ID: 901189071

View in Genome Browser
Species Human (GRCh38)
Location 1:7393843-7393865
Sequence CTGGAGAGGGAGGATGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1373
Summary {0: 1, 1: 0, 2: 10, 3: 156, 4: 1206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901189071 Original CRISPR CTGGAGAGGGAGGATGAAGA GGG (reversed) Intronic
900031185 1:374078-374100 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900031200 1:374127-374149 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900040533 1:458944-458966 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
900051754 1:602327-602349 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900061963 1:693915-693937 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
900145204 1:1156261-1156283 ATGGAGGGGGTGGATGGAGATGG - Intergenic
900159159 1:1215350-1215372 CTGGAGAGGGAGGGAGTGGAGGG + Intergenic
900361383 1:2290664-2290686 CAGGAGGAGGAGGAGGAAGAGGG + Intronic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
900932846 1:5747670-5747692 GAGGAGAGGGAGGAAGGAGAGGG + Intergenic
901189071 1:7393843-7393865 CTGGAGAGGGAGGATGAAGAGGG - Intronic
901297482 1:8171433-8171455 CTGGACATGGAAGGTGAAGAGGG + Intergenic
901740387 1:11338186-11338208 GGGGAGAGGGAGGAGGAGGAGGG - Intergenic
901779626 1:11585104-11585126 GTGGAGAGGGAGCATGGAGAAGG + Intergenic
902292164 1:15442487-15442509 CTGGAGGTGGAAGACGAAGAAGG + Exonic
902301773 1:15507134-15507156 CTGGAGAGGCGGGAAGAAAACGG + Intronic
902383765 1:16065021-16065043 CTGGGGAGAGAGGGTGGAGAAGG - Intronic
902448983 1:16484854-16484876 CTGGAGACAGAGGACGGAGAGGG - Intergenic
902468367 1:16631561-16631583 CTGGAGACAGAGGATGGAGAGGG - Intergenic
902505774 1:16938430-16938452 CTGGAGACAGAGGATGGAGAGGG + Exonic
902576710 1:17382570-17382592 CAGGAGAGGAGGGCTGAAGATGG - Intronic
902653850 1:17854113-17854135 CAGGGAGGGGAGGATGAAGAGGG - Intergenic
902737627 1:18411603-18411625 GTGGTGAGTGAGGAGGAAGAGGG + Intergenic
903011056 1:20330725-20330747 AGGGAGAGGGAGAAGGAAGAGGG - Intronic
903225130 1:21890357-21890379 CTGGAGGGGGCTGATGAGGATGG - Intronic
903240714 1:21980962-21980984 CTGGGGAGGGTGGGTGATGATGG + Intronic
903384886 1:22919701-22919723 CAGGAGAGGGAGGAGGGAGGAGG + Intergenic
903520526 1:23944255-23944277 CTGGAGATGGATGGTGATGATGG - Intergenic
903743944 1:25574199-25574221 CTGGAGAGGAGGGAGGAAGGAGG + Intergenic
904173628 1:28609809-28609831 CTGGAGATGGATGATGCTGATGG - Intronic
904428669 1:30447860-30447882 CTGGACAGGGGCCATGAAGAGGG + Intergenic
904517193 1:31065618-31065640 GCGGAGCGGTAGGATGAAGATGG + Exonic
904565804 1:31427685-31427707 CTGCAAAGTGAGGATGAGGATGG - Intronic
904869000 1:33604834-33604856 AGGGAGGGGGAAGATGAAGAGGG + Intronic
904880011 1:33689212-33689234 CTGGGGTGGGAGAATGAGGAAGG + Intronic
905108671 1:35578666-35578688 CTGGAGAAGGAGGAGGGAGCTGG + Intronic
905390313 1:37632200-37632222 GAGGAGAGGGAGGAAAAAGAAGG - Intronic
905845559 1:41228325-41228347 CTGGAGATGGATGGTGATGAGGG + Intronic
905912925 1:41666042-41666064 ATGGGGATGGAGGATGGAGAGGG - Intronic
906118739 1:43373267-43373289 CTTGAGAAAGAGGATGGAGACGG - Intergenic
906194560 1:43921697-43921719 GTGGAGGGGGATGATGGAGAAGG - Intronic
906234906 1:44200369-44200391 CTGGAGATGAAGGAGAAAGAAGG - Intergenic
906564728 1:46790812-46790834 CTGGACAGGGAGGTGGCAGAAGG - Intronic
906634207 1:47397400-47397422 CCGGTGAGGGAGGCTGTAGAAGG - Intergenic
906724963 1:48037409-48037431 CAGGAGAGGGAGAATGAAAGGGG + Intergenic
906804154 1:48763863-48763885 CAGGAGGGGCAGGATGAACAGGG + Intronic
907084253 1:51654980-51655002 CTGGAGATGGATGGTGATGATGG + Intronic
907179938 1:52560642-52560664 CTGGAGATGGATGATGGTGATGG + Intergenic
907303565 1:53502302-53502324 GAGGAGAGGGAGGAAGGAGAGGG + Intergenic
907401138 1:54225675-54225697 CAGGGGAGGGAGGAAGGAGAAGG + Intronic
907539333 1:55198345-55198367 ATGGAAATGGAGGATGAAGTCGG + Intronic
908007441 1:59741374-59741396 CTGGAGCGGGAGGAAGTGGAGGG - Intronic
908086184 1:60636630-60636652 CTGGAGAGAGGGAAGGAAGAAGG + Intergenic
908222986 1:62027049-62027071 CTGGAGATGGATGGTGATGATGG - Intronic
908801930 1:67889265-67889287 CTGGAGAGTGAGGAGGAACCTGG + Intergenic
908820672 1:68083074-68083096 CAGGAGAGGGAGAATGAAAAAGG + Intergenic
909267867 1:73584799-73584821 GTGAAGAGGGAGAATAAAGATGG + Intergenic
909486656 1:76181111-76181133 CAGGAGTGGGAGCATGCAGACGG - Intronic
909601700 1:77467887-77467909 CGGGTGAGGGATGATGAGGAAGG - Intronic
909622418 1:77683201-77683223 CGGGGGAGGGAGAATGAAGGGGG - Intronic
910698931 1:90051169-90051191 ATGCAGAGGAGGGATGAAGAAGG - Intergenic
910719091 1:90265873-90265895 GTGTAGGAGGAGGATGAAGATGG + Intergenic
910856285 1:91699111-91699133 CTGGAGAGAGAGGATAGAGAAGG - Intronic
911063060 1:93764335-93764357 ATGGAGAAAGAGGATGAAGGAGG - Intronic
911090288 1:94012157-94012179 CTGGAGAGGGAGGAGGTTGTGGG - Intronic
911192020 1:94957758-94957780 CTGGACATAGAGGATGCAGAGGG + Intergenic
911778679 1:101847154-101847176 CTGGTAAGGGAGGAAAAAGAAGG - Intronic
912040353 1:105382852-105382874 ATGGAGAGGGAGAAAGAAAAAGG - Intergenic
912168540 1:107069437-107069459 GAGGAGTGGGAGGATGAGGAGGG + Intergenic
912385644 1:109270006-109270028 CAAGAGAGTGAGGAAGAAGAAGG - Exonic
912572286 1:110633395-110633417 CTGGTGAGGGAGCAGGAAGGGGG + Intergenic
912797200 1:112700442-112700464 CAGGAGCGGGAGGGTGAAGGGGG + Exonic
912927096 1:113922826-113922848 CTTGAGAGGGAGGCTGAGGTTGG - Intergenic
913063654 1:115230246-115230268 CTGGAGGGGGAAGATGAGGGAGG + Intergenic
913533515 1:119749785-119749807 ATGGAGAGGGAAGAAGAAAAAGG - Intronic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915269888 1:154746517-154746539 GAGGAGAAGGAGGAAGAAGATGG - Intronic
915606776 1:156957031-156957053 CTGGGGTGGGAGGATGGTGAAGG - Intronic
915715304 1:157939688-157939710 CTGGAAAGGGAGGATGACCCTGG - Intergenic
915839188 1:159201640-159201662 TTGGAGAGGAAGGATGGAGGTGG + Exonic
915940568 1:160115922-160115944 CTGCTGAGGAAGGATGAAGTGGG + Intronic
916075359 1:161197361-161197383 CTAGAGAGGGAGGAGGGAGGAGG + Intronic
916332076 1:163628341-163628363 ATGGAGGGGGAGGAGGAGGAGGG - Intergenic
916336151 1:163673164-163673186 CTGGGGAGTGAGGAGGAAAAGGG - Intergenic
916780510 1:168022636-168022658 CTGGAGAGGGAGTTTGAGAAGGG + Intronic
917707165 1:177646284-177646306 CTGGAGAGGGAGGTCATAGAGGG + Intergenic
917767490 1:178237804-178237826 CTGGAGATGGATGATGGTGATGG - Intronic
918075644 1:181169332-181169354 ATGGAAGGGGAGCATGAAGATGG - Intergenic
918177389 1:182057892-182057914 TTAGAGAGTGACGATGAAGATGG - Exonic
918323866 1:183391195-183391217 TTGCAGAGTGAGGATGAGGATGG - Intronic
919429529 1:197475366-197475388 GAAGAGAGGAAGGATGAAGATGG - Intronic
919486117 1:198149339-198149361 GTGGAGAGGGAGGAGTAGGAAGG + Intergenic
919656365 1:200201009-200201031 GAGGAGAGGGAGCATGCAGATGG - Intergenic
919697277 1:200590696-200590718 CTGGAGATGGATGATGGTGATGG + Intronic
919739943 1:200975336-200975358 ATGGAGACAGAGGAGGAAGAGGG + Intronic
920008816 1:202853034-202853056 CTGGAGAAGGATTATGAAGTAGG - Intergenic
920038465 1:203080806-203080828 CTGGAGAGGGAGGCGGCAGAGGG - Intergenic
920045044 1:203127643-203127665 GAGGAGACGGAGGATGAGGAGGG + Exonic
920251692 1:204626248-204626270 TGGGAGAGGGCAGATGAAGAGGG - Intronic
920291027 1:204923325-204923347 CTGGAGTGGGAGGAGGAGGGAGG - Intronic
920416482 1:205802129-205802151 TTGGAGAGGGAGGAGGAGGCAGG + Intronic
920962296 1:210674265-210674287 CTGCAGAGGGAGGACAGAGATGG - Intronic
920971059 1:210744111-210744133 CTGTAGAGGGAGGATAAGCAAGG + Intronic
921035638 1:211375883-211375905 CTGGATAGGGAAGATGAGGGAGG - Intergenic
921079223 1:211725407-211725429 GTGGAGAGAGAGGAGGAGGAGGG - Intergenic
921111879 1:212046436-212046458 CTTGAGGGGGAGCATGGAGAGGG - Intronic
921273084 1:213490125-213490147 CTGGGCAGTGAGGATGGAGAAGG + Intergenic
921280048 1:213557462-213557484 CTGGAGAGGGAAGAAGAGGCAGG + Intergenic
921520987 1:216153371-216153393 CAGGAGAGGGAGCATGCAGATGG - Intronic
921924069 1:220697406-220697428 CTGGCGAGGAAGGAGGAAGAAGG + Exonic
922036986 1:221858471-221858493 AAAGAGAGGGAGGAAGAAGAAGG + Intergenic
922225200 1:223640066-223640088 TTGGAAAGTGAGGATGAAAAGGG - Intronic
922317304 1:224453875-224453897 GAGGGGAGGGAGGATAAAGAAGG - Intronic
922420019 1:225453168-225453190 CTGGAGAGGGATGGTGGTGATGG + Intergenic
922543294 1:226435147-226435169 CTGAAGCGGGAGGCTGAAGCAGG - Intergenic
922718118 1:227887376-227887398 TTGGAGAGGGAGGAGTAAGGGGG - Intergenic
922805148 1:228382457-228382479 CTGGAGATGGACGATGATAATGG - Intergenic
922925021 1:229341497-229341519 CAGGCGAGGGAGGATGGGGAGGG + Intronic
923006672 1:230055439-230055461 CTGGAGTGCACGGATGAAGAAGG - Intergenic
923414764 1:233745836-233745858 CTGTTGGGGGAGGATGGAGAAGG + Intergenic
923478135 1:234356707-234356729 CTTGAGAGGGATGAAGCAGAAGG + Intergenic
923676654 1:236086343-236086365 CTTAAGAGGGAGGAGCAAGATGG - Intergenic
923694693 1:236236251-236236273 CTGGAGGGGGTGGGGGAAGAAGG - Intronic
924210373 1:241759803-241759825 CTGGAGATGGATGGTGATGAAGG - Intronic
924260974 1:242231217-242231239 AGGAAGAGGGAGGAGGAAGAGGG - Intronic
924260978 1:242231230-242231252 CTCAACAGGGAGGAGGAAGAGGG - Intronic
924740016 1:246789607-246789629 CTGGAGAGGGCGGCTGCGGAGGG - Intergenic
1063377189 10:5561410-5561432 CTGCAGAGAGGGGAGGAAGAGGG + Intergenic
1063873992 10:10452512-10452534 GTGGGGAAGGAGGTTGAAGAGGG - Intergenic
1064001894 10:11670630-11670652 CTGGAGAACTAGGATGAAGTGGG - Intergenic
1064067652 10:12196233-12196255 CGGCAGCTGGAGGATGAAGAAGG + Exonic
1064273117 10:13882663-13882685 CTGGGCAGTGAGGATGAAGAGGG - Intronic
1064350969 10:14576148-14576170 CTGGAGATGGATGGTGGAGATGG + Intronic
1064631325 10:17315743-17315765 ATGGACAGGGAGGAAGAAGAGGG + Intergenic
1064831534 10:19473403-19473425 CTGGAGATGGATGATGGTGATGG - Intronic
1064934914 10:20668881-20668903 CAGGAGAGGGAGTGTGAAGCGGG - Intergenic
1065011683 10:21426908-21426930 CGGGAGAAGGAGCATGCAGATGG + Intergenic
1065035277 10:21631657-21631679 CAGGAGAGAGAAAATGAAGAGGG + Intronic
1065145222 10:22761897-22761919 CTGGAGTTAGGGGATGAAGAGGG + Intergenic
1065304314 10:24354331-24354353 CAGGAGGGGGAGCATGCAGATGG + Intronic
1065728768 10:28691710-28691732 GTGGAGAGGGGGGATGGAGGGGG - Intergenic
1065765652 10:29026997-29027019 GAGGAGAAGGAGGATGAAGAAGG + Intergenic
1065827041 10:29582121-29582143 CTGGAGAGGGATGGTGGTGATGG + Intronic
1065883579 10:30058681-30058703 CTGGAGACGGGGGAAGTAGAGGG + Intronic
1065950809 10:30649061-30649083 CTGGAGAGGGATGGTGGTGATGG - Intergenic
1066471636 10:35703491-35703513 CTGGAAAGTGAGCATGAAGATGG - Intergenic
1067065413 10:43101563-43101585 CTGGAGGCTCAGGATGAAGAGGG - Intronic
1067183662 10:44009031-44009053 CAACAGAGGGAGGATAAAGAAGG + Intergenic
1067555202 10:47264806-47264828 CTGAAGAGGAAGGACGAAGCCGG + Intergenic
1067687221 10:48473377-48473399 CTGGAGAGGGATGGTGGTGATGG + Intronic
1067935307 10:50606377-50606399 CTGGAGATGGATGGTGGAGATGG + Intronic
1067984292 10:51124377-51124399 GTGGAGTGGGAGGATGGAGAGGG + Intronic
1068123873 10:52813931-52813953 TTGGAGAGGGAGGAGGAGTAAGG - Intergenic
1068425793 10:56862074-56862096 GTGGAGGTGGAGGATGTAGAGGG - Intergenic
1068574705 10:58672167-58672189 CTGGAGATGGATGGTGATGATGG - Intronic
1068753485 10:60623681-60623703 CTGGAGAGGGAAGTAGATGAAGG + Intronic
1068955175 10:62814982-62815004 CGGGAGAGGGAGGGAGAAAAAGG - Intronic
1068958138 10:62839653-62839675 CTGGAGATGGATGGTGATGATGG - Intronic
1070128354 10:73639792-73639814 TGGGAGAGGGAAGATTAAGAAGG - Intronic
1070166335 10:73900956-73900978 CTGGAGATGGAGGCTGAGGCAGG + Intergenic
1070248322 10:74752298-74752320 CTGGAGACGGAGGTTGCAGTGGG - Intergenic
1070541273 10:77417110-77417132 TTGATCAGGGAGGATGAAGATGG - Intronic
1071011340 10:80944278-80944300 CGGGAGTGGGAGCATGCAGACGG + Intergenic
1071065154 10:81623717-81623739 CTGGAGAGGGCAGATAAAGATGG - Intergenic
1071068531 10:81665847-81665869 CTGGAGAGAGAAAATGAAGAAGG + Intergenic
1071278149 10:84075437-84075459 CAGGAGAGGGAGGGAGAACAAGG + Intergenic
