTCCGAGTGAGG + Intronic
1037015679 8:13903253-13903275 GACACAGATGTGTCTGTCTTGGG - Intergenic
1038076243 8:24078186-24078208 GACTCAGATATTTGTGAATGTGG + Intergenic
1038818290 8:30929128-30929150 GATTATGATGTGTCTCAGTGTGG + Intergenic
1039228787 8:35419954-35419976 GCCCCAGATGTGGCTGAGTCTGG + Intronic
1040617647 8:49054628-49054650 GAACTATATGTGTCTGAGTGTGG + Intronic
1041657154 8:60364440-60364462 GACTATGATATGTCTGGGTGTGG - Intergenic
1042413845 8:68496718-68496740 AACTCAGATTTGTCTGCCTGGGG - Intronic
1046175793 8:110573271-110573293 GATTTAGATGTGTCCAAGTGAGG - Intergenic
1046372674 8:113329665-113329687 CACTGTGATGTGTCTGGGTGTGG - Intronic
1047099590 8:121661906-121661928 GACACAGCAGTGACTGAGTGTGG - Intergenic
1048127560 8:131653794-131653816 GATTATGATGTGTCTAAGTGTGG - Intergenic
1049426789 8:142541341-142541363 GAATCAGAGGTGTCTGGGTATGG + Intronic
1049648702 8:143752422-143752444 GACTATAATGTGTCTCAGTGTGG + Intergenic
1049894457 9:100646-100668 GATGCAGATGTGTTTGAGTGTGG - Intergenic
1050839613 9:10131696-10131718 AACTCAGAAGTGTGTGTGTGTGG + Intronic
1051254377 9:15197677-15197699 GACTATGATGTGCCTAAGTGTGG - Intronic
1053735667 9:41100638-41100660 GATGCAGATGTGTTTGAGTGTGG - Intergenic
1054692713 9:68330762-68330784 GATGCAGATGTGTTTGAGTGTGG + Intronic
1056088242 9:83177704-83177726 TACTATGATGTGTCTGTGTGTGG + Intergenic
1056645266 9:88406217-88406239 GACTGAAATGTCTCTGTGTGGGG + Intronic
1057018430 9:91676314-91676336 CACTTACATGTGGCTGAGTGGGG - Intronic
1057517470 9:95734253-95734275 GACACAGATGTGTGTGTGTGTGG + Intergenic
1058641473 9:107089840-107089862 GACTCTGATATGTCTTAGTGTGG - Intergenic
1061012978 9:127966238-127966260 GACCTAGATGTGTCTGACTCTGG - Intronic
1061283291 9:129609460-129609482 TGCTCAGATGGGTCTGAGTTGGG + Intronic
1185801799 X:3017801-3017823 GACTCAGATGTGCCACAGTAAGG - Intronic
1187347450 X:18479195-18479217 GACTATGATGTTTCTGGGTGTGG + Intronic
1187610222 X:20934817-20934839 GATCCAGATGTGTCTGATGGTGG + Intergenic
1187687856 X:21833554-21833576 GACTTCGATGTGTCTAGGTGTGG - Intergenic
1192902385 X:75513797-75513819 GACTATAATGTGTCTGATTGTGG - Intronic
1194774889 X:97950195-97950217 GACTATGATGTGTCTAAATGTGG - Intergenic
1196305207 X:114094660-114094682 GACTATGATGTGTCTATGTGTGG + Intergenic
1196492712 X:116287381-116287403 GACTATGATGTGCCTGAGTGTGG + Intergenic
1196596033 X:117546545-117546567 GCCTCAAATGTATCTGAGTATGG - Intergenic
1196805101 X:119576334-119576356 CACTCAGTTGTGTGTGTGTGTGG + Intronic
1198220536 X:134596962-134596984 GACTATGATATGTCTTAGTGTGG + Intronic
1199287205 X:146066845-146066867 GAGTCAGCTGTGACTCAGTGGGG + Intergenic
1199925339 X:152457142-152457164 GACTATGATATGCCTGAGTGTGG - Intergenic
1200207522 X:154328102-154328124 CACACAGATGTGTATGAGTATGG - Intronic
1201306411 Y:12554510-12554532 GTGTCAGATGTGTCAGATTGGGG + Intergenic
1202045905 Y:20737316-20737338 GAAGCATATGTGTCAGAGTGAGG - Intergenic