ID: 901189806

View in Genome Browser
Species Human (GRCh38)
Location 1:7402888-7402910
Sequence CCTTTTCCACAGCAGGAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901189800_901189806 7 Left 901189800 1:7402858-7402880 CCCTGCTGAGAGTAAGAAGTGTT 0: 1
1: 0
2: 1
3: 20
4: 156
Right 901189806 1:7402888-7402910 CCTTTTCCACAGCAGGAATGGGG 0: 1
1: 0
2: 2
3: 33
4: 241
901189801_901189806 6 Left 901189801 1:7402859-7402881 CCTGCTGAGAGTAAGAAGTGTTC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 901189806 1:7402888-7402910 CCTTTTCCACAGCAGGAATGGGG 0: 1
1: 0
2: 2
3: 33
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901189806 Original CRISPR CCTTTTCCACAGCAGGAATG GGG Intronic
900602993 1:3511163-3511185 CCTTGTCCACAGCAGACAGGCGG - Intronic
901039560 1:6355824-6355846 CCTGTTCCGCAGCGGGAGTGAGG + Intronic
901189806 1:7402888-7402910 CCTTTTCCACAGCAGGAATGGGG + Intronic
903238986 1:21969925-21969947 CCTTTTCTTCATCTGGAATGTGG + Intergenic
903537804 1:24078592-24078614 GCTTTTCCCCAGCAGGCAGGAGG - Intronic
904276903 1:29390810-29390832 CCAGTTCCTCAGCAGGAAGGAGG - Intergenic
905302705 1:36996687-36996709 GCTGTTCCCCACCAGGAATGAGG - Intronic
905459883 1:38115682-38115704 CCTTTTCCTCTCCAGGAAGGTGG + Intergenic
906540976 1:46585761-46585783 TCTTTACCACAGCAGGGCTGAGG + Intronic
906666281 1:47624390-47624412 CCTTTCCCACCGCAGGCCTGGGG - Intergenic
907308917 1:53528400-53528422 CCCTGTCCACAGCAGGTGTGTGG - Intronic
907399091 1:54213401-54213423 TCTTTTCTAGAGGAGGAATGAGG + Intronic
907655125 1:56334308-56334330 CATTATCCAAAGAAGGAATGAGG - Intergenic
908458380 1:64326212-64326234 GCTGCTCCACACCAGGAATGTGG + Intergenic
913213861 1:116603735-116603757 CATCTTCAACAGCAGGAAGGAGG - Exonic
915253770 1:154609597-154609619 CCTTCCCCACAGCAGGTAGGGGG + Intronic
916216094 1:162396547-162396569 TCATTTCAACAGCATGAATGTGG - Exonic
916665169 1:166960156-166960178 CCTTTTCCCCAACAGGAATTAGG - Intronic
916954038 1:169812899-169812921 CATTTTCCTCAGCAGAAATAGGG - Intronic
920776111 1:208938779-208938801 CCTTTTCCAGAGTTGGCATGGGG - Intergenic
920865022 1:209744633-209744655 ACTGTTCCACTCCAGGAATGGGG - Intergenic
922338732 1:224638557-224638579 CCTTTTACAGAGCAGGAAACTGG - Intronic
923268765 1:232336001-232336023 CCTTCTCCCCAGCAGGCCTGGGG + Intergenic
923784055 1:237050840-237050862 TCTTTTCCACAGCAGGTTTCTGG + Intronic
924609822 1:245564367-245564389 CCTTTCCCGGAGCAGGAACGGGG + Intronic
1063435045 10:6022584-6022606 CCTCTTCCCCAGCAGGAAGCTGG + Intronic
1064814339 10:19241101-19241123 ACTTTTCCACAAAAGTAATGAGG - Intronic
1065925577 10:30432182-30432204 CATTTTCCATAGCAGAAATGTGG + Intergenic
1067211134 10:44261121-44261143 CCTGTTCCATAGCAGTGATGAGG + Intergenic
1067448385 10:46366895-46366917 CCTTCTCCCCAGCAGGCATTTGG + Intergenic
1067588990 10:47493871-47493893 CCTTCTCCCCAGCAGGCATTTGG - Intergenic
1067636115 10:48001962-48001984 CCTTCTCCCCAGCAGGCATTTGG - Intergenic