1071731897 10:88256500-88256522 CTGAAGAAGGCGGATGGAGACGG - Intergenic
1072004651 10:91232784-91232806 GTGGAGAGTGAGGATGGAGGAGG + Intronic
1072905233 10:99446898-99446920 CTAGACAAGGAGGATCAAGAGGG + Intergenic
1073115196 10:101087877-101087899 GTGGAGAGGAAGGAGGGAGAGGG - Intergenic
1073156419 10:101350725-101350747 CTGGTGAGTGAGGATCATGAAGG - Intergenic
1073340915 10:102743990-102744012 GAGGAGAGGGAGGAGGAGGAGGG + Exonic
1073412727 10:103355499-103355521 CTGGAGATGGAGGGTGGTGATGG + Intergenic
1073427738 10:103466117-103466139 CAGGGAAGGGAGGTTGAAGAAGG - Intergenic
1073440196 10:103547976-103547998 CTGGATGGGGAGGGTGAGGAAGG - Intronic
1073482032 10:103791992-103792014 CAGGAGAGGCAGGAGGAAGCTGG + Intronic
1073592196 10:104767811-104767833 GAGGAGAGGGGGGAAGAAGAGGG - Intronic
1074053647 10:109902645-109902667 GTGGAGAGGGGTGATGAAGATGG + Intronic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1074202938 10:111256058-111256080 CTCTAGAAGGAGGAGGAAGAGGG + Intergenic
1074732160 10:116390739-116390761 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1075355979 10:121776300-121776322 GTGGGGAGGGAAGATGAAGAGGG - Intronic
1075400153 10:122155213-122155235 CTGGAGAGGCAGGTTGAGAAGGG - Intronic
1075513763 10:123093482-123093504 GGGGACAGGGAGGAGGAAGAAGG - Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1075811838 10:125229970-125229992 CTGGAGATGGATGATGGTGATGG - Intergenic
1075952272 10:126490536-126490558 CTGGAGATGGATGGTGATGATGG + Intronic
1075968098 10:126630297-126630319 CTGCAGATGCTGGATGAAGAGGG + Intronic
1075969877 10:126643327-126643349 CTGCATGGGGATGATGAAGAGGG + Intronic
1076292138 10:129353730-129353752 CTAAAGAGGGAGGATAAAGCGGG + Intergenic
1076318960 10:129564437-129564459 GGGGAGAGAGAGGAAGAAGAAGG - Intronic
1076467772 10:130696906-130696928 CTGGGGAGGGAGAATGAAATGGG + Intergenic
1076492325 10:130870468-130870490 CTGGAGAGGAAAGAAGAAAAAGG - Intergenic
1076495178 10:130892605-130892627 GAGGAGAGGGAGGAAGAGGAGGG - Intergenic
1076501482 10:130939744-130939766 CTGGAGATGGAGGGTGAGGCTGG + Intergenic
1076735831 10:132458541-132458563 CTGGAGACGGAAGCTGGAGACGG + Intergenic
1076966806 11:95167-95189 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
1076990679 11:271890-271912 CTGGAGAGGGACGATGGTGATGG - Intergenic
1077351530 11:2095306-2095328 CTGGAGAGGGAGGTTGAGGTGGG - Intergenic
1077493358 11:2872437-2872459 CTCGAGAGGGAGGCTGAGGCAGG - Intergenic
1078113875 11:8425879-8425901 CTCTAGAGGGAGGATGCAGATGG + Intronic
1078547231 11:12255278-12255300 CTGGAGTGGGAGGATGGTGAGGG - Intronic
1078551743 11:12285948-12285970 CTGGAGAGAAAGGATGGGGACGG - Intronic
1078720404 11:13878814-13878836 GATGAGAGGGAGGAAGAAGATGG + Intergenic
1078729090 11:13959701-13959723 GAGGAGAGGGAGGAGGAAGAAGG + Intergenic
1079119584 11:17672339-17672361 CTGGGGAGGGGGCATAAAGAAGG + Intergenic
1079202900 11:18390638-18390660 GTGGGGATGAAGGATGAAGAGGG - Intergenic
1079386667 11:19986181-19986203 CTGGAGATGGAGGATGAGGGTGG + Intronic
1079441588 11:20520271-20520293 CTGGGGAGGGAGGATGCGGTGGG + Intergenic
1079449560 11:20588044-20588066 AAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1079531753 11:21462669-21462691 CTGGAGCTGCAGGATGAACAAGG - Intronic
1080643361 11:34171155-34171177 GTGTAGAGTGAGGATGAGGATGG + Intronic
1080746657 11:35114401-35114423 TTTGAGAGGGTGGAAGAAGAGGG - Intergenic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1080886049 11:36369293-36369315 CTGCTGGGGGAGGATGAAGCTGG + Intronic
1081594744 11:44451290-44451312 CAGGAGATGGAGGATGCAGTGGG + Intergenic
1081729020 11:45355532-45355554 CTGGAGCGTAAGGAAGAAGAAGG - Intergenic
1082099708 11:48162386-48162408 AGGGAGAGGGAGGAGGGAGAGGG - Intronic
1082109913 11:48263161-48263183 CTGCAGGGGGAGGAAGAATATGG - Intergenic
1082655838 11:55856277-55856299 CTGTGGAGGGAAGAAGAAGAGGG + Intergenic
1083105522 11:60354642-60354664 ATGGAAATGGAGGATGAAAAGGG + Intronic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083188519 11:61032778-61032800 CTGGAGATGGAGGGTGGTGATGG + Intergenic
1083210668 11:61183311-61183333 CTAGAAAGGGAGGGTGTAGAGGG - Intergenic
1083616348 11:64028420-64028442 CTGCAGAGGGAGGAGGGAGAGGG + Intronic
1083675945 11:64324684-64324706 CTGGGGAGGGAGGCTGAGGCAGG + Intergenic
1083857700 11:65401311-65401333 CTGGGGAGGGAGGCTGGGGAGGG - Intronic
1084100904 11:66948389-66948411 CTGAAGAGTGAGGAGGCAGAGGG + Intronic
1084672370 11:70614900-70614922 CTGGAGAGGGAAGAGGAAGTGGG + Intronic
1084726524 11:70945933-70945955 GTGGAGAGGGAGGTTGAACTGGG - Intronic
1084726637 11:70946403-70946425 GTGGAGAGGGAGGGTGAACCTGG - Intronic
1084726753 11:70946841-70946863 GTGGAGAGGGAGGATGAGCCTGG - Intronic
1084841929 11:71859830-71859852 CTGGGGAGGGAGGAGGAAATAGG + Intergenic
1084937020 11:72592317-72592339 CTGGGGAGGGAGGAGGAAGGAGG - Intronic
1084971713 11:72775728-72775750 CTGGAGGTGGGGGATGGAGAGGG - Intronic
1085041494 11:73328927-73328949 CTAGAGAGGCAGGATGGAGAAGG + Intronic
1085186229 11:74578365-74578387 CTGAAGAGGAAGGTGGAAGAAGG + Intronic
1085250965 11:75143662-75143684 CTGGAGATGGATGGTGAGGATGG + Intronic
1085663593 11:78392690-78392712 ATGGAGAGGGATGAAGAACAAGG - Intronic
1085684580 11:78610119-78610141 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1085703397 11:78764797-78764819 CTGGAGAAGAAGGAAGTAGAAGG + Intronic
1085768145 11:79301799-79301821 CTGGAGCAGGAGGAAGAAGAGGG - Intronic
1086515913 11:87613138-87613160 CTGGAGAGAGAGGACGAAGGAGG - Intergenic
1086566590 11:88233829-88233851 ATGGATAGGGAGGAGGAAAACGG - Intergenic
1086985523 11:93244819-93244841 GTGGAGAGGGAGGCTGAGGAGGG - Intergenic
1087327279 11:96739032-96739054 CTGAAGAGGGAGGCTGAAGAGGG - Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087581090 11:100054629-100054651 CATGACAGTGAGGATGAAGATGG - Intronic
1087919776 11:103853300-103853322 CAGGAAAGGGAAGATGAATATGG + Intergenic
1088051435 11:105519912-105519934 ATGGAAAGTGAGGAGGAAGAGGG + Intergenic
1088196248 11:107277108-107277130 GTGGAGAGGGAGGATGGAAAAGG - Intergenic
1088298134 11:108323405-108323427 GTGGAGGGAGAGGATGAAGAGGG + Intronic
1088300185 11:108349948-108349970 CTGGAGAGGAAGGAGTATGAGGG + Intronic
1088359580 11:108976670-108976692 GGGGTGAGGTAGGATGAAGAAGG + Intergenic
1088448326 11:109955447-109955469 CAGGAGGGGGAGCATGCAGATGG - Intergenic
1088848560 11:113687706-113687728 GTGGAGAGGGAGAGTGGAGAGGG + Exonic
1088907267 11:114164258-114164280 CGAGAGAGGGAGAAGGAAGAAGG - Intronic
1089025273 11:115262882-115262904 TAGGAGAAGGTGGATGAAGAAGG - Intronic
1089048108 11:115521322-115521344 CTGGAGGAGGAGCCTGAAGATGG - Intergenic
1089278322 11:117354959-117354981 CTGCAGAGAAAGGATGAAGGAGG - Intronic
1089467935 11:118697565-118697587 CTGGAGAGGGTGGGTCAGGAAGG + Intergenic
1089587279 11:119518280-119518302 CCAGAGAGGGAAGAGGAAGAGGG + Intergenic
1089746912 11:120623970-120623992 AGGGAGAGGGAGGAGGAAGAGGG - Intronic
1089833922 11:121353324-121353346 CTGGAGTGGGTAGATGCAGATGG - Intergenic
1090023961 11:123151948-123151970 CTGGAGAGGGAAGAGGAAGGAGG - Intronic
1090231449 11:125109374-125109396 CTGCAGAGGGAGGAAGGAAAGGG + Intronic
1090610712 11:128467950-128467972 CCTGAGAGGGAGGGTGGAGAGGG - Intronic
1090669145 11:128934008-128934030 AAGGAGAGGGAGGAGGAAGGAGG - Intergenic
1090738841 11:129638027-129638049 GAGGAGATGGAGGTTGAAGAGGG - Intergenic
1091343541 11:134837964-134837986 CTGAAGAGGGAGGACAGAGAGGG - Intergenic
1091459164 12:630864-630886 ATGGCGCGGGAGGAGGAAGAAGG + Intronic
1091603082 12:1929782-1929804 TAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1091686892 12:2568800-2568822 CTGGAGATGGAGGATGGTGGTGG + Intronic
1091842053 12:3628332-3628354 GTGGAGGAGGAGGAAGAAGAAGG + Intronic
1091848615 12:3677577-3677599 CTGGAGAAGGGGGAAGGAGAAGG - Intronic
1091933635 12:4417244-4417266 CTGGAGAGGGATGGTGGTGACGG + Intergenic
1092078553 12:5693672-5693694 CTGGAGAAGAAGGAAGGAGAGGG - Intronic
1092138048 12:6163373-6163395 CTGAAGCGGGAGGATCACGAGGG - Intergenic
1092263255 12:6963390-6963412 CTGCAGAGGGGGGATGAGGGTGG + Intergenic
1093213732 12:16338018-16338040 GTGGAAATGGAGGGTGAAGAAGG + Intergenic
1093235370 12:16603958-16603980 TGGGAGAGGGAAGAGGAAGAGGG + Intronic
1093689163 12:22090139-22090161 CAGGAGAGAGAGAGTGAAGAGGG - Intronic
1093703826 12:22253287-22253309 CTGGAGAGGGTGCCTGAAGGTGG + Intronic
1094129903 12:27063588-27063610 CAGGAGGAGGAGGAGGAAGAAGG - Intronic
1095596138 12:43960286-43960308 CTGGAGAGGGGGGTTGAGTAAGG + Intronic
1096025300 12:48355742-48355764 TTAGAGAGGAAGGATGAAAATGG + Intergenic
1096046036 12:48563246-48563268 AGGGAGAGGCAGGAAGAAGAGGG - Intergenic
1096254238 12:50053174-50053196 GTGAAGAGGGAGGGTAAAGAGGG - Intergenic
1096330449 12:50707809-50707831 CATGGGAGGGAGGATGAAGTTGG - Intronic
1096380412 12:51152884-51152906 CTGGAGATGGATGATGGTGATGG - Intronic
1096556830 12:52409017-52409039 AGGGAGAGGGAGGAGGGAGAGGG - Intergenic
1096573699 12:52539848-52539870 CTGGAGAGGGAGAGAGGAGATGG - Intergenic
1096626819 12:52900881-52900903 CTAGAGAAGGAGGTGGAAGAGGG - Intronic
1096650472 12:53059766-53059788 CTGGAGAGGGAGGCTGGAGAAGG + Exonic
1096656555 12:53096224-53096246 CTGGAGAGGCAGGGAGGAGAGGG - Intergenic
1096791989 12:54051257-54051279 GTGGAGAGGGTTGATGAAGAGGG - Intronic
1097174778 12:57136229-57136251 CAGGGGAGGGAGGCTGAAGGGGG + Intronic
1097409630 12:59235457-59235479 ATGGAGAGGTAGGGTGAAGAGGG - Intergenic
1097809833 12:64006458-64006480 CTGGAGAGGCAGGCTGTGGAGGG + Intronic
1099561019 12:84174072-84174094 CTGGAGGGGGTGGAGGCAGAAGG + Intergenic
1099635996 12:85212209-85212231 CAGGAGATGGAGGCTGCAGATGG + Intronic
1099948453 12:89272510-89272532 CAGGAGAGAGAGGATCAGGAAGG - Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100376579 12:94021696-94021718 CTGGAGATGGATGATGATGATGG + Intergenic
1100779596 12:98009732-98009754 CAGAAGAGGGAGGGTGAAGGTGG - Intergenic
1101954690 12:109202946-109202968 CTGGAGATGGATGATGGTGATGG - Intronic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102246015 12:111356317-111356339 CTGGAGATGGAGGGTGATGATGG - Intergenic
1102394517 12:112575024-112575046 AGGGAGAGGGAGGAAGAGGAGGG + Intronic
1102598736 12:114012862-114012884 AGGGAGAGGGAGGAGGGAGAGGG + Intergenic
1102598742 12:114012881-114012903 AGGGAGAGGGAGGAGGGAGAAGG + Intergenic
1102598775 12:114012998-114013020 GAGGAGAGGGAGGAGGGAGAGGG + Intergenic
1102656581 12:114487067-114487089 CTGGTGAGGGAGGATGATATGGG + Intergenic
1102738750 12:115187195-115187217 CTGAAGTGGGAGGCTGAATAAGG - Intergenic
1103122814 12:118395121-118395143 CTGGAGAGGGAGAATGGAAGAGG + Intronic
1103344138 12:120238083-120238105 CTGGACAGGGAGGAAGCAGATGG + Intronic
1103617199 12:122161833-122161855 CTGGAGGGGGAGGGTGGAGGCGG - Intergenic
1103778872 12:123386287-123386309 CAGGAGAGGGAGGGTGAAGCGGG - Intronic
1103972120 12:124678892-124678914 CAGGGGAGGGAGGAAGAGGAGGG - Intergenic
1104339024 12:127930039-127930061 GTGGAGAGGGAAGCTGGAGAGGG - Intergenic
1104381677 12:128312990-128313012 GAGGAGAGGGAGGATGGAGCAGG - Intronic
1104406639 12:128523325-128523347 CTGGAGATGGATGGTGATGATGG + Intronic
1104549951 12:129747180-129747202 AAGGAGAGGGAGGAGGGAGAAGG - Intronic
1104773781 12:131380939-131380961 GGGGAGAGGGAGGGTGAAGAGGG - Intergenic
1105405940 13:20132831-20132853 CTGGAGATGGATGGTGATGATGG - Intergenic
1105431070 13:20338581-20338603 CTGGAGATGGATGGTGATGATGG + Intergenic
1105698515 13:22915469-22915491 CTGCCAAGGGAGGAGGAAGATGG + Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1105803953 13:23938809-23938831 CTGGAGAGGGAAAAAGAAGGTGG - Intergenic
1105850184 13:24327716-24327738 CTGCCAAGGGAGGAGGAAGATGG + Intergenic
1106010456 13:25816075-25816097 CTGGAGATGGATGATGGTGATGG + Intronic
1106316062 13:28594889-28594911 CTGGAGAGGGATGGTGGTGATGG + Intergenic
1106356621 13:28989648-28989670 CTGGATGGGGAGGATGAGGGTGG + Intronic
1106376759 13:29196542-29196564 CTGGAGATGGATGATGGTGATGG - Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106625894 13:31420731-31420753 TTTGGGAGGGAGGATGATGAGGG - Intergenic
1106692466 13:32133041-32133063 GTGGATAGGGAGGTTGCAGATGG + Intronic
1106945668 13:34824881-34824903 CTGGAGATGGATGGTGGAGATGG - Intergenic
1107160276 13:37217648-37217670 CTGGTGGGGGATGATGATGATGG - Intergenic
1107562512 13:41571300-41571322 AGGGAGAGGGAGGAGGGAGAGGG - Intronic
1107722201 13:43260567-43260589 GTGGAGGGGAAGGATGAGGAGGG - Intronic
1107771794 13:43794627-43794649 CTGCAGAGGCAGTATGTAGATGG - Intergenic
1108106425 13:47015409-47015431 CTCGGGAGGGAAGAGGAAGAAGG + Intergenic
1108132513 13:47318025-47318047 TGGGAGGGGGAGGAGGAAGAAGG - Intergenic
1108694010 13:52886793-52886815 CTGGACAGGGATGGTGATGAAGG + Intergenic
1109204598 13:59467260-59467282 CAGGAGGGGGAGCATGTAGATGG - Intergenic
1109378485 13:61526403-61526425 AGGGAGGGGGAGGATGCAGATGG + Intergenic
1109476882 13:62891014-62891036 CTGGAGTGGAAGGAGGAACATGG + Intergenic
1110237768 13:73234342-73234364 CTGGAAAGGGAGGAGGAGGTGGG - Intergenic
1111090936 13:83446170-83446192 CAGGAGAGAGAAGATGAAGGGGG + Intergenic
1111316950 13:86576173-86576195 CTGGGGAGGTAGGATGAAAGAGG + Intergenic
1112211247 13:97379803-97379825 CTGGAGATGGAGGGTGGTGATGG + Intronic
1112214706 13:97418344-97418366 CAGGAGAGGGATGATGGTGATGG - Intergenic
1112264187 13:97907677-97907699 CTGGAGATGGATGGTGATGATGG + Intergenic
1112265043 13:97915885-97915907 CTGAAGTGGGAGGATGATGGAGG + Intergenic
1112370845 13:98792082-98792104 CTGGAGATGGAGGGTGGCGATGG + Intergenic
1112714306 13:102166013-102166035 CTGGAGATGGACGATGGTGATGG - Intronic
1112796786 13:103065962-103065984 CTGGAGCGGGAGGATGTCAAAGG + Exonic
1112983049 13:105410366-105410388 CTCGGGAGGGAGGCTGAAGCAGG + Intergenic
1113043038 13:106125274-106125296 CTGGAGGGGAAGGAGGAAGAAGG - Intergenic
1113317004 13:109191477-109191499 CTGGAGAGTGGTGAGGAAGAAGG + Intronic
1113387135 13:109859149-109859171 CTGGAGAGGGATGGTGGTGATGG + Intergenic
1113585219 13:111460044-111460066 AGGGAGAGGGGGGAGGAAGAGGG + Intergenic
1113672225 13:112183052-112183074 GTGGAGAAGGAGGCTGACGATGG - Intergenic
1113909880 13:113836736-113836758 GAGGAGGGGGAGGAAGAAGATGG + Intronic
1114317423 14:21521972-21521994 CTGGAGCAGGGGGAGGAAGAAGG + Exonic
1114437970 14:22723826-22723848 CTGTAGAGGGTGGATGATGGGGG - Intergenic
1114560819 14:23589192-23589214 CTGGTGGGAGAGGGTGAAGATGG + Intergenic
1114649761 14:24277057-24277079 ATGGAGAGTGAGGATGGAGAAGG + Intergenic
1114995925 14:28351682-28351704 CTGCAAAGTGATGATGAAGAGGG + Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115170319 14:30497502-30497524 CTGGAGAGGAAGGCAGAAGTTGG - Intergenic
1115514632 14:34173327-34173349 CTGGAAAGGTGGTATGAAGATGG - Intronic
1115772372 14:36678086-36678108 CTGGATATGGATGTTGAAGATGG + Exonic
1115861058 14:37686960-37686982 CTGGAGAAGGTGGAGCAAGATGG + Intronic
1115923952 14:38410274-38410296 CTGGGGAGGGAGGAGGAAATAGG - Intergenic
1116475081 14:45330866-45330888 AAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1117660118 14:57995382-57995404 GGGAAGAGGGTGGATGAAGAAGG + Intergenic
1118261061 14:64246992-64247014 TGGGTGAGGGAGAATGAAGAAGG - Intronic
1118299896 14:64605926-64605948 CAGGAGAGGGAAGATGGGGATGG + Intergenic
1118313105 14:64707138-64707160 CTGAGGAGGGAGGATGGAGTAGG - Intronic
1118482344 14:66179842-66179864 CTGGAGAGTGAGTACAAAGAGGG - Intergenic
1118796634 14:69151587-69151609 CAGGGGAGGGGGGGTGAAGACGG - Intronic
1118838231 14:69491750-69491772 CTGGGGAGGGGGGCAGAAGATGG + Intronic
1119037046 14:71239251-71239273 CTGGAGAGGGATGGTGGTGATGG + Intergenic
1119145900 14:72313752-72313774 CTGGGGAGTAAGGATGGAGAAGG + Intronic
1119444606 14:74652764-74652786 CTGGAGAGGGAGGTGGAGAATGG + Intergenic
1119818334 14:77591320-77591342 GTGGGGAGGGTGGATGAGGAAGG + Intronic
1119888215 14:78162260-78162282 CTGGAGAAGGAGGGTGCAGATGG + Intergenic
1120000857 14:79301877-79301899 CTGAAGAGGGAAGGAGAAGAGGG + Intronic
1120209586 14:81621836-81621858 CAAGAGAGGAAGGAAGAAGAGGG - Intergenic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1120310987 14:82828255-82828277 CTGGATAAGGGGGCTGAAGATGG - Intergenic
1120442600 14:84559218-84559240 CTAGAGAGGGAGAAAGAACAGGG + Intergenic
1120578650 14:86217756-86217778 ATGGAGGAGGAGGAGGAAGAAGG - Intergenic
1121045234 14:90782827-90782849 CTGGAGATGGAGGGTGGTGACGG + Intronic
1121099140 14:91237883-91237905 CTGGAGATGGAGGGTGGTGATGG - Intronic
1121392787 14:93590329-93590351 CTGCAGTGGGAGGAAGAAGCTGG + Intronic
1121666569 14:95676913-95676935 CCGGAGGGGGAGCATGCAGACGG - Intergenic
1121898169 14:97668219-97668241 CTCTATGGGGAGGATGAAGAGGG - Intergenic
1122091136 14:99341322-99341344 CTGGGGAAGGACGAGGAAGAAGG + Intergenic
1122219256 14:100225613-100225635 CTGGAGATGGATGGTGATGATGG + Intergenic
1122244753 14:100394620-100394642 CTTGAGAGGGATGATGAGAAAGG + Intronic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122415735 14:101548693-101548715 CTGGAGAGGGAAGAGGAGGCGGG + Intergenic
1122449921 14:101797480-101797502 ATGGAGAGGGTGGAGAAAGAGGG - Intronic
1122578940 14:102759351-102759373 CTGGAGAGGGAGGTGGGAGTTGG + Intergenic
1122915889 14:104858820-104858842 GTGGAGATGGAGGGTGGAGATGG - Intergenic
1122916065 14:104859530-104859552 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916095 14:104859660-104859682 GTGGAGATGGAGGATGGAGATGG - Intergenic
1122916120 14:104859762-104859784 GTGGAGATGGAGGATGGAGATGG - Intergenic
1122916136 14:104859827-104859849 ATGGAGATGGAGGGTGGAGATGG - Intergenic
1122916140 14:104859840-104859862 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916182 14:104860046-104860068 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916200 14:104860122-104860144 ATGGAGATGGAGGATGGAGATGG - Intergenic
1122916216 14:104860200-104860222 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916261 14:104860406-104860428 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916320 14:104860651-104860673 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916352 14:104860768-104860790 GTGGAGATGGAGGGTGGAGATGG - Intergenic
1123022927 14:105410692-105410714 CTGGTGAGGGAGGTGGAGGATGG + Intronic
1123105076 14:105837471-105837493 GAGGAGGGTGAGGATGAAGAGGG + Intergenic
1123629930 15:22254446-22254468 CTGGAGAGGGAGGCAGCTGAAGG - Intergenic
1124103795 15:26718884-26718906 GGGGAGAGGCAGGCTGAAGAGGG - Intronic
1124231859 15:27952788-27952810 CTGGGGAGGGAGGCTGAGGTAGG - Intronic
1124338324 15:28873722-28873744 CTGGAATGGGAGGAGGAACATGG - Intergenic
1124355647 15:28993020-28993042 CTGGAGGGGCAGGAAGAGGATGG + Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1125003891 15:34796813-34796835 GAGGAGAGGGAGAAGGAAGAGGG + Intergenic
1125635875 15:41188305-41188327 AGGGAGAGGGAGGAAAAAGAGGG - Intronic
1125731320 15:41894158-41894180 CGGGGAAGGGAGGATGATGAAGG - Intergenic
1126195426 15:45925522-45925544 CTGGGGAGGGAGGATGATGTAGG - Intergenic
1126234959 15:46373028-46373050 CAGTAGAGGGAAGAGGAAGAGGG + Intergenic
1126682374 15:51214763-51214785 CTGGAGAGGGGAGATGAGGCTGG + Intronic
1126803946 15:52326616-52326638 CTGGAGATGGATGATGGTGATGG + Intronic
1126896174 15:53259064-53259086 CTGAAGAGGCAGGAAGAAGAAGG + Intergenic
1127833298 15:62769659-62769681 CAGGAGAGGGTGGAGGATGATGG - Intronic
1127967230 15:63931489-63931511 CTGGAAAGTGATGAAGAAGAAGG + Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128192405 15:65714931-65714953 CTGGAGAGAGAGGAGGTAGTAGG - Intronic
1128241080 15:66101366-66101388 CTGGAGATGCAGGTTGTAGATGG - Intronic
1128519573 15:68366559-68366581 GGGGAGAGGGAGGAAGGAGAGGG - Intronic
1128542125 15:68543528-68543550 CTGGGGTGGGAGGAGGAAGGAGG - Intergenic
1128545052 15:68561135-68561157 CAGGAAAGGGAGCTTGAAGAGGG + Intergenic
1128604853 15:69029073-69029095 CTGGAGATGGAGGGTGGTGATGG - Intronic
1129002624 15:72346927-72346949 GTGGACAGGGAGGCTGCAGAGGG - Intronic
1129108329 15:73323517-73323539 ATGTGGAAGGAGGATGAAGACGG + Exonic
1129169637 15:73799736-73799758 CTGGGAAGGGAGGTTGAAGCAGG - Intergenic
1129200147 15:73993843-73993865 CTGGAGAGCGGGTATGAAGAGGG - Intronic
1129898023 15:79122905-79122927 CTGGGGAGGGAAGTTGCAGAGGG + Intergenic
1129926032 15:79365051-79365073 GGGGAGAGGGAGCATGCAGAGGG - Intronic
1130114786 15:80997273-80997295 CTGGAGATAGAGGATGGTGATGG + Intergenic
1130552076 15:84895636-84895658 CAGGAGAGGGAGGTTGTGGAGGG + Intronic
1130739199 15:86579856-86579878 GTGGTGAGGGAGGAAGAAGTGGG + Intronic
1130894947 15:88162776-88162798 CTGGAGAAAGAGGAGGAAGCTGG - Intronic
1131343044 15:91620885-91620907 CTGGAGAGTGATGATAAAGATGG + Intergenic
1131525814 15:93151643-93151665 CTGGAAGGGGAGGAGGAAGGAGG - Intergenic
1132028069 15:98419644-98419666 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
1132080298 15:98858501-98858523 GGGGAGAGGGAGGATTAAGTTGG - Intronic
1132333354 15:101027497-101027519 CTGGTGAGGGAGGGTCAGGATGG + Intronic
1132441373 15:101868679-101868701 CTAGAGAAGGAGGATGCAGCAGG + Intergenic
1132783041 16:1638945-1638967 CTGGAGAGGCAGGCTGGAGGAGG - Intronic
1132952351 16:2570311-2570333 CTGGAGAGGGTGGATGCCGTGGG + Intronic
1132962000 16:2629859-2629881 CTGGAGAGGGTGGATGCCGTGGG - Intergenic
1133210856 16:4262738-4262760 CTGGAGATGAATGATGAAGAGGG - Intronic
1133392753 16:5422766-5422788 ATGGAGAGGGAGAAGGGAGAGGG + Intergenic
1133392848 16:5423076-5423098 AAGGAGAGGGAGGAAGAGGAAGG + Intergenic
1133395281 16:5442213-5442235 TTTGAGGGGGAGGATGTAGAAGG + Intergenic
1133526132 16:6607555-6607577 ACGGAGAGAGAGGAGGAAGAGGG - Intronic
1133530738 16:6652816-6652838 CTGGAGATGGAGGGTGGTGATGG + Intronic
1133765174 16:8832806-8832828 CTGAAGAGGGAGGATGGGCAGGG - Intronic
1133842795 16:9425189-9425211 GGGGAGAGAGAGGAGGAAGAGGG + Intergenic
1133928619 16:10213921-10213943 CAGGAGAGGCAGGATCAAGTCGG - Intergenic
1133966868 16:10537989-10538011 CTGGAGCACGAAGATGAAGAAGG + Exonic
1134009112 16:10838231-10838253 CTGGAGAGGGATGTTGAGAATGG + Intergenic
1134102345 16:11461092-11461114 CTGGAGAGGAAGGAGGAGAATGG - Exonic
1134111015 16:11515700-11515722 CTGAGGAGGGAGGAGGAAGGAGG + Intronic
1134122780 16:11596649-11596671 GGGGAGAGGGAGGATGTGGAGGG + Intronic
1134355017 16:13474187-13474209 CTGTAGAGGAAAGAAGAAGAGGG - Intergenic
1134811210 16:17168434-17168456 CTAGAGAGGGAAGAGGAGGAGGG + Intronic
1135050685 16:19190495-19190517 CTGGAGAGGGATGGTGGTGATGG - Intronic
1135066575 16:19315004-19315026 GTGGAGGGGGAGGAGGAGGAGGG + Intronic
1135117877 16:19738993-19739015 CTGCAGAGGGAGCATGGGGAGGG - Intronic
1135223958 16:20639406-20639428 CTGCAGAGGCAGGAGGAAGCTGG - Intronic
1135327717 16:21537898-21537920 CTGGAGACGGATGGTGGAGATGG - Intergenic
1135549611 16:23388062-23388084 TGGGAGAGGGAGGGAGAAGAAGG - Intergenic
1135661770 16:24303161-24303183 CTGGAGAGGGAAGGGGAAGATGG - Intronic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1136338069 16:29623918-29623940 CTGGAGACGGATGGTGGAGATGG - Intergenic
1136486889 16:30578926-30578948 ATGGTGGGGGAGGGTGAAGAAGG - Intronic
1136570977 16:31096483-31096505 CTGGAGAGGGAGGAGCCAGCAGG - Intergenic
1137390546 16:48077652-48077674 CTGGAGACGGATGATGGTGATGG + Intergenic
1138157937 16:54722991-54723013 CTGGAGGTGGAGGATGAGGATGG + Intergenic
1138298722 16:55908920-55908942 ATGGAGAGAAAGGAGGAAGAAGG - Intronic
1138365858 16:56476589-56476611 CTGGAGATGGATGATGGTGATGG - Exonic
1139133355 16:64172629-64172651 CGGGAGAGGGAGAAAGGAGAGGG + Intergenic
1139264307 16:65624696-65624718 CTGGAGACAGAGGAGAAAGAGGG - Intergenic
1139528412 16:67530028-67530050 CCGGAGAGGGCGGTGGAAGAAGG - Intronic
1139652724 16:68370738-68370760 CTGGAGTGGGAGGTTGGAGTGGG - Intronic
1139849682 16:69943343-69943365 CTGGAGATGGATGATGGTGATGG - Intergenic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140799902 16:78476879-78476901 GAGAAGAGGGAGGAAGAAGATGG - Intronic
1141139686 16:81489299-81489321 CTGGAGTTGGTGGGTGAAGAGGG + Intronic
1141306629 16:82870497-82870519 CTGGGGAGGGAGAATAAAGTGGG + Intronic
1141461150 16:84179524-84179546 CTGCGGAGGGAGGAAGAGGAAGG - Exonic
1141757783 16:86004019-86004041 CTGGAGAGAGAGGAGGCAGAAGG + Intergenic
1141789063 16:86220875-86220897 AAGGAGAGAGAGCATGAAGAAGG - Intergenic
1141822692 16:86458034-86458056 CTGGAAAGGAAGGAAGGAGAAGG - Intergenic
1141863047 16:86731019-86731041 CTGCAGCGGGAGGATGGAGCTGG + Intergenic
1141973209 16:87496309-87496331 CTGGAGAGGGAGGCAGCTGAAGG + Intergenic
1142191605 16:88720721-88720743 GAGGACAGGGAGGAAGAAGAGGG - Exonic
1142332064 16:89461339-89461361 CTGGAGAGGGATGGTGGTGATGG + Intronic
1142631946 17:1230829-1230851 CTGGAGAGGGGGCCTGGAGACGG + Intergenic
1143008068 17:3850001-3850023 CTGGAGAGAGAGTTTTAAGAAGG + Intergenic
1143270855 17:5673420-5673442 CTGGAGAGTGGGAAGGAAGAGGG + Intergenic
1143278916 17:5735605-5735627 CTGGAGATGGATGGTGATGATGG + Intergenic
1143320840 17:6068056-6068078 CTAGGGAGGGAGGTTGAGGAAGG - Intronic
1143389624 17:6552580-6552602 CTGGAGCGGAAGAATGCAGAGGG - Intronic
1143759658 17:9091801-9091823 CTGGAGACGGATGGTGATGATGG - Intronic
1143814031 17:9496760-9496782 CATCAGAGGGAGTATGAAGAAGG + Intronic
1143880292 17:10024667-10024689 CAGGTGAGGGTGGATGGAGAGGG - Intronic
1144045724 17:11452931-11452953 AAGGAGAGGGAGGAAGAGGAGGG - Intronic
1144566318 17:16362467-16362489 CTGGAGAGGGATGGTGGTGATGG + Intergenic
1144599889 17:16602220-16602242 CTGGAGATGGATGATGTTGATGG - Intergenic
1144647830 17:16987464-16987486 GTGGAGAGGGAGGAGGAGGAAGG + Intergenic
1145779192 17:27550825-27550847 CTTGAGAAGGAGGATGGGGAGGG + Intronic
1146478855 17:33186182-33186204 CTGGAGATGGAGGTTGCAGTTGG - Intronic
1146584389 17:34069654-34069676 GAGGAGAGGGAGGAGAAAGAGGG + Intronic
1146950083 17:36899782-36899804 CTGGGCTGGGAGGATGCAGAGGG + Intergenic
1146980930 17:37160907-37160929 CTGGAAAGAGAGGATGGAGGGGG + Intronic
1147277724 17:39333140-39333162 ACGGAGAGGGAGGAGGGAGAGGG - Intronic
1147382941 17:40066178-40066200 CTGGAGAGGGAATTTGAGGAGGG + Intronic
1147484816 17:40802339-40802361 GTGGAGGGTGGGGATGAAGAGGG + Intergenic
1147563752 17:41524269-41524291 CTGCAGAGAGAGGAAGAAGAGGG + Intronic
1147625273 17:41896110-41896132 CTGGAGCTTGAGGATGAAGCTGG + Intronic
1147887396 17:43693432-43693454 CCCGGGAGAGAGGATGAAGAGGG + Intergenic
1148114708 17:45168990-45169012 AAAGAGAGGGAGGAGGAAGAAGG - Intronic
1148220557 17:45858745-45858767 CTGGAGAGGGAGGGTGAGGAAGG + Intergenic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148488097 17:48004153-48004175 GCGGAGAAGGAGGAAGAAGACGG - Intergenic
1148619335 17:49022601-49022623 CAGGAGAGGGAGGGGGAGGAGGG - Intronic
1148744697 17:49911761-49911783 CTGGAGAGGAGGGAAGAAGAGGG + Intergenic
1148744915 17:49912753-49912775 CTGGAGAGCAGGGAAGAAGAGGG - Intergenic
1148806713 17:50267473-50267495 CTGGGGCCGGAGGAGGAAGAGGG + Intergenic
1148809695 17:50282513-50282535 CTGGAGATGTTGGATGCAGAAGG - Intergenic
1149267306 17:54941003-54941025 GGAGAGAGGGAGGATGAAGAGGG - Intronic
1149310254 17:55386328-55386350 CTGGAGAGGGAGGAAGAGGCGGG - Intergenic
1149446689 17:56718650-56718672 CTGGAGAGGCAGGTAGAAGTCGG + Intergenic
1149453891 17:56771712-56771734 CTGGAGAGGGAGGCAGGAGGGGG + Intergenic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1149991490 17:61385977-61385999 CTGGGGAGGGAGGCTGGAGAGGG + Intronic
1150069552 17:62139574-62139596 CTGCAGCGGGAGGCTGAAGGTGG + Intergenic
1150152242 17:62819584-62819606 AAGGAGAGGAAGGATGGAGAGGG - Intergenic
1150259539 17:63777406-63777428 CTGGAAAGGGAGTTTGAGGAAGG + Intronic
1150289917 17:63975196-63975218 CTGGAGAGGGAGCATCAGTAGGG - Intergenic
1150335253 17:64326272-64326294 CTGGAGATGGAGGATGACCCAGG + Intronic
1150602016 17:66659367-66659389 CTGGTGGAGGAGGAGGAAGAAGG - Intronic
1150834640 17:68553196-68553218 CAGGAGAGAGAGGATGCAAAGGG - Intronic
1151215083 17:72571709-72571731 GTGGGGAGGGAGGATGATGGAGG - Intergenic
1151380750 17:73724220-73724242 TAGGAGAGGGAGGCTGGAGAGGG + Intergenic
1151396829 17:73828247-73828269 CAGGAGAGAAAGGATGAAGGAGG - Intergenic
1151823330 17:76509100-76509122 TGGGAGAGGGAGGATTAGGAAGG + Intergenic
1151825058 17:76519402-76519424 CGGGAGAGGGAGGATTAGGAAGG - Intergenic
1152099457 17:78292520-78292542 ATGGAGAGGGCAGATGAGGAGGG - Intergenic
1152441372 17:80312273-80312295 AAGGAGAGGGAGGAAGAGGAAGG + Intronic
1152676679 17:81644969-81644991 CTGCAGAGGGAAGAGGAACAGGG - Intronic
1152863003 17:82706619-82706641 CTGGAGATGGAGGGTGGTGACGG - Intergenic
1152894864 17:82905271-82905293 CAGGAGAGGGAGCATGGAGGAGG - Intronic
1152948453 17:83211586-83211608 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1152948468 17:83211635-83211657 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1153524937 18:5985913-5985935 TTGGAGAGGGATGCTGTAGAGGG + Intronic
1153762448 18:8344913-8344935 AGGGAGAGGGAGGAGGGAGAAGG + Intronic
1153837450 18:8976739-8976761 CTGGAGAGGGATGCTAGAGATGG - Intergenic
1154110875 18:11567484-11567506 CTGGAGGAGGTGGAGGAAGAGGG + Intergenic
1154166135 18:12015695-12015717 CTGGAGAGGGAAGGTGAGGCAGG - Intronic
1155213252 18:23620523-23620545 CTAGAGAGGGAGGGGGAAGGCGG + Intronic
1155233262 18:23794426-23794448 TTGGTGGGGGAGGAAGAAGAGGG - Intronic
1155277176 18:24199415-24199437 GTGGAGGGGGAAGATGAAGCAGG - Intronic
1156263010 18:35461979-35462001 TTGGGGTGGGAGGATGAAGAAGG - Intronic
1156269391 18:35517085-35517107 CTGGAGTTGCAGGAGGAAGATGG - Intergenic
1156463220 18:37333311-37333333 GTGGAGGGGGAGGAGGGAGAGGG - Intronic
1156846482 18:41671541-41671563 GTGGAGAAGGAGGAAGAAGAGGG + Intergenic
1157194517 18:45609919-45609941 CTGGAGATGCAGGATGCAAATGG + Intronic
1157210306 18:45736506-45736528 GTTGAAAGGGAGGGTGAAGACGG - Exonic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157442843 18:47723512-47723534 ATGGAGAAGGAGGATGGAGCTGG - Intergenic
1158052189 18:53235701-53235723 CTGGAGATGGATGATGTTGATGG - Intronic
1158325229 18:56306728-56306750 CTTGAGAGTGAGGATCCAGAAGG + Intergenic
1158427370 18:57352354-57352376 CAGGAGAGGGAGGGAGTAGAGGG - Exonic
1158525466 18:58209256-58209278 GTGGAGGTGGAGGATGAAGGGGG - Intronic
1158610511 18:58935494-58935516 GGGGAGAGGGAGGAGGAGGAAGG - Intronic
1158860788 18:61590199-61590221 GGGGAGAGCGGGGATGAAGAAGG - Intergenic
1159266127 18:66082048-66082070 ATGCAGAGGGAGGATGTAGTAGG - Intergenic
1159586657 18:70288983-70289005 CTGGAGGAGGAGGAGGAAGGAGG + Exonic
1159880986 18:73858336-73858358 TTGGAGAAGGAGGCAGAAGATGG - Intergenic
1160013827 18:75125915-75125937 CTGCAGAGGGAGGAGGAACAGGG - Intergenic
1160033938 18:75284494-75284516 CTGGAGATGGAGGGTGGTGATGG - Intronic
1160068943 18:75607665-75607687 CTGGTGAGAGAGGCTGAAGGAGG + Intergenic
1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG + Intergenic
1160191946 18:76722028-76722050 CTGAAGAGAGAGGACGAACAAGG - Intergenic
1160389904 18:78522083-78522105 CTGGATGGGGAGGTTGAGGATGG - Intergenic
1160565434 18:79784067-79784089 GAGGAGGGGGAGGAAGAAGAGGG + Intergenic
1160643609 19:164790-164812 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
1160676460 19:393912-393934 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695228 19:480651-480673 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695347 19:481320-481342 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160941388 19:1621909-1621931 GAGGAGAAGGAGGATGCAGATGG + Exonic
1161027993 19:2045515-2045537 GAGGAGAAGGAGGAAGAAGAGGG - Intronic
1161218090 19:3104746-3104768 CTGGCGAGGCAGGCTGCAGACGG + Intronic
1161239358 19:3213412-3213434 GGGGAGAGGGAGGAGGGAGAGGG + Intergenic
1161821621 19:6533746-6533768 CTGGAGGGGGAGGGGGAAGGGGG - Intronic
1161821634 19:6533774-6533796 CTGGAGGGGGAGAAGGGAGAAGG - Intronic
1161934343 19:7362297-7362319 AAGGAGAAGGAGGAAGAAGAAGG + Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162024206 19:7884552-7884574 GAGGAGGGGGAGGAGGAAGATGG + Intergenic
1162024221 19:7884587-7884609 GAGGAGAGGGAGGAGGAAGATGG + Intergenic
1162024241 19:7884632-7884654 GAGGAGAGGGAGGAGGAAGATGG + Intergenic
1162024260 19:7884677-7884699 GAGGAGAGGGAGGAGGAAGATGG + Intergenic
1162098454 19:8324831-8324853 CTGGGGAGTGGGGAGGAAGAGGG + Intronic
1162105375 19:8366837-8366859 CAAGAGAGGAAGGAGGAAGAGGG - Intronic
1162180562 19:8865973-8865995 CTTGAGAGGAAGGAGGAAGAGGG + Intronic
1162228706 19:9246913-9246935 CTGGAGATGGATGGTGAGGATGG + Intergenic
1162477424 19:10908929-10908951 CAGGAGAGGGAGCAGGAAGCCGG - Intronic
1162484414 19:10950242-10950264 CTGTAGTGGGAGGCTGAAGTAGG + Intergenic
1162728847 19:12705769-12705791 CTGGAGAGGGAGCACGAAATGGG + Intronic
1163150907 19:15413425-15413447 CTGGAAAGTGAAGATGAAGCTGG - Intronic
1163523849 19:17808349-17808371 CTTGAGCGTGAGGTTGAAGAAGG - Exonic
1163682366 19:18690478-18690500 CTGGAGAGTGATGAGGATGAGGG - Intronic
1163786170 19:19275966-19275988 CTGCAGAGGGAGGTTGGGGAGGG - Intergenic
1164292696 19:23881842-23881864 GAGGAGAAGGAGGAGGAAGAGGG + Intergenic
1164426544 19:28146821-28146843 GTGGAGGGGGATGATGGAGATGG - Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164592134 19:29512906-29512928 TTGGAGAAGGAGGAAGGAGAGGG + Intergenic
1164592624 19:29514554-29514576 AAGGAGAGGGAAGATGAGGAAGG + Intergenic
1164632191 19:29769075-29769097 CTGGAGACTGAGGGTGAAGTGGG - Intergenic
1164818023 19:31221612-31221634 CAGGAGAGGGGAGGTGAAGAAGG - Intergenic
1164879933 19:31724241-31724263 CTGGAGATGGATGATGGTGATGG - Intergenic
1165008244 19:32823835-32823857 CTGCAGAGTGGGGCTGAAGAGGG + Intronic
1165154636 19:33779530-33779552 CTGGAGAGGGAGAATGGACATGG - Intergenic
1165166886 19:33863275-33863297 CTGCAGGGGGAGGGTGGAGAGGG + Intergenic
1165333516 19:35154396-35154418 CTGGGGGAGGAGAATGAAGAGGG - Intergenic
1165363846 19:35352096-35352118 CAGGAGAGAGAGGCTGAAGCGGG - Exonic
1165739790 19:38198366-38198388 CTGGATGGGGAGGGTGGAGATGG - Intronic
1165883262 19:39058419-39058441 CTTGGGAGGGAGGCTGAAGAAGG - Intergenic
1165925645 19:39324531-39324553 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1166046117 19:40232147-40232169 CTGGAGAGGGTGGGTGGAGCTGG - Exonic
1166059766 19:40318905-40318927 CTGGAGATGGATGATGGCGAAGG + Intergenic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1166719234 19:44987971-44987993 CTGTAGAGGGAGGCTGAAGGTGG - Intronic
1167123336 19:47532071-47532093 CTGGAAATGGAGGGGGAAGAAGG + Intronic
1167350130 19:48969226-48969248 CTCCAGAGAGAGGATGCAGAGGG - Exonic
1167645485 19:50703123-50703145 CTCTGGAGGGAGGATGAGGAAGG - Intronic
1167786605 19:51643107-51643129 CTGGAGATGGTGGATGGAGAGGG + Exonic
1167852026 19:52209599-52209621 CTGGAGATGGAGGGTGATAATGG - Intronic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1168277924 19:55287323-55287345 CTGGAGAGGGAGGATGGGGTAGG - Intronic
1168393267 19:56027975-56027997 CTGGAGACTGAGGTGGAAGAAGG - Exonic
925332446 2:3069231-3069253 CTGGAGATGGATGATGATGATGG + Intergenic
925396166 2:3535051-3535073 CTGGAGATGGAGGGTGCTGATGG + Intronic
925639115 2:5970619-5970641 TTGGAGAGGCAGGAAGAATATGG - Intergenic
925888396 2:8412957-8412979 CTTGAGAGGCAGGCTGGAGAAGG + Intergenic
926386152 2:12337746-12337768 CTGAAGAGCAAGCATGAAGATGG + Intergenic
926601887 2:14854347-14854369 TTGGAGAGGGTGGAGCAAGATGG + Intergenic
927081398 2:19634288-19634310 CTGGAGGGGGAGCATGACCAGGG - Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927513315 2:23658078-23658100 CAGGAGAGGGAGGAGGGAGGAGG - Intronic
927889306 2:26738523-26738545 CTGGGAAGGGAGGATCAGGAAGG - Intergenic
927929823 2:27036924-27036946 ATGGTGAGGAAGGAAGAAGAGGG + Intronic
928171798 2:29009212-29009234 ATGGAGATGGAGGTGGAAGAGGG + Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928658308 2:33475694-33475716 CTTGGAAGGGAGGATGAAAAGGG + Intronic
929085620 2:38164724-38164746 CTGGAGAGGAGAGATGAAGAGGG - Intergenic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929588134 2:43128679-43128701 GTGGAGAGGAATGAGGAAGAGGG + Intergenic
929935399 2:46291140-46291162 CTGGAGATAGAGGCTGAAGGAGG - Intergenic
929994585 2:46817387-46817409 CTGGAGATGGAAGATGCAGCTGG + Exonic
930122977 2:47775001-47775023 CTGGAGAGGGAATCTGAAGTAGG + Intronic
930364647 2:50424167-50424189 GAGGAGGGGGAGGAGGAAGAGGG + Intronic
930364675 2:50424276-50424298 GGGGAGGGGGAGGAAGAAGAAGG + Intronic
930384626 2:50678616-50678638 CTGGAGAAGGAGGCTGTAAAGGG - Intronic
930461891 2:51691748-51691770 CTGGAGAAGTAGTATGAACAAGG + Intergenic
930779726 2:55212201-55212223 CTGGAGAGGGAGGTTGCTGTGGG + Intronic
930818536 2:55622473-55622495 CTGGAGAGGTAGGCAGAAGCAGG - Intergenic
931163791 2:59723254-59723276 CTGGAAAAGGAGGAGGAAGTAGG + Intergenic
931241076 2:60453023-60453045 CGGGAGAGGGAGGAGGGAAAGGG + Intronic
931430438 2:62204955-62204977 CTAGAGAGGGAGAGAGAAGAAGG + Intronic
931570565 2:63664957-63664979 CTGCATGGAGAGGATGAAGATGG + Intronic
931952590 2:67381984-67382006 CTCCAGATGGAGGCTGAAGAAGG + Intergenic
932215258 2:69962129-69962151 CTGGAGAGGGAGGCAGAGGAGGG + Exonic
932460755 2:71880435-71880457 ATGTAGAGGGAGCATGAGGAAGG - Intergenic
932631092 2:73344122-73344144 CTGGGGAGTGAGGATGAGGTGGG + Intergenic
932757447 2:74418153-74418175 CTGGAGAAGGAGGAAGAGAAGGG - Intronic
932832637 2:75005919-75005941 CTTAAGAGGGAGGAAGAGGACGG + Intergenic
933425998 2:82112794-82112816 CAGGAGAGGGAGCATGTAGATGG - Intergenic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
934119103 2:88823275-88823297 TTGGAGAGGGAGGTTGAACCTGG + Intergenic
934743727 2:96744575-96744597 CGTGAGAGGAAGGATGGAGAGGG + Intergenic
934924670 2:98373926-98373948 CTGGAGAAGTGGGATGAAAATGG - Intronic
934964953 2:98713110-98713132 CTGGAGATGGAGGATGCAGTGGG + Intronic
935192573 2:100790808-100790830 CTGGAAAAGGAGTATGATGATGG - Intergenic
935268812 2:101416190-101416212 CTGGGGAGGGGGGTGGAAGAAGG + Intronic
935595612 2:104874911-104874933 CTGGAGATGGATGATGGTGATGG - Intergenic
935711929 2:105906885-105906907 CTGGAGATGGATGGTGATGATGG - Intergenic
936034838 2:109102689-109102711 GGGGAGAGGGAGGATGAGGAAGG + Intergenic
936051176 2:109224781-109224803 CTGGAGAGGGAGGTTGCAGTGGG + Intronic
936061950 2:109300650-109300672 ATGGAGAAGGAAGAGGAAGATGG - Intronic
936155503 2:110044032-110044054 CTGGAGAGGTGGGAAGAACAGGG + Intergenic
936189183 2:110327402-110327424 CTGGAGAGGTGGGAAGAACAGGG - Intergenic
936239617 2:110776329-110776351 CTGGAGATGGATGGTGATGATGG + Intronic
936371015 2:111902508-111902530 CTGGAGTGGTAGGAACAAGAGGG - Intronic
936502670 2:113078420-113078442 CTGGTCAGGGAAGATGAAGCAGG - Intergenic
936928771 2:117765129-117765151 CTGGAGACGGAGGTTGCAGCAGG + Intergenic
937380889 2:121375200-121375222 CAGGAGAGAGAGAGTGAAGAGGG - Intronic
937494932 2:122408452-122408474 CTGGAAAGGAAGGAGCAAGAGGG + Intergenic
937824456 2:126351682-126351704 CTGGAGATGGATGGTGATGATGG + Intergenic
937895234 2:126972756-126972778 CTGGAGACGGAAGGTGCAGATGG - Intergenic
938314951 2:130318878-130318900 CTGGTGAGGGAGCAGGGAGAGGG - Intergenic
938422382 2:131155398-131155420 CTGGGGAGGGAGGCTCCAGAAGG - Intronic
938655700 2:133430862-133430884 GTGGAGAGGGAGAAGGAAGGAGG + Intronic
938734780 2:134176131-134176153 CTTGAGAGGAAGGCTGAAGGGGG + Intronic
938963209 2:136361485-136361507 ATGGAGAGAGAGAAGGAAGAAGG - Intergenic
938982549 2:136540275-136540297 CAGGAGAGAGAGCATGAAGTGGG - Intergenic
939831571 2:147078805-147078827 GTGGAGAGGGAAAATGAAGTTGG + Intergenic
940106916 2:150111474-150111496 ATGGAGTGGGAGGAGGAAGGAGG - Intergenic
940443087 2:153743058-153743080 AAGGAGAGGGAGGATAAAGTAGG + Intergenic
940650542 2:156436294-156436316 CGGGAGCGGGAGGAGGAAGTCGG + Intronic
940839484 2:158562538-158562560 CTGGAGATGGATGATGGTGATGG + Intronic
941216124 2:162711505-162711527 CTGAAAATGCAGGATGAAGATGG - Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
942658556 2:178240196-178240218 CTGGAGATGGATGATGGTGATGG + Intronic
942762896 2:179420751-179420773 CTGGAGAGGGATGGTGATGATGG - Intergenic
943024878 2:182615796-182615818 AAGGAGAGGGAGAAGGAAGAGGG + Intergenic
943763215 2:191632132-191632154 CTGGTAAGGGAGGGTGGAGAGGG - Intergenic
944132020 2:196357212-196357234 CTGCACAGGGAGGATGGAGAAGG - Intronic
944483483 2:200180437-200180459 ATGGAGAGGGAAGGGGAAGAGGG + Intergenic
944566643 2:200998183-200998205 CTGGAGAGGAAGGATGAGGGTGG - Intronic
944685646 2:202115311-202115333 CTGGAAGGGGAGGGTGGAGACGG - Intronic
945416320 2:209577346-209577368 CTGGGGAGAGAGGATGATGATGG + Intronic
945422275 2:209653315-209653337 CCATACAGGGAGGATGAAGAGGG + Exonic
946147513 2:217742132-217742154 CTGGAAAAGGAGGATGGTGATGG - Intronic
946335851 2:219036031-219036053 CAGGACTGGGAGGAGGAAGAGGG - Intronic
946807459 2:223485503-223485525 CTGGAGAGCAAGCATGGAGATGG - Intergenic
946937566 2:224737457-224737479 CAGGAGAGAGAGAGTGAAGAGGG - Intergenic
947434998 2:230065841-230065863 CTGGAGAGGGAGAACTTAGAGGG + Intronic
947536289 2:230942280-230942302 CAGGAGAAGGAGGCAGAAGAAGG - Intronic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
947805295 2:232962473-232962495 CAGGAGATGGAGGTTGAAGGGGG + Intronic
948041154 2:234902599-234902621 CTGGAGAGGGAGGAGGGAGGAGG + Intergenic
948766501 2:240224515-240224537 CTGGAGAGGATGGATGAGGGAGG - Intergenic
948810961 2:240478104-240478126 CTGGAGCGGGAGGAAGGGGAGGG - Intergenic
1168889624 20:1286408-1286430 CTGGAGAGGGAGAAGGGAGCTGG + Intronic
1168906601 20:1408963-1408985 CTGGAGATGGATGGTGATGATGG - Intergenic
1169180315 20:3560136-3560158 CTGGTGGGGGAGAATGAAGAAGG - Intronic
1169677083 20:8166413-8166435 CTGGAGAGGTAGGAAGAGGTAGG - Intronic
1170335007 20:15260267-15260289 GTGGGGAGGGGGGATAAAGAGGG - Intronic
1170493729 20:16904162-16904184 CTGGAGAGAGAGGGTGAGGTGGG + Intergenic
1170827556 20:19809494-19809516 CTGAAGAGTGTGGATGACGATGG + Intergenic
1170966873 20:21081496-21081518 CTGGAGAGGGATGGTGGTGATGG + Intergenic
1171087434 20:22250622-22250644 CTGGAGCAGGAGGAGGGAGAGGG + Intergenic
1171459491 20:25290891-25290913 CAGGGGAGGGAGGATACAGAGGG - Intronic
1172127782 20:32635420-32635442 CGGGAGATGGAGGTTGCAGAAGG + Intergenic
1172574456 20:35996967-35996989 CAGGAAATGGAGAATGAAGAAGG - Intronic
1172849214 20:37948511-37948533 CAGGAGAGGGAGGCTGAGGCAGG + Intergenic
1172891398 20:38268475-38268497 AAGGAGAGGGGGAATGAAGAAGG - Intronic
1173002016 20:39111566-39111588 GAGGAGAGGGAGGAGGGAGAGGG + Intergenic
1173112256 20:40202993-40203015 GGGGAAGGGGAGGATGAAGAAGG + Intergenic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1173664190 20:44753439-44753461 CTGGAGAAGGAGAGTGGAGATGG + Intronic
1174063787 20:47850440-47850462 AGAGAGAGAGAGGATGAAGATGG + Intergenic
1174101074 20:48126596-48126618 CTGGAGACGCAGGGAGAAGATGG - Intergenic
1174292586 20:49519542-49519564 CAGGCGAGGGTGGGTGAAGAAGG - Intronic
1174750013 20:53102488-53102510 GGGGAGAGGAAGGAAGAAGAGGG + Intronic
1175013719 20:55765836-55765858 CAGGAGAGAGAGCATGAAGGAGG + Intergenic
1175074731 20:56362958-56362980 CTGCTGAGGGAGGCTGCAGAGGG - Intronic
1175148922 20:56917623-56917645 CTGGAGTGGGAGAAGGAAGACGG - Intergenic
1175564017 20:59958558-59958580 CTGAAAAGGGAGGAGCAAGATGG + Exonic
1175613978 20:60376894-60376916 GTGGCAAGGGAGGAGGAAGAAGG + Intergenic
1175977619 20:62719507-62719529 CTGGAGAGGGAGGGTGGAGATGG - Intronic
1176062013 20:63176589-63176611 CTGGAGAGGGTGGAAAAGGAAGG + Intergenic
1176160282 20:63644090-63644112 CTGGAGAGGGAGGTTCTAGGGGG - Intronic
1177085379 21:16696142-16696164 CAGGAGAGAGAGAGTGAAGAGGG + Intergenic
1177231251 21:18322730-18322752 GTGGGGAGGGAGGATAAAGAAGG + Intronic
1177608599 21:23415971-23415993 CTGGAGAGGAAGGAATAGGAAGG + Intergenic
1177824867 21:26071343-26071365 CTGGAGAGGGAAACTGAAGATGG - Intronic
1178225542 21:30713381-30713403 CTGGAGAGGAAGGATAAAGAAGG + Intergenic
1178679419 21:34660077-34660099 CTGGGGAGGGAGGATGGAACTGG - Intergenic
1178822860 21:35991342-35991364 CAGGAGAGTGAGGAGGGAGATGG + Intronic
1178873808 21:36397081-36397103 CAGGTCAGGCAGGATGAAGAGGG - Intronic
1179268977 21:39833893-39833915 CTGGAGACGGAGGTTGGTGATGG - Intergenic
1179281022 21:39934410-39934432 CTGCAGAGAGGGGATGATGATGG + Intergenic
1179513953 21:41893649-41893671 CTGGAGAGCGTGAGTGAAGATGG - Intronic
1180202048 21:46229757-46229779 CAGCAGAGGGAAGAGGAAGATGG + Intergenic
1180622796 22:17172811-17172833 CTGGAGAGGCAGGCTGAGGCGGG + Intergenic
1180628510 22:17210669-17210691 CTGGAGGCGGAGGTTGTAGAGGG - Intronic
1180743071 22:18067264-18067286 CTGGAGAGGGGGGATCAGGAAGG - Intergenic
1180938267 22:19640182-19640204 CTGGAGACGGATGGTGGAGATGG - Intergenic
1181138099 22:20783503-20783525 CTGGGGAGGGAGGCTGAGGCAGG + Intronic
1181283771 22:21737575-21737597 CTGGAGAGGGATGATGATGATGG - Intergenic
1181656683 22:24306732-24306754 CTGGAGATGGATGGTGATGATGG - Intronic
1181685565 22:24525444-24525466 CTGCTGAGGCAGGATGGAGAAGG - Intronic
1181901546 22:26160301-26160323 GGGGAGATGGAGGAAGAAGAAGG + Intergenic
1181904911 22:26186612-26186634 CTGGAGATGGTGGAGGATGAGGG + Intronic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182185597 22:28398344-28398366 ATGGAGAGGGAGCCAGAAGAGGG + Intronic
1182514333 22:30844954-30844976 CAGGAAAGGGAGGCTCAAGAAGG + Intronic
1183193547 22:36337211-36337233 CTGGAGAGGGAAGGTGTAGCTGG + Intronic
1183443654 22:37838470-37838492 CTGGGGAGGGAGGAGGGAGTAGG - Intronic
1183582151 22:38732389-38732411 CTGGTGAGGGAGCCTGAACACGG - Exonic
1183598204 22:38824873-38824895 CTGGAGGGGGAGGAGGAGGAGGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1184306277 22:43604580-43604602 CTGGACAGGGAGCCTCAAGATGG - Intronic
1184345160 22:43908742-43908764 TTGGTGAGGGAGAATGACGAGGG + Intergenic
1184444871 22:44541181-44541203 CTGGGGAGGGAGGAAGGAGTAGG - Intergenic
1184561642 22:45267267-45267289 GAGGGGAGGGGGGATGAAGAGGG + Intergenic
1184574959 22:45356273-45356295 CTGTAGAGGGAGGAGGATGGTGG - Intronic
1184682596 22:46080147-46080169 CGGGAGAGGGAGGAGGAAGCCGG - Intronic
1184756796 22:46520814-46520836 CTGGAGATGGAGGGTGATGATGG - Intronic
1184801746 22:46765144-46765166 CTGAAGAGGGCAGAAGAAGAAGG + Intronic
1185363765 22:50425151-50425173 GTGGAGAGGGAGAATGAATGGGG - Intronic
949160764 3:879169-879191 CTGGAGAGGGTGGTTGGAAAAGG + Intergenic
949533509 3:4978858-4978880 CGGGCGGGGGAGGAGGAAGAGGG + Intergenic
949654967 3:6207265-6207287 CTGGAGAAGCATGGTGAAGATGG - Intergenic
950099881 3:10350200-10350222 CTGGAGAGGGATGGGGAAGGGGG + Intronic
950221045 3:11196311-11196333 CTGCTTAGGGAGGCTGAAGAGGG - Intronic
950452454 3:13073034-13073056 CTGGAGAGGGAGCCAGAACAGGG - Intronic
950590774 3:13934643-13934665 CTGAGCAGGGAGGGTGAAGAAGG + Intergenic
950689390 3:14643602-14643624 TTGGAATGGAAGGATGAAGAAGG + Intergenic
950866074 3:16190305-16190327 CTGGAGGGGGAGCCTGAGGATGG - Intronic
951261773 3:20518229-20518251 CTGGATAGGGAGGAGAGAGAGGG - Intergenic
951680337 3:25288232-25288254 CTGGAGAGAAAGGAGGAAAATGG + Intronic
952151372 3:30596246-30596268 CCGGTGAGTGGGGATGAAGACGG - Intergenic
952152956 3:30612399-30612421 GTTGGGAGGGAGGCTGAAGAGGG + Intronic
952866625 3:37859864-37859886 CTGTATTGGGAGGATTAAGAAGG + Intergenic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953026008 3:39145351-39145373 GTGGAGAGGGAGGAGGGAAAAGG - Intronic
953243259 3:41168092-41168114 CAGACGAGGGAGGAAGAAGAAGG + Intergenic
953420523 3:42750248-42750270 CTGGAGAAGGAAGATGGGGAAGG - Intronic
953715193 3:45311522-45311544 CTGGAGAGGCAGGGGGCAGAAGG + Intergenic
954034559 3:47844247-47844269 CTGGAGAAAGACGAGGAAGAGGG + Intronic
954050806 3:47975480-47975502 ATAGAGAGGGAGGAAGAAGTAGG + Intronic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954366440 3:50148757-50148779 CTGGAGTGGGAGGAAGAGGGAGG + Intergenic
954393389 3:50279284-50279306 CTGGAGCTGGAGCATGAAAATGG - Intronic
954762899 3:52889971-52889993 CTGGAGAGGGTAGAGGCAGAGGG - Intronic
954776815 3:53026838-53026860 CTGGAGAGGCTGGAGTAAGATGG + Intronic
955029326 3:55201148-55201170 CTGGAGGGGGAGGATCATGCTGG + Intergenic
956000367 3:64723584-64723606 CTGGAGAAGGATGATGCTGATGG + Intergenic
956064284 3:65380433-65380455 CTGGAGATGGATGATGATGATGG - Intronic
956666419 3:71646139-71646161 CTGGAGATGGATGATGGTGATGG - Intergenic
956699726 3:71948300-71948322 GTGGGGAGGGAGGATGTAGCTGG + Intergenic
956786088 3:72643587-72643609 CCTGAGAGGGAAGATGAGGAGGG + Intergenic
957125089 3:76148584-76148606 CTGAAGAGGGAGGCTCCAGAAGG - Intronic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957666770 3:83241972-83241994 CTGGAAATTGAGGAGGAAGAAGG + Intergenic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958871969 3:99570318-99570340 TTGTAGAGGGTGGATGAGGAAGG + Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
958925245 3:100150065-100150087 TGGGAGAGAGAGGATGAAGGAGG - Intronic
959380028 3:105630592-105630614 GGGGAGAGGGGGAATGAAGAAGG - Intergenic
960216950 3:115051905-115051927 CAGGAGAGAGAAAATGAAGAGGG + Intronic
960508924 3:118525351-118525373 CAGGAGGGGGAGCATGCAGACGG + Intergenic
960945086 3:122960877-122960899 CTGGAGATGGAGGGTGGTGATGG + Intronic
960953192 3:123012769-123012791 CTGGGGTGGAAGGATGAAGGAGG - Intronic
961020817 3:123505321-123505343 CTGGAGATGGATGGTGATGATGG + Intronic
961142724 3:124568896-124568918 CTGGAGATGGATGGTGATGATGG + Intronic
961343073 3:126243349-126243371 CAGGAGGGGGAGCATGCAGATGG + Intergenic
961528316 3:127523192-127523214 CTGGAGACGGATGGTGATGATGG + Intergenic
961648948 3:128407959-128407981 CTAGGGAGGGAGGCAGAAGAGGG + Intronic
962031477 3:131605382-131605404 CTAGAGAGAGAGAAGGAAGAGGG - Intronic
962047572 3:131776830-131776852 TGGCAGAGGGAGGATGAGGAAGG - Intronic
962064005 3:131960119-131960141 GTGGAGAGGGAGGGAGGAGAGGG + Intronic
962074970 3:132072026-132072048 TTGGGGAGTAAGGATGAAGACGG - Intronic
962092789 3:132262760-132262782 CTGGAGAGGGAGTGCGAAGTGGG + Intronic
962276377 3:134017758-134017780 GAGAAGAGGGAGAATGAAGAGGG + Intronic
962356455 3:134698463-134698485 CTGGAGGTGGAGGATGGAGACGG - Intronic
962376429 3:134862261-134862283 CTGGTGGGGGATGATGGAGAGGG + Intronic
962829925 3:139131020-139131042 CTGGAGAGGGAGGTTGTTGGTGG + Intronic
962841676 3:139238405-139238427 CTGGAGGAAGAGGAGGAAGAAGG - Intronic
963796476 3:149635603-149635625 CGGAAGAGGGAGGAGGAGGAAGG + Intronic
964086955 3:152830630-152830652 TGGGAGAGGGAGGAGGAAGAGGG - Intergenic
964235054 3:154515887-154515909 CTGGAGATGGGTGATGATGATGG - Intergenic
965117629 3:164512672-164512694 CTGGAAAGGGTAGTTGAAGAAGG - Intergenic
965118802 3:164523382-164523404 CTGGAGGGGGAGGTTGCAGTGGG - Intergenic
965260972 3:166484429-166484451 GTGGAGAGGGTGGAGGAAGCTGG + Intergenic
965312208 3:167143289-167143311 TTGGGAAGGGAGGAGGAAGAAGG + Intergenic
965389212 3:168084166-168084188 CAGGAGAGAGAGGGTGAAGGGGG - Intronic
965489625 3:169320422-169320444 CTGAGGAGGAAGGATAAAGAGGG + Intronic
965865209 3:173197330-173197352 CAGGAGAGAGAGAATGAAGGAGG + Intergenic
966215469 3:177497469-177497491 CTGGAAGGGGAGGTTGCAGAGGG + Intergenic
966265142 3:178031359-178031381 TTGGAGAGGTAGGATAAGGAAGG - Intergenic
966535711 3:181031494-181031516 CTGGAGATGGAAGATGGTGATGG - Intergenic
966636877 3:182144879-182144901 CTGCAGAGGAAGGATGAAATGGG - Intergenic
966664500 3:182455743-182455765 CTGGGAAGGGAGGAGGAATAAGG - Intergenic
966706938 3:182926378-182926400 CTGCAGAGGGAAAATGAAGCAGG - Intergenic
966807557 3:183818866-183818888 CTGGAGGGAGAGGATGAGGCTGG + Intronic
966906551 3:184530364-184530386 TTGTAGGGGGAGGAGGAAGATGG + Intronic
967330280 3:188283095-188283117 CTAGAGAGACAGGATTAAGAAGG - Intronic
967674413 3:192278860-192278882 ATGGAGAGGGAGGAGCAGGAAGG - Intronic
967750448 3:193108930-193108952 ATCAAGAGGGAAGATGAAGAAGG - Intergenic
968585031 4:1412339-1412361 CTGTAGAGGCAGGATGCAAAAGG + Intergenic
968611711 4:1560149-1560171 CTAGAAAAGGAGGATCAAGAAGG - Intergenic
968808520 4:2789801-2789823 CAGGAGAGGGAGGATGAGGCAGG + Intergenic
969087643 4:4668266-4668288 TTGGAGAGAGAGGAAGAAAAGGG - Intergenic
969241796 4:5903705-5903727 CTGGAGATGGATGATGGTGATGG + Intronic
969352108 4:6603957-6603979 TTGGAGAGGGAGGCTGGAGGAGG - Intronic
969783042 4:9425862-9425884 CTGGGGAGGGAGGAGGAAATAGG + Intergenic
970436603 4:16041641-16041663 CTGTAGTGGGAGGCTGAAGTAGG + Intronic
970572768 4:17398962-17398984 ATGGTGAGGGAGGAGAAAGAAGG - Intergenic
971054139 4:22893811-22893833 GTGGACAGGGAGAATGCAGAAGG + Intergenic
971218077 4:24680521-24680543 AGAGAGAGGGAGGAAGAAGAAGG + Intergenic
971615252 4:28781125-28781147 CAGAAGACTGAGGATGAAGATGG + Intergenic
971643159 4:29161680-29161702 TAGGAGAGAGAGCATGAAGAGGG - Intergenic
971909926 4:32782791-32782813 CTGGAGAGGGAGAAAGAAATAGG - Intergenic
972369950 4:38413746-38413768 CTGGGGAGGAAGGAGGAAGTTGG - Intergenic
972371549 4:38428774-38428796 CAAGAGAAAGAGGATGAAGAAGG + Intergenic
972420987 4:38886125-38886147 CTGTGGAGGGAGGATGGACAAGG + Intronic
972565523 4:40265682-40265704 AGGGAGAGGGAGGAGGGAGATGG + Intergenic
972587555 4:40451858-40451880 CTGGCAAGGGTAGATGAAGAAGG + Intronic
972672368 4:41226020-41226042 CTGGAGATGGATGATGTTGATGG + Intergenic
973067960 4:45821409-45821431 CTGGAGGGGGAGAATGCAAATGG + Intergenic
973639123 4:52885932-52885954 CTACAGAGGGACAATGAAGATGG - Intronic
973782017 4:54296988-54297010 ATGGAGTGGGAGGCAGAAGACGG - Exonic
973793956 4:54404572-54404594 GTGGAGATGGAAGATGAATAGGG + Intergenic
974078949 4:57193580-57193602 GTGGAGAGTGGGGTTGAAGAGGG - Intergenic
974608620 4:64185366-64185388 CAGGAGAGAGAGAATGAAGGGGG + Intergenic
974686984 4:65243108-65243130 GAGGAGAAGGAGGAAGAAGAAGG + Intergenic
974856501 4:67467014-67467036 CAGAAGGGGGAGGATGAAAAGGG + Intergenic
974931588 4:68366384-68366406 CGGGAGAGAGAGCATGAAGGGGG - Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975485574 4:74931677-74931699 CTGGCCAGGGAGGATGGAGAGGG + Intergenic
975635696 4:76445816-76445838 CATGAGAGGGAGGAAGAAGGTGG - Intronic
976475883 4:85482518-85482540 CTGCCGAGGGAGGATGAAAGGGG + Intronic
976789248 4:88859291-88859313 CAGGAGAGGGAGGAGGAAGGAGG + Intronic
977491849 4:97723787-97723809 TAGGAGAGAGAGCATGAAGAGGG + Intronic
978030481 4:103936334-103936356 CAGGAGAGGGTGGAGCAAGATGG + Intergenic
978241460 4:106521497-106521519 CTGGAGGGGGAGGCTGAGGTGGG - Intergenic
978477897 4:109152944-109152966 CTGGAGATGGATGATGGTGATGG + Intronic
978752476 4:112266695-112266717 CTAGAGTGGGAAGATGAAGAAGG + Exonic
978827316 4:113041052-113041074 CTGTAGAGAGATGATGATGAGGG - Intronic
981001538 4:139833485-139833507 CTAGAGTGGGAGGAAGAAGGGGG + Intronic
981035398 4:140163602-140163624 CTGCAGAGGGTGGATCAAGGGGG + Intergenic
981297288 4:143146784-143146806 CTGGAGAGTGAAGAAGAAGCTGG + Intergenic
981479105 4:145218405-145218427 CTGGTGAGGGAGGAGGACAAGGG + Intergenic
981532495 4:145765681-145765703 GCTGAGAGGGAGGATGAAGAGGG + Exonic
981569283 4:146134448-146134470 CTGCTGAGGGTGGATGCAGACGG - Intergenic
982217244 4:153093017-153093039 GTGGAGAGGGAGAATGGAGATGG - Intergenic
982222935 4:153140402-153140424 CTGGAGATGGATGGTGATGATGG - Intergenic
982226244 4:153170127-153170149 AAGGAGAAGGAGGAGGAAGAGGG + Intronic
982603354 4:157481465-157481487 CTGGAGAGGAAGGATAGATAGGG + Intergenic
983436063 4:167717303-167717325 CTGGAGAGCAATGATGAACAGGG - Intergenic
983552214 4:169029125-169029147 CAGGAGATGGAGGCTGCAGATGG + Intergenic
984916247 4:184727341-184727363 CTGGAGATGGATGGTGATGATGG + Intronic
985263823 4:188139814-188139836 CTGCAGAGCGAGGATGAGCAGGG + Exonic
986102296 5:4625100-4625122 ATGGAGATGGATGATGATGATGG + Intergenic
986167574 5:5288843-5288865 CTGGAGTGGCAGGATCAGGAAGG - Intronic
986222093 5:5776922-5776944 CTGGAGAGGGAGGAATAGCAGGG - Intergenic
986414192 5:7511794-7511816 GTGTAGAGGGAGTATGAACATGG + Intronic
986522320 5:8633015-8633037 TTGGAGGAGGAGGATGAAGGGGG + Intergenic
986664638 5:10090098-10090120 CAGAAGAGGGAGGCAGAAGAGGG + Intergenic
987398301 5:17446812-17446834 TTGGAAAGGGAAGTTGAAGATGG + Intergenic
988025001 5:25674140-25674162 CAGGAGAGAGAGAATGAACAGGG + Intergenic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
989057579 5:37379754-37379776 CTGGAGAGAGAGGAAGAGAAAGG + Intronic
989116765 5:37962385-37962407 GAGGAGAGGGAGGGTGCAGATGG - Intergenic
989146376 5:38254671-38254693 CTAGAGAGGAAGCATGAAGAGGG + Intergenic
989255403 5:39361271-39361293 CTGTAGAGGTAGGATGAGGTGGG + Intronic
989349211 5:40465789-40465811 CTGGAAAGGTGGGATGAAGTGGG - Intergenic
990194163 5:53294243-53294265 CTGGGGAGGGAGAATGAAAAAGG + Intergenic
990523834 5:56605763-56605785 CAGGAGAGGGGTGAAGAAGAAGG - Intronic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990598558 5:57334680-57334702 CTGGATAGGGAGGAAGCAGAAGG - Intergenic
990602107 5:57369410-57369432 CTGGAGAGAGAGGCAGAAGAAGG - Intergenic
990728391 5:58781828-58781850 GTGGAGAGGGAGGAGGAAGTTGG - Intronic
991191496 5:63879399-63879421 CTGAAGAAGGATGATGAATAAGG + Intergenic
991524960 5:67546284-67546306 CTGCTGGGGGAAGATGAAGAAGG - Intergenic
991961703 5:72051195-72051217 CTAGAGAGGGAGGAAGAGCATGG + Intergenic
992008731 5:72506528-72506550 CTAGAATGGGAGGATTAAGATGG - Intronic
992347277 5:75892581-75892603 CTACAGAGGGAAGATGAGGAAGG - Intergenic
992627518 5:78648761-78648783 GGGGAGAGGGAGGAGGAGGAGGG + Exonic
992773720 5:80071972-80071994 CTGGAGAGGGAGGATCTCGTGGG - Intronic
993252715 5:85549591-85549613 ATGAAGAGTGAGGACGAAGAAGG + Intergenic
993503493 5:88686446-88686468 CTGGAGTGGGAGAAGGGAGATGG - Intergenic
993551307 5:89277257-89277279 GTTGAGAGGAAGGCTGAAGAAGG - Intergenic
993603117 5:89953332-89953354 CTGGATGGGGAGCATGAAGAAGG + Intergenic
993709013 5:91204468-91204490 CTGGAGATGAAGGATGGTGATGG + Intergenic
993773592 5:91962801-91962823 CAGGAGGGGGAGCATGCAGATGG - Intergenic
993827411 5:92708908-92708930 CAGGAGAGGGAGATTAAAGATGG + Intergenic
994209662 5:97073619-97073641 CTGGAGGGGGAGCATGCAGACGG - Intergenic
994869685 5:105331629-105331651 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
995111308 5:108431794-108431816 CTGGAGAGGGAGCAAGAAACCGG + Intergenic
996002438 5:118380833-118380855 CTGGAGAGGGATGTTGATAATGG - Intergenic
996010138 5:118473153-118473175 CTGGGGAAGGAGGGTCAAGATGG - Intergenic
996156549 5:120109810-120109832 CTTGAGAGGAAGGATGAAAAGGG + Intergenic
996541232 5:124631508-124631530 CTGGAGAGTGGTGAGGAAGATGG + Intergenic
996611026 5:125380839-125380861 GAGGAGATGGAGGAAGAAGAGGG + Intergenic
996669491 5:126100657-126100679 CGGGAGGGGGAGCATGCAGATGG + Intergenic
997214152 5:132096571-132096593 CTGGAGAGTGAGGGTAAAAAGGG + Intergenic
997410085 5:133684314-133684336 CTGGGGAGGGAGGGTGCAGAGGG + Intergenic
997823890 5:137089425-137089447 CTGGTGTGGGAGGAGGAGGAGGG - Intronic
998012159 5:138704029-138704051 TTGGACAGGGAGGTTGAAGGGGG - Intronic
998181404 5:139947993-139948015 CTGGAGATGGAGAATGGTGATGG - Intronic
998447743 5:142211500-142211522 CTGGAGAGTGAGGATCAAGCAGG + Intergenic
998585643 5:143423945-143423967 GTGGGGAGGGGGGATAAAGAGGG + Intronic
998750697 5:145318626-145318648 CAGGAGGGGGAGCATGCAGATGG + Intergenic
998793461 5:145791638-145791660 CTGGAGATGGATGATGGTGACGG + Intronic
998844897 5:146298924-146298946 CAGAAGCGGGAGGATGAAAAGGG - Intronic
999044839 5:148455921-148455943 GAGGAGGAGGAGGATGAAGAGGG + Intronic
999051333 5:148526881-148526903 ATGTAGGGGGAGTATGAAGAGGG + Intronic
999221213 5:149979336-149979358 GTGGGGAGGGAGAGTGAAGATGG + Intronic
999255976 5:150210231-150210253 TTGCAGAGAGAGGAAGAAGAGGG + Exonic
999273894 5:150315551-150315573 CGGGAAAGGGAGAATGGAGAGGG + Intronic
999738864 5:154534128-154534150 CTGGAGGCTGAGGAGGAAGATGG - Intergenic
999883497 5:155893556-155893578 CTAGAGAGGCATAATGAAGATGG + Intronic
999928116 5:156401859-156401881 TTGGAGATGGATGATGATGATGG - Intronic
1000035009 5:157439938-157439960 CTGGAGATGGATGTTGATGAGGG + Intronic
1000179943 5:158799092-158799114 CCAGAGAGAGAGGATGAGGAGGG + Intronic
1000193298 5:158934487-158934509 CTGGAGAAAGAGGAAGAAAAAGG - Intronic
1000339248 5:160264651-160264673 CTGGAGAGGGATGGTGGTGATGG - Intronic
1000444866 5:161307119-161307141 GTGGTGAGGAAGGAGGAAGAAGG - Intronic
1000455340 5:161441973-161441995 CTGGGGTGGGAGGAGGGAGATGG + Intronic
1001132898 5:169079513-169079535 GAGGAGAGGGAGGAGGAAGGAGG + Intronic
1001244947 5:170098925-170098947 GGGGAGAGGGAGGGGGAAGAGGG + Intergenic
1001654124 5:173336397-173336419 CTGGAGATGGGGGATGGCGAAGG - Intergenic
1001705505 5:173738449-173738471 CCTGAGAGGGAGGTTGAAGGTGG - Intergenic
1002024520 5:176388043-176388065 CTGGGGAGGGAGTGTGACGAAGG + Intronic
1002202519 5:177538108-177538130 CTGGAGAAGGGGGAGGAAAAAGG + Intronic
1002205248 5:177558325-177558347 CTGGGGAGAGAGGAAGAAGTAGG - Intergenic
1002207679 5:177574874-177574896 CTGGGGAGGAAGGATGATTAGGG - Intergenic
1002380578 5:178825351-178825373 GATGAGATGGAGGATGAAGAAGG - Intergenic
1002733314 5:181360001-181360023 CTAGAGAAGGAGGATGCAGCAGG + Intergenic
1002742620 5:181444741-181444763 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1002742635 5:181444790-181444812 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1002751226 6:114117-114139 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
1002832942 6:840446-840468 CTGGGGAGGGAGGAGAAAGGAGG + Intergenic
1003123467 6:3336906-3336928 CTGAAGTGGGAGGCTGAAGTGGG - Intronic
1003198781 6:3939666-3939688 CTGAAGAGGGTGGAAGGAGAAGG + Intergenic
1003219288 6:4143420-4143442 CAGGAGAGAGAGAATGAAGGGGG + Intergenic
1003269154 6:4591976-4591998 CTGGGGAGTGGGGATGAAGTTGG - Intergenic
1003389822 6:5703967-5703989 CGGCAGAGGAAGGAGGAAGAGGG - Intronic
1003499737 6:6694558-6694580 CTGTAGGGGGAGCATGCAGATGG + Intergenic
1003616101 6:7656830-7656852 TTGGAGCTGGAGGATAAAGAGGG - Intergenic
1003746051 6:9003955-9003977 AGGGAGAGGGAGGAAGAGGAGGG - Intergenic
1003817622 6:9859929-9859951 GAGGAGGAGGAGGATGAAGAAGG + Intronic
1004141969 6:13026552-13026574 GTAGAGAGGGAGGAAGGAGACGG + Intronic
1004684068 6:17925310-17925332 CTTGAGCGGGAGGAAGAATAGGG + Intronic
1004881133 6:20009624-20009646 CTTGAAAGGGAGGATGAAGAGGG - Intergenic
1004902797 6:20209779-20209801 CAGGATAGGGAGGATAAAGGTGG - Intronic
1005312646 6:24573046-24573068 CGGGAGAGGGAGGTTGCAGTGGG + Intronic
1005625286 6:27656669-27656691 CTGGAGATGGATGATGGTGATGG + Intergenic
1005877489 6:30023272-30023294 CTGGAGATGGAGGGTGGTGATGG - Intergenic
1006106626 6:31720834-31720856 ATGGAGAGGGTGGATACAGAAGG + Intronic
1006256198 6:32834551-32834573 CTGGAGATGGATGGTGATGATGG + Intronic
1006335126 6:33416375-33416397 CTGAGGAGGGAGGATGATAAGGG + Exonic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006770209 6:36547004-36547026 CTGGAGACGGGGGAAGAAGGGGG + Intronic
1007041055 6:38722810-38722832 ATGGAGAAGGATGCTGAAGATGG + Exonic
1007296064 6:40821515-40821537 CTGGAGATGGGAGGTGAAGAGGG + Intergenic
1007405572 6:41634397-41634419 CTGGTGATGGAGGATGACGGTGG - Intergenic
1007406418 6:41638451-41638473 CTGGAGGGAGAGAAGGAAGAAGG + Exonic
1007470427 6:42086645-42086667 CAGGAGAGGGTGGTGGAAGAGGG - Intronic
1007598324 6:43065714-43065736 CTGGAATGGGAGGGTGAAAAGGG + Intronic
1007616335 6:43181899-43181921 TGGGAGAGGGAGGATTAGGAGGG + Intergenic
1007667915 6:43526840-43526862 CAGGTGAGGAAGGAGGAAGATGG + Intronic
1007712982 6:43836360-43836382 CTGGAGAGTGGGGAGGAGGAAGG + Intergenic
1007779634 6:44245662-44245684 CTGGTGAGGGAGGACGATGTGGG + Intergenic
1008042466 6:46816563-46816585 GAGGAGAAGGAGGAAGAAGAAGG + Intronic
1008055977 6:46946472-46946494 GTGGTGAGGGAAAATGAAGATGG + Intronic
1008475544 6:51931955-51931977 ATGGAGAGAGAGGAGGGAGAAGG + Intronic
1008809103 6:55470821-55470843 CAGGAGAGAGAGCATGAAGAGGG + Intronic
1009022602 6:57960930-57960952 CTGGAGAGAGAGGAAGAGAAAGG - Intergenic
1009441440 6:63684398-63684420 CTTGAAATGAAGGATGAAGATGG + Exonic
1009501732 6:64421937-64421959 CTTGATGGGGAGGATGGAGAGGG - Intronic
1009518855 6:64656731-64656753 CTGGATTGGGAGGATGAGAAGGG + Intronic
1010676542 6:78752847-78752869 CTGCTGCTGGAGGATGAAGAAGG - Intergenic
1011460075 6:87593768-87593790 CTGGAGATGGAGGCTGCAGTGGG - Intronic
1013105751 6:107025494-107025516 CCAGAGAGGGAGGAGGAAGGTGG + Intergenic
1013249563 6:108320783-108320805 CTGGGGTGGTAGGATGAGGAAGG + Intronic
1013677246 6:112479165-112479187 ATGGAGAGGTAGGATAGAGAAGG + Intergenic
1013681737 6:112531839-112531861 CTGGAGAGGGAAGAATTAGATGG - Intergenic
1014116753 6:117675487-117675509 CTGCCAAGGGAGGAGGAAGATGG + Exonic
1014135128 6:117880091-117880113 CAGGAGAGAGAGGATCAAAATGG - Intergenic
1014348079 6:120300971-120300993 CTGGAGAGAAAGGCTGAAAATGG - Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014755967 6:125302090-125302112 TTGGAAGGGGAGGAGGAAGAGGG - Intergenic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1014949236 6:127536119-127536141 CTATAGTGGGAGGATGAAAATGG + Intronic
1015017591 6:128433247-128433269 GTGGAAAGCGGGGATGAAGAGGG - Intronic
1015143977 6:129965275-129965297 CTGGAAATGGATGATGATGATGG + Intergenic
1015398215 6:132758988-132759010 GTGGGGAGGGAGGAAAAAGAAGG - Intronic
1015510438 6:134033100-134033122 CTGGAGAGGTAGGACGGAAAGGG + Intronic
1015554103 6:134443192-134443214 GTGGAGAGAGAAGTTGAAGAGGG + Intergenic
1015699469 6:136019899-136019921 GAGGAGAGGGAGGAAGAGGAAGG + Intronic
1015839581 6:137462265-137462287 CAGGAGACGGAGGTTGCAGAGGG + Intergenic
1016061765 6:139637823-139637845 CTGAAGAGGGAAGAAGAACATGG - Intergenic
1016221709 6:141679884-141679906 GTGGGCAGGGATGATGAAGAAGG + Intergenic
1016750183 6:147623201-147623223 GAGGAAAGGGAGGATCAAGAGGG + Intronic
1016890386 6:149000481-149000503 CAGCAGAGAGAGGAAGAAGACGG + Intronic
1017194386 6:151684332-151684354 CTGGAGAGGTTGGCTGGAGACGG + Intronic
1017268316 6:152477353-152477375 CAGAAAAGGGTGGATGAAGAGGG + Intronic
1017417482 6:154236458-154236480 CTGGAGATGGATGATGCTGACGG + Intronic
1017721976 6:157249789-157249811 CAGGAGTGGGAGGATGTGGAGGG - Intergenic
1017806310 6:157948692-157948714 CTGGAGATGGATGATGGTGATGG - Intergenic
1017847653 6:158273391-158273413 CCAGTGAGGGAGGATGAGGATGG - Intronic
1017870130 6:158479994-158480016 CAGGTGAGGGAGGAGGAAGAGGG - Intronic
1018361483 6:163074880-163074902 CTGGAGTGGGAGGCTGAGGTGGG + Intronic
1018617156 6:165697769-165697791 CTGGAGATGGATGATGGTGATGG + Intronic
1018655690 6:166033805-166033827 CTGCAGAGAGAGGTTTAAGAGGG + Intergenic
1018719677 6:166563225-166563247 CTGGAGAAGGAAGATGGAGAAGG + Intronic
1018729634 6:166638973-166638995 ATGAAGAGGGAGGAAGAAGAGGG + Intronic
1018834618 6:167473589-167473611 GAGGGGAGGGAGGATGATGAGGG + Intergenic
1018945398 6:168344394-168344416 TTGGAGACGGAGGAAGAAGATGG - Intergenic
1019159136 6:170057742-170057764 GAGGGGAGGGAGGAAGAAGAGGG - Intergenic
1019237564 6:170632323-170632345 CTAGAGAAGGAGGATGCAGCAGG + Intergenic
1019247755 6:170720480-170720502 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1019247770 6:170720529-170720551 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1019327636 7:446116-446138 ATGGAGAGGGAGGAAGAAGAGGG + Intergenic
1019416957 7:932256-932278 CTGGAGAGGAAGGCTGGGGAGGG - Intronic
1019483570 7:1277265-1277287 AGGGAGAGGGAGGAGGGAGAAGG - Intergenic
1019633040 7:2059640-2059662 CTGGAGAGGGAGCATGGCCAGGG + Intronic
1019728513 7:2616811-2616833 CTGGATGGGGAAGAGGAAGAGGG - Intergenic
1020171770 7:5850605-5850627 CTGGAGATGGATGATGGTGATGG + Intergenic
1020787116 7:12587348-12587370 GTGGGGAGTGAGGATGAGGATGG + Intronic
1020871610 7:13637512-13637534 CTGGATGGGGAGTATGAAGTAGG - Intergenic
1020996082 7:15266283-15266305 CTGGAGATGGACGGTGAAGATGG + Intronic
1021506155 7:21387496-21387518 CTGGAGCGGGGAGATAAAGAAGG + Intergenic
1021874326 7:25034479-25034501 CTGGAGATGGATGGTGATGATGG - Intergenic
1021886929 7:25148338-25148360 CTGAAGCAGGAGGATGCAGAAGG + Intronic
1022446287 7:30473267-30473289 AAGGAGAGGGAGGATGAGTAAGG + Intronic
1022470179 7:30677159-30677181 ATGGAGTCGGGGGATGAAGAAGG + Intronic
1022855397 7:34309254-34309276 CTGGAGGGGAAGCATGCAGACGG + Intergenic
1022972584 7:35531045-35531067 CAGGAGATGGGGGATCAAGAAGG + Intergenic
1023350230 7:39313176-39313198 CTGGAGAGTGTGGGTCAAGAGGG - Intronic
1023356476 7:39372025-39372047 CTTGGGAGGGAGGCTGAAGCAGG - Intronic
1023532738 7:41175397-41175419 CAAGAGAGGGAGGAAGAAGCTGG - Intergenic
1023643719 7:42287629-42287651 CAGAAGAGGGAGAATAAAGATGG - Intergenic
1023754387 7:43402360-43402382 TGGGAGAGGGAGCATGCAGACGG - Intronic
1023776456 7:43612290-43612312 CTGGAGGGAGAGGATAGAGATGG + Intronic
1023809690 7:43902162-43902184 GTGGAGAGGGAGGAGGAGGGGGG + Intronic
1024149657 7:46558079-46558101 CAGGAGAGTGAGGATGTAGTTGG + Intergenic
1024157237 7:46638189-46638211 CTGGAGAGGGGCTATGAGGATGG - Intergenic
1024357779 7:48433606-48433628 CTGGAAATGGATGATGATGATGG - Intronic
1024813161 7:53236759-53236781 CTGGAGAAGGAAGATAGAGAAGG - Intergenic
1025909142 7:65813500-65813522 CTGAAGTGGGAGGATGAAAGTGG - Intergenic
1026679851 7:72457602-72457624 TGGGAGAAGGAGGAGGAAGAGGG - Intergenic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1026941176 7:74289022-74289044 CTGGACAGAAAGGATGAGGAGGG - Intergenic
1026974757 7:74490492-74490514 CTAGAGAGGGAGTATTCAGAGGG + Intronic
1027144327 7:75683526-75683548 CTGGAGGGGCAGGAGGAAGCTGG + Intronic
1027367396 7:77472743-77472765 AAGGAGAGGAAGGATTAAGAGGG + Intergenic
1027585177 7:80048908-80048930 CAGGAGGGGGAGCATGCAGACGG + Intergenic
1027669507 7:81078151-81078173 CTGGAAAGGGACGATGGAGTGGG + Intergenic
1028134246 7:87209345-87209367 GTTGAGAGGGGGGAAGAAGAGGG + Intronic
1028732712 7:94170399-94170421 TTAGAGAGGGAGGAGGAAGGTGG - Intergenic
1028828739 7:95304061-95304083 CTGGAGAGGGATGGTGATGATGG - Intronic
1028894058 7:96021078-96021100 CTGGAGATGGATGATGGTGATGG + Intronic
1028921374 7:96314101-96314123 AAGGAGAAGGAGGAGGAAGAAGG + Intronic
1029103373 7:98153051-98153073 CAGGAGAGGCAGGAGGAAGTCGG + Intronic
1029120821 7:98266856-98266878 CTGGAGACGGAGGCTGCAGGAGG + Intronic
1029423678 7:100484153-100484175 ATGGAGAAGGGGGATGAAGCAGG + Intronic
1029450832 7:100641140-100641162 CTGGAGGAGGAAGAGGAAGACGG - Exonic
1029479081 7:100802203-100802225 CTGGAGAGGGAGGCTGGGGCAGG - Intergenic
1029821255 7:103149553-103149575 CTGGAGAGGCAGCCTGAAGGAGG - Intronic
1029914074 7:104188875-104188897 CAGGAGAGAGAGCATGAAGGGGG - Intronic
1031165927 7:118226636-118226658 ATGGAGGAGGAGGAAGAAGAGGG + Intronic
1031427308 7:121621357-121621379 GTGCAGAGGGAGGACGGAGATGG - Intergenic
1031630569 7:124038301-124038323 TTGGAGAGGGAGGGTGAAGTTGG + Intergenic
1031675735 7:124610023-124610045 CTGAAGAGGGAGGGTGTCGAGGG + Intergenic
1031813460 7:126401992-126402014 CTAGAGAAGGATGAAGAAGAGGG - Intergenic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032169982 7:129576671-129576693 CTGGTGAGGGATGATGGTGATGG + Intergenic
1032206377 7:129869524-129869546 CTTGAGAGTGAGGATGGTGATGG - Intronic
1032255059 7:130290513-130290535 CTGGAGATGGATGATGGTGATGG - Intergenic
1032504551 7:132425513-132425535 CTGATGAGGGAGGGTGAGGAAGG - Intronic
1032510929 7:132471713-132471735 TTGGAGTGGGAGGAGGAGGAGGG + Intronic
1032565615 7:132939687-132939709 TTGGAAAGGAAGAATGAAGAGGG + Intronic
1032669383 7:134069354-134069376 GAGAAGAGGGAGGAGGAAGAAGG - Intergenic
1032834826 7:135662748-135662770 CTGGGGAGGCAGGAAGAAAACGG - Intronic
1033156924 7:138965070-138965092 CTGCTGAAGGAGGCTGAAGAGGG - Intronic
1033263581 7:139865566-139865588 AGGGGGAGGGAGGAAGAAGAAGG + Intronic
1033527684 7:142232601-142232623 CCAGAGAGGGGGGATGGAGAGGG + Intergenic
1033536812 7:142320363-142320385 CCGAAGAGGGAGAATGAAGATGG + Intergenic
1033707839 7:143905863-143905885 CTGGAAAGGATGGATGGAGAGGG + Intergenic
1034270007 7:149798814-149798836 CTGGAGAGGAAGGAGGGTGAGGG + Intergenic
1034271145 7:149803916-149803938 CAGGGGATGAAGGATGAAGAAGG + Intergenic
1034455024 7:151165376-151165398 CTGAAGAGAGAGGATGGAGGGGG - Intronic
1035224563 7:157426171-157426193 CTGGAGATGGATGATGGTGATGG + Intergenic
1035500348 8:87334-87356 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035500366 8:87407-87429 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035500381 8:87456-87478 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035510203 8:174288-174310 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
1035583298 8:753610-753632 ATGGAGAGGGAGGAAGTAGTTGG + Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036552105 8:9825035-9825057 CTGGAGATGGATGGTGATGACGG + Intergenic
1036814039 8:11887982-11888004 CTGGAGATGGATGGTGGAGATGG + Intergenic
1036836018 8:12068196-12068218 CTGGGGAGGGAGGAGGAAATAGG - Intronic
1036857861 8:12314766-12314788 CTGGGGAGGGAGGAGGAAATAGG - Intergenic
1037115522 8:15221313-15221335 GGGGAGTGGGAGGTTGAAGAGGG + Intronic
1037300254 8:17444021-17444043 GAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1037524820 8:19714452-19714474 CTGGAGAGAGAGAATAGAGATGG - Intronic
1037683694 8:21119621-21119643 CTGTGGAAGGAGGATGAAGTTGG + Intergenic
1037739210 8:21591932-21591954 CTGGAGATAGAGGAAGAACAGGG + Intergenic
1038161964 8:25048158-25048180 ATAGAGAGGGAACATGAAGATGG + Intergenic
1038229996 8:25690939-25690961 GAGGAGAGGGATGATGGAGAGGG - Intergenic
1038525672 8:28271071-28271093 CTAGAGAGGGAGGAAGGAGGTGG - Intergenic
1038526449 8:28278130-28278152 CTGGAGAAGGATCATGATGATGG + Intergenic
1038785620 8:30612636-30612658 CAGGAGAGGGAGGCTGAGGCAGG - Intronic
1038860898 8:31387990-31388012 GGGGAGAGGGAGGAAGAAGAGGG - Intergenic
1039048092 8:33468293-33468315 AGGGAGAGGGAGGAGGAGGAGGG - Intronic
1039317344 8:36387998-36388020 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1039555256 8:38470524-38470546 CTGGAGGTGGAGGCTGAAGAAGG + Intergenic
1040774690 8:51027714-51027736 CTGTTGAGGGAGGGTGGAGAGGG - Intergenic
1040869696 8:52087971-52087993 ATGTAGACAGAGGATGAAGATGG - Intergenic
1041410069 8:57543754-57543776 CTGGAGCTGGAGGGTGGAGATGG + Intergenic
1041438234 8:57865025-57865047 CTGGAGAAGGATGATGGTGATGG - Intergenic
1041755134 8:61305312-61305334 GTGGGAAGGGAGGATGAAGGGGG - Intronic
1041927842 8:63254427-63254449 ATGGAGAGGTATGATGAATATGG - Intergenic
1042722116 8:71837386-71837408 GTGAGGAGGGAGGATAAAGAGGG + Intronic
1042816468 8:72882956-72882978 CTGGAGAAGGCAGATAAAGAGGG - Intronic
1042984425 8:74567005-74567027 TGGGAGAGGGAGCATGCAGATGG - Intergenic
1043321673 8:78994380-78994402 CTGGAGATGGATGGTGATGATGG + Intergenic
1043436016 8:80237064-80237086 GGTGAGAGGGAGGAGGAAGAGGG + Intergenic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1043702053 8:83301103-83301125 CTGGAGAGGGAGCATGCAGATGG - Intergenic
1043950250 8:86300856-86300878 AAGGAAAGGGAGGAGGAAGAAGG + Intronic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1044767908 8:95596865-95596887 CATGAGAGGGAGGGTGGAGATGG + Intergenic
1044817183 8:96125204-96125226 CTGAAAAGGGAGGTGGAAGAGGG + Intergenic
1045323425 8:101099053-101099075 ATGGAAAGTGAGGATGGAGATGG - Intergenic
1045508476 8:102795169-102795191 CTGCACAGGGAGGAAGCAGAGGG - Intergenic
1045543688 8:103109546-103109568 CTGGGAAGGAAGGATGAAGAAGG + Intergenic
1045881516 8:107045942-107045964 TGGGGGAGGGAGGATGGAGAGGG + Intergenic
1046065096 8:109186877-109186899 CAGGAGAGGCAGAATGGAGAGGG - Intergenic
1046816090 8:118585353-118585375 CTGGAGATGGATGGTGATGATGG + Intronic
1046904989 8:119562881-119562903 CCGGTGAGGCAGGATGAAGGAGG + Exonic
1046942752 8:119946899-119946921 CTGGAGAGGGTGAGGGAAGAAGG - Intronic
1047119430 8:121884146-121884168 CTGGAGATGGAGGTTGCAGTGGG + Intergenic
1047309887 8:123683107-123683129 CTGGAGAGAAAGGAGGGAGAGGG + Intronic
1048290488 8:133177697-133177719 GAGGAGAGGGAGGATGAAGAAGG - Intergenic
1048292817 8:133193358-133193380 CTGCAGTGGAAGGAGGAAGATGG + Intronic
1048881646 8:138876996-138877018 CAGGACAGGAAGGATGAAGTGGG - Intronic
1048886739 8:138915043-138915065 CCGGAGAGGGAGGAAGCAGCTGG - Intergenic
1049035616 8:140073751-140073773 CTGGGTAGGGATGATAAAGATGG + Intronic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049148338 8:141018424-141018446 CAGGAAAGTGAGGCTGAAGAGGG - Intergenic
1049195473 8:141313308-141313330 CTGAAGAGGGAGGAAAGAGAGGG + Intergenic
1049408134 8:142460727-142460749 CTGGAGAGGGAGGAGGGAGGAGG - Intronic
1049528763 8:143142901-143142923 CTGGGGAGGGAGGAGGGACAGGG - Intergenic
1049536033 8:143182971-143182993 CTGGAGAGGGAGGGCTGAGAAGG - Intergenic
1049733292 8:144190144-144190166 ATGCAGAGGCAGGAGGAAGATGG - Intronic
1049899828 9:148799-148821 CAGGAGAGTGAAAATGAAGAGGG + Intronic
1049939569 9:532453-532475 CTGGAGATGGATGGTGATGATGG - Intronic
1049984971 9:941600-941622 CTGGAGATGGAGGGTGGTGATGG + Intronic
1050663243 9:7906869-7906891 TGGGAGAGGAAGGATGAAGATGG - Intergenic
1050694034 9:8259696-8259718 CTGGTGAGCAAGGAAGAAGAGGG - Intergenic
1050873449 9:10605491-10605513 CTGGAGTGAGAAGATGATGAAGG + Intronic
1051071464 9:13173181-13173203 CTGGAGATGGATGGTGATGATGG + Intronic
1051159762 9:14193937-14193959 ATTGAGAGAGAGGATGTAGAGGG - Intronic
1051208856 9:14720145-14720167 GTGAAGACGGAGCATGAAGATGG - Exonic
1051599151 9:18854742-18854764 CTGGAGAGGGTGGAAGAACATGG + Intronic
1051974587 9:22934091-22934113 CTGAAGTGGGGGGATGAGGAGGG + Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052459793 9:28747615-28747637 TGGGAGAGGGAGCATGCAGACGG - Intergenic
1052689347 9:31797190-31797212 CTGGAGATGGATGATGATCACGG + Intergenic
1053067354 9:35078078-35078100 CTGGAGAGAAAGGAGGAGGAAGG + Intronic
1053316918 9:37059760-37059782 TCAGAGAGGTAGGATGAAGACGG + Intergenic
1055559529 9:77509024-77509046 CTGGAGAGGGATGGTGGTGATGG - Intronic
1055933640 9:81585070-81585092 CTCTACAGTGAGGATGAAGAGGG - Intronic
1056309180 9:85322078-85322100 CTGAAGAGTGTGGATGACGATGG + Intergenic
1056318517 9:85414919-85414941 CTTGAGAGAGAGGAAGGAGAAGG + Intergenic
1056506929 9:87266240-87266262 CTTGAGAGGAAGGCTGAAGAAGG - Intergenic
1056723931 9:89095518-89095540 CTGGAGATGGAGGGTGGTGATGG + Intronic
1056773152 9:89494277-89494299 GAGGAGAGGGAAGAGGAAGAGGG - Intronic
1056847971 9:90056842-90056864 CTGGAGTGGGAGGAGGAGAATGG + Intergenic
1056870108 9:90269259-90269281 TGGGAGAGGGAGGAGGAACAAGG - Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057226666 9:93296479-93296501 ATGGAGGGGGAGGAGGGAGAAGG - Intronic
1057226777 9:93296826-93296848 ATGGAGGGGGAGGAAGATGAGGG - Intronic
1057623668 9:96658445-96658467 CTGGAGATGGATGATGGAGCAGG - Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058691893 9:107526994-107527016 CTGGAGATGGATGGTGATGATGG - Intergenic
1058951617 9:109909249-109909271 CTGAAGCAGGAGGATGCAGAAGG - Intronic
1058961127 9:109993894-109993916 CTTGAGGGAGAGGAGGAAGAGGG - Intronic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1059160674 9:112032099-112032121 AAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1059249120 9:112872447-112872469 CTGGTGAGAGAGGAGGAAGAGGG + Exonic
1059456619 9:114403867-114403889 CAGGAGGAGGAGGATGCAGAGGG - Intronic
1059496958 9:114717938-114717960 GGGCAGAGGTAGGATGAAGATGG - Intergenic
1059528512 9:115015189-115015211 CTAGGGAGGGAGGAGGATGAGGG + Intergenic
1059550621 9:115225359-115225381 GGGGATAGGGAGGATGAGGAAGG + Intronic
1059923245 9:119180883-119180905 CTGGAGAGGGCAGAGGAAGATGG + Intronic
1060036640 9:120261534-120261556 CTGGAGAGGGAGAAGGCAGAGGG + Intergenic
1060100436 9:120835933-120835955 CTGGAGATGGACGATGGTGATGG - Intronic
1060230484 9:121821857-121821879 CTGGTCAGGGAGGCTAAAGATGG + Intergenic
1060239327 9:121889453-121889475 CTGGAGATGGAAGGTGATGATGG - Intronic
1060252162 9:121995188-121995210 CAGGATAGAGAGGAAGAAGAGGG + Intronic
1060469037 9:123931883-123931905 TTGGAGAGGGAGGTAGAAGGTGG + Intergenic
1060826957 9:126693141-126693163 GTGAAGAGCGAGGATGAAGATGG + Exonic
1061179315 9:129014437-129014459 CTGCAAAGCGAGGCTGAAGAAGG - Exonic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061646265 9:132004605-132004627 CTGCAGAGTGAGGATGGATAGGG - Intronic
1061984496 9:134122049-134122071 CAGGAGAGGGAGGTTGCAGTGGG + Intergenic
1062068151 9:134540001-134540023 CTGGGTAGGGAGGTGGAAGAGGG - Intergenic
1062349062 9:136130275-136130297 CAAGAGAGGCAGGATGAATAAGG - Intergenic
1062445971 9:136594926-136594948 CTGGAGATGGAGGGTGGTGAAGG + Intergenic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062757718 9:138312313-138312335 CTAGAGAAGGAGGATGCAGCAGG + Intergenic
1203608526 Un_KI270748v1:75960-75982 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1203608542 Un_KI270748v1:76009-76031 GTGGAGAGGGAGAAAGGAGAGGG + Intergenic
1185485974 X:481955-481977 AAGGAGAGGGAGGAAGGAGAGGG + Intergenic
1185603690 X:1355226-1355248 GTGGAGGGGGAGGAGGAAGGAGG + Intronic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1186038878 X:5454689-5454711 CTGGAGTTGGAGGGTGATGATGG - Intergenic
1186175588 X:6922885-6922907 ATGTAGCTGGAGGATGAAGAGGG - Intergenic
1186579195 X:10799132-10799154 CAGGTGAGGGGGGATGAAAAAGG - Intronic
1186646861 X:11516333-11516355 CTGGAGATAGACGATGATGATGG - Intronic
1186670223 X:11759313-11759335 CTGGAGGGCGAGGAGAAAGAGGG - Intronic
1186806342 X:13143772-13143794 CTGTACAGGGAGAATGATGAGGG + Intergenic
1187207278 X:17195145-17195167 CTGAAGAGAGAGCATGAAGAAGG - Intergenic
1187671269 X:21668096-21668118 CTGGAGATGGATGATGGTGATGG - Intergenic
1188005850 X:25015428-25015450 TTGGAGAGGAAGGAAGGAGAGGG - Intronic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1189636177 X:43012145-43012167 CTGGAGAGTGGGGATTAAGGTGG + Intergenic
1189832695 X:44990474-44990496 CTGGAGGTGGAGGATGCAGTGGG + Intronic
1189935052 X:46058753-46058775 CCCAAGATGGAGGATGAAGAAGG - Intergenic
1190029016 X:46953909-46953931 CAGGAGAGGGAGGAGGAGAAAGG - Intronic
1190516942 X:51233672-51233694 CTAGAAAGGGAGTTTGAAGAGGG - Intergenic
1191051853 X:56202096-56202118 CCAGAGAGTGAGTATGAAGAAGG + Intergenic
1191608231 X:63084223-63084245 TTTGAGTGGGAGAATGAAGAAGG + Intergenic
1192001292 X:67154678-67154700 CAGGAGGGGGAATATGAAGATGG + Intergenic
1192050776 X:67722072-67722094 ATGGGGAGGGGGAATGAAGAAGG - Intronic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1192328134 X:70150857-70150879 TTGGAAGGGGAAGATGAAGAGGG + Intronic
1192500315 X:71645868-71645890 TGGGAGAGGGAGGAGGGAGATGG + Intergenic
1192503002 X:71665503-71665525 GAGGAGGAGGAGGATGAAGAGGG + Intergenic
1192639059 X:72846070-72846092 TGGGAGATGGAGGAGGAAGAGGG + Intronic
1192642653 X:72874738-72874760 TGGGAGATGGAGGAGGAAGAGGG - Intronic
1193551256 X:82895695-82895717 CTGGAGAGACATGATCAAGATGG + Intergenic
1194049027 X:89045301-89045323 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1194314674 X:92361743-92361765 CTGGAGATGGATGATGGTGATGG - Intronic
1194804925 X:98315318-98315340 CTGGAGAGGGAGGATTGGGGTGG + Intergenic
1195007873 X:100704482-100704504 CTGAGCAGAGAGGATGAAGAAGG + Intronic
1195068002 X:101254792-101254814 CAGGAGAGGGAGGAGGAAACAGG + Intronic
1195266318 X:103183568-103183590 CTGGAAGGAGAGCATGAAGATGG + Intergenic
1195379347 X:104256050-104256072 AGGGAGGGGGAGGAGGAAGAAGG - Intergenic
1195707241 X:107746482-107746504 CTGGAGAGTCAGGATGACCAAGG - Intronic
1195756561 X:108204616-108204638 CTGCAGAGGGAAGAGCAAGATGG + Intronic
1195997829 X:110748869-110748891 CTGGAGATGGATGGTGGAGATGG + Intronic
1196164083 X:112519271-112519293 GTGGAAAGTCAGGATGAAGAGGG - Intergenic
1196383956 X:115127641-115127663 CTTGGGGGGGATGATGAAGATGG + Intronic
1196490820 X:116263905-116263927 CTGGAGATGGATGGTGGAGATGG - Intergenic
1196577377 X:117335179-117335201 TTGCAGAGGGAGGAGGGAGAAGG - Intergenic
1197366644 X:125572132-125572154 CAGGAAAGGGAGAATGAAGGGGG + Intergenic
1197639443 X:128951843-128951865 CTGGGGAGGGAGTGTGAAGGTGG - Intergenic
1197903777 X:131401367-131401389 TGGGAGAGGGAGGAGGAAGATGG + Intergenic
1198112407 X:133513514-133513536 CTGGAAAGGGAGGAGGAAGGAGG + Intergenic
1198312120 X:135434017-135434039 CTGGAGACAGAGGATGGAGAGGG + Intergenic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1198410577 X:136363022-136363044 CAGGGGAGGGTGGATGATGAGGG + Intronic
1198479792 X:137030929-137030951 GTGGAGAATGAGGATGAAGAGGG - Exonic
1199583992 X:149393389-149393411 CTGGAGATGGATGATGGTGATGG + Intergenic
1200622729 Y:5473260-5473282 CTGGAGATGGATGATGGTGATGG - Intronic
1200909003 Y:8514575-8514597 ATGGAGAGGGAGGAGGAAAAGGG - Intergenic
1201146281 Y:11067075-11067097 AAGGAGAGGGAGGGAGAAGAAGG + Intergenic
1201146383 Y:11067389-11067411 AGGGAGAGGGAGGGAGAAGAAGG + Intergenic
1201516497 Y:14824082-14824104 GTGGAGAGAGAGAATGAAGAAGG + Intronic
1201540079 Y:15096555-15096577 ATGGAGAGGGAGGGAGAAGAAGG - Intergenic
1201902088 Y:19053831-19053853 CTGGAGAGGGATGTTGGTGATGG + Intergenic
1202107358 Y:21385103-21385125 CGGCAGAGGGAGGAGGAAAAGGG + Intronic