1068590978 10:58852792-58852814 CATTTTCCACAGCAGGCTGGAGG - Intergenic
1069624355 10:69858513-69858535 CCTTTTACTTAGAAGGAATGGGG - Intronic
1070025412 10:72627033-72627055 CTATTTCCACAGCAGGGGTGAGG - Intergenic
1070132675 10:73665967-73665989 CCTTCTCCCCAGCAGGCATTTGG - Intergenic
1071609009 10:87018107-87018129 CCTTCTCCCCAGCAGGCATTTGG + Intergenic
1071813139 10:89205315-89205337 CCTTTTCCACATGAGGAATCAGG + Intergenic
1072565544 10:96613915-96613937 CATTTTGCAAAGCAGGACTGAGG + Intronic
1073180247 10:101579105-101579127 CCTTTCCCATAGCAGGGAAGGGG + Exonic
1074155859 10:110798806-110798828 CCTTTTCCCCTGCAGCATTGAGG + Intronic
1074163189 10:110851224-110851246 CCTTTTCCAAAGCTGGCATTAGG - Intergenic
1074413429 10:113247004-113247026 TATTTTCTACAGCAGGAAAGTGG - Intergenic
1074882129 10:117667561-117667583 TCTTGTCAACACCAGGAATGGGG + Intergenic
1076272101 10:129162794-129162816 CCTTTTCCACAACACGAATTGGG + Intergenic
1077615263 11:3669531-3669553 CTGTTTCCTCAGCAGGAATATGG + Intronic
1078454570 11:11465188-11465210 CCCTGACCTCAGCAGGAATGGGG - Intronic
1079381347 11:19940670-19940692 CCAATTCCACAGCTGTAATGTGG - Intronic
1079399905 11:20098378-20098400 CCTTTTTAACAGCAGGAGTTAGG - Intronic
1080271487 11:30455273-30455295 CCAGTGCCTCAGCAGGAATGGGG - Intronic
1081285276 11:41261209-41261231 CCTTTTCCACCGCAGCAACAAGG + Intronic
1081735019 11:45396644-45396666 CTTTATCCAGAGCAGCAATGTGG - Intergenic
1083836390 11:65271516-65271538 GTATTTCCATAGCAGGAATGGGG - Intronic
1086310319 11:85529162-85529184 CATTTCTCAAAGCAGGAATGAGG - Intronic
1086780461 11:90898097-90898119 CCATTTCTACAGTAGGACTGGGG - Intergenic
1086896941 11:92324147-92324169 CCTTTTCCATATCAGCAATAAGG + Intergenic
1088383465 11:109222488-109222510 CACTCTCCACAGCATGAATGGGG - Intergenic
1088399983 11:109412798-109412820 TCTTATCCACACCAGTAATGGGG - Intergenic
1088638146 11:111844484-111844506 CCATTTCCATAGGAAGAATGTGG + Intronic
1089709110 11:120302306-120302328 CCCTTTCCACAGCAACAAAGCGG + Exonic
1092094437 12:5829567-5829589 AAGTTTCCACAGGAGGAATGAGG - Intronic
1093073395 12:14731707-14731729 ACTCTTACACAGCAGGAATGAGG - Intergenic
1093398122 12:18708315-18708337 CATTTACCACAGCATGAGTGAGG - Intronic
1096354002 12:50924793-50924815 GCTTTTCCTCAGAAGGAAAGTGG - Exonic
1096542100 12:52313682-52313704 CCTTCTCCACAGCTGACATGAGG - Intergenic
1097342089 12:58450490-58450512 CCTTCTCCCCAGCAGTGATGAGG + Intergenic
1100008441 12:89922898-89922920 ACTTTCCCAAAGAAGGAATGAGG - Intergenic
1103852984 12:123945501-123945523 CCCTTTCCACAGCAAGCACGCGG - Intronic
1105217091 13:18294286-18294308 CATCTTCAACAGCAGGAAGGAGG - Intergenic
1105356149 13:19661817-19661839 CCTTCTCTGCAGCATGAATGAGG - Exonic
1105503137 13:20989297-20989319 TTTTTTCCACTGCAGGAAAGGGG - Exonic
1106769690 13:32949977-32949999 CTTTTTCCCCAGCAGCAGTGAGG + Intergenic
1106780024 13:33049908-33049930 CCTGTTTTACAGCAGGATTGTGG - Intronic
1112360156 13:98709983-98710005 TCTTTTCCAAATCAGGAATGAGG + Intronic
1112763702 13:102718599-102718621 CTGTTTCCACAGCAAGAAGGGGG - Intergenic
1112943529 13:104895706-104895728 CCCTTTCCACAGCTGGGATAAGG - Intergenic
1115119676 14:29925927-29925949 CCTTTTCCACATCAGTATTGTGG - Intronic
1116854540 14:49939970-49939992 CCTTCTCCATAGTTGGAATGAGG - Intergenic
1118469196 14:66058959-66058981 CCTTTTCCTCTGCAGGACTGTGG + Intergenic
1118634960 14:67739962-67739984 CACATTCCACTGCAGGAATGGGG + Intronic
1119948510 14:78719903-78719925 CATTTACCAAAACAGGAATGAGG - Intronic
1121832277 14:97062770-97062792 CCTTATTCAGAGAAGGAATGTGG + Intergenic
1122071056 14:99205581-99205603 CCTTTTCCAGAGGAGGAAAAAGG + Intronic
1122318448 14:100839367-100839389 CCTCTTCCAAAGGAGGAATAAGG + Intergenic
1122785795 14:104162785-104162807 CCATTTCCAGAGGAGGAAAGGGG + Intronic
1124013583 15:25859036-25859058 CCTCTTCCACAGCAGGGGTGAGG - Intronic
1124157718 15:27242126-27242148 CATTTCAAACAGCAGGAATGAGG + Intronic
1124434566 15:29636232-29636254 CCTCGTCCACAGCAGGCATGAGG - Intergenic
1125128744 15:36256489-36256511 CTTTCTCCATAGCAGGAAGGAGG + Intergenic
1125507322 15:40274310-40274332 CCCTTGCCTCAGGAGGAATGGGG - Intronic
1125671855 15:41479444-41479466 CATTTTACACAGCAGAAAAGGGG - Intronic
1126479346 15:49100449-49100471 CCTTTTCTATAACAGAAATGTGG - Intergenic
1126974279 15:54157197-54157219 TCTTTTCCTCAGAAGCAATGTGG - Intronic
1130141257 15:81228186-81228208 CCTATTCCACAGCAGGAGGCTGG + Intronic
1130672009 15:85920976-85920998 CCTTGTGCACAGCAAGCATGTGG - Intergenic
1130814047 15:87411822-87411844 CCTTGACCACAGCCAGAATGAGG + Intergenic
1131667191 15:94583036-94583058 CCATTTGCACAGCTGGAAAGTGG - Intergenic
1133045498 16:3086437-3086459 GCTTTTCCACATCTGGAATGTGG - Intergenic
1142162668 16:88566886-88566908 CCTCTTCCAGAGCAGGAAGTGGG - Intergenic
1143256117 17:5559279-5559301 CCTGCTCCAAAGAAGGAATGAGG + Exonic
1143468452 17:7155022-7155044 TCTTTTCCAAAGCAGCAATTTGG - Intergenic
1143915064 17:10285545-10285567 ACTCTTCCAGAGGAGGAATGCGG - Intergenic
1144213684 17:13036087-13036109 ACTTTTCCCCAGCAGCAATGGGG - Intergenic
1144664492 17:17092674-17092696 TCCTTTCCAGAGCAGGAAAGGGG + Intronic
1146175460 17:30663527-30663549 TTTTTTCCACAGGAGGCATGAGG - Intergenic
1146348911 17:32079573-32079595 TTTTTTCCACAGGAGGCATGAGG - Intergenic
1146810381 17:35898442-35898464 CCTTTACCACATCAGGGAAGTGG + Intergenic
1147610886 17:41801290-41801312 CCTATTCCACAGCAGGGAGGTGG - Intergenic
1148966391 17:51439552-51439574 CCTTCCCCACTGCAGCAATGAGG - Intergenic
1151506094 17:74528245-74528267 ATTTTTCCACATCAGGAGTGGGG - Intronic
1151575678 17:74951626-74951648 CCATTTCCTCCACAGGAATGTGG - Exonic
1153406470 18:4746439-4746461 CTTTCTCCACAGCAGCAATAAGG + Intergenic
1156129616 18:33954844-33954866 CCTTTTCCACTTCAGGGATCTGG - Intronic
1156269271 18:35516064-35516086 ATTTTCCCTCAGCAGGAATGTGG - Intergenic
1157595024 18:48859199-48859221 CCTGTGCCACAGCTGGAATGAGG - Intronic
1157812440 18:50707055-50707077 ACTTTTAAACAGCAGGAAAGTGG - Intronic
1158176137 18:54658299-54658321 AATTTGCCACAGCAGCAATGAGG - Intergenic
1158568325 18:58574685-58574707 ATTTTTCCACAGCCGGAACGGGG - Intronic
1159411699 18:68085152-68085174 CCTTTTCTACAAAAGGGATGTGG + Intergenic
1162384111 19:10351001-10351023 CCCTCTCCACAGCAGGATAGTGG + Intronic
1162796480 19:13089994-13090016 CCTTTTTCACAGCTGGGATGAGG - Intronic
1162983510 19:14254384-14254406 TTTTTTCCACAGGAGGCATGAGG + Intergenic
1164399043 19:27890333-27890355 CTGTGTCCCCAGCAGGAATGAGG + Intergenic
1166660430 19:44643714-44643736 CCGTTTCCTCACCTGGAATGTGG + Intergenic
1167691893 19:50990441-50990463 CCCATTCCACAGCAGCAATCTGG + Intergenic
1167940633 19:52943074-52943096 GCTTAAACACAGCAGGAATGCGG + Intronic
925329207 2:3045101-3045123 CCTTTACCCCAGCAGGAAGGGGG + Intergenic
926443756 2:12919333-12919355 CCTTTTCCAAAGCACAAATTTGG + Intergenic
926626048 2:15090735-15090757 GCTTTTCCAAATAAGGAATGGGG - Intergenic
927487844 2:23501281-23501303 CCTATTCCAAAGCAGGAATAGGG - Intronic
932850113 2:75176622-75176644 GCTGTTCCACAGCAGGACTTTGG + Intronic
933624919 2:84587582-84587604 TCTCTGCAACAGCAGGAATGAGG - Intronic
934297233 2:91752396-91752418 CATCTTCAACAGCAGGAAGGAGG + Intergenic
937055937 2:118936871-118936893 TCTTTTCCAGAGCAGGTTTGGGG - Intergenic
937683628 2:124671075-124671097 GCTTTTACACAGGAAGAATGAGG - Intronic
937883757 2:126886559-126886581 CCTCTTCCCCAGAAGGAACGGGG + Intergenic
938066172 2:128283131-128283153 CTTTTTCAACTGCAGGAAAGTGG - Intronic
939252290 2:139697402-139697424 CCTTTTCCCCCCCCGGAATGAGG + Intergenic
939697281 2:145342474-145342496 TGTTTTCCACAGCAGGTATGTGG - Intergenic
940326234 2:152428056-152428078 CCTTTTACAAAGGGGGAATGTGG - Intronic
941501798 2:166288285-166288307 CTTTTTCCACACCAGAAATGAGG + Intronic
943030574 2:182680971-182680993 CCTTTTCCACGGCAGCAACCTGG - Intergenic
943225557 2:185169640-185169662 CCTTTGCAACAGCATGGATGGGG - Intergenic
944277179 2:197852207-197852229 CCTGTTGCACAGCTGCAATGTGG + Intronic
944510028 2:200455614-200455636 CAGCTTCCACAGTAGGAATGTGG + Intronic
946140082 2:217682687-217682709 CCGTTTCCCCAGCTGAAATGAGG - Intronic
946448870 2:219762944-219762966 CCGTTGTCACAGCAGGAAGGTGG - Intergenic
946695102 2:222348820-222348842 CCTTTTCCAGAGCAGCAGTTTGG + Intergenic
947803959 2:232951729-232951751 TCTTTTGCACAGGAGGAATGGGG - Intronic
948013227 2:234666833-234666855 TGTCTTCCACAGCAGGAAAGTGG - Intergenic
1169126692 20:3133329-3133351 CCATTTCCTCAGCAGGACTAGGG - Intronic
1169979561 20:11368219-11368241 CTTTTTCCACAGCAAGGAGGAGG - Intergenic
1170086107 20:12534011-12534033 CCTTGTCCTCACCAGTAATGAGG + Intergenic
1173263228 20:41455097-41455119 CCTTTTCCATAGCAGACATTTGG - Intronic
1173876532 20:46375847-46375869 CCTTTTCCTTAGCATGGATGTGG - Intronic
1173898137 20:46566383-46566405 CCTTTCCCTCCGCAGGAATCGGG - Exonic
1175443978 20:59007738-59007760 CCTTTTGCAGAGAAGGAAGGAGG + Intergenic
1175565878 20:59976706-59976728 CCTCCCCCACAGCAGGACTGAGG - Intronic
1175637291 20:60596493-60596515 CTTTTTCCATAGCAGGAGAGGGG - Intergenic
1179187876 21:39098514-39098536 CCTTTTCCTCCGCAGGACTTCGG - Intergenic
1179530584 21:42016102-42016124 CATTTTACACACCAGGAAAGGGG + Intergenic
1180692248 22:17727128-17727150 CCTTGTCCCCAGCAGGGAGGTGG - Exonic
1180737331 22:18027137-18027159 GCTTTTCTATAGCAGGACTGAGG - Intergenic
1182576818 22:31278497-31278519 CCCTGCTCACAGCAGGAATGGGG - Intronic
1183023347 22:35044940-35044962 CCTTTTCCAGAGGAGGAAACTGG - Intergenic
1183750085 22:39714940-39714962 CCTCTTCCACAGCAGGGAAGGGG - Intergenic
1184066397 22:42124160-42124182 CCTCCTGCTCAGCAGGAATGGGG - Intergenic
1184068865 22:42136312-42136334 CCTCCTGCTCAGCAGGAATGGGG - Intergenic
951071468 3:18333671-18333693 ACTTTTCCATGGCAGGAGTGAGG + Intronic
951608812 3:24468276-24468298 CTTTTTCCACATTAGAAATGAGG + Intronic
952540281 3:34360129-34360151 TCTTGTCTACAGCAGCAATGGGG + Intergenic
952594556 3:35000276-35000298 ACTTCTACTCAGCAGGAATGAGG + Intergenic
952609671 3:35193072-35193094 CTTTTTACACAGTAGGTATGGGG - Intergenic
953045882 3:39294040-39294062 GCTGCTCCACAGCAGAAATGTGG - Intergenic
953180422 3:40589653-40589675 CCTTTGCCATAGGAGGATTGGGG + Intergenic
953216318 3:40922258-40922280 CCTTTGCCACCTCAGGACTGGGG - Intergenic
954852778 3:53617598-53617620 CCTTTTCCTCAGCTGTAAAGTGG - Intronic
955080887 3:55656970-55656992 ACTATTCCACAGCAGGATGGTGG + Intronic
957437192 3:80193777-80193799 CTTTTTCCACATCAGCAATTGGG - Intergenic
959496172 3:107054747-107054769 CCCCTTCCACAGCAGCAATGAGG + Intergenic
962461368 3:135616452-135616474 CTTTCTCCAGACCAGGAATGAGG + Intergenic
962745806 3:138396595-138396617 ACTTTCCCTCAGCAGGAAGGAGG + Intronic
962805154 3:138921883-138921905 CCTTTTCCTCATCTGGAATGTGG + Intergenic
963346715 3:144103648-144103670 CCATGACCACAGCAGTAATGGGG - Intergenic
965622387 3:170654635-170654657 CCTCTTCCACCCCAGGAATGGGG + Intronic
966243861 3:177784302-177784324 CCTTTTCCATAAAAGGATTGGGG + Intergenic
967979402 3:195056610-195056632 CCATTTGCACAGCAGGAAGCAGG + Intergenic
968035043 3:195541367-195541389 GGTTTTCAGCAGCAGGAATGTGG - Intronic
969498527 4:7539847-7539869 GGGCTTCCACAGCAGGAATGGGG - Intronic
970407421 4:15777386-15777408 CCTGTTCCAGAGCAGCAAGGAGG - Intergenic
970669609 4:18380766-18380788 CTTTTACCTCAGCTGGAATGAGG - Intergenic
970870977 4:20816508-20816530 CCTTATCCCCAGCAGGTATCTGG + Intronic
972640849 4:40923663-40923685 CCTCTTCCCCTGAAGGAATGAGG - Intronic
973128193 4:46615212-46615234 CCTTTTCCACATCAGCAATAAGG - Intergenic
974696049 4:65373370-65373392 CCTTTTATACAGCACGAAAGTGG - Intronic
974898060 4:67963306-67963328 CCTCTTACACATCAGGAATCCGG + Intronic
977345583 4:95812250-95812272 CCTTTCCCACAGTGGGAAGGTGG - Intergenic
977865782 4:102025875-102025897 CCTTTTCCACAGAATGCCTGAGG - Intronic
979990650 4:127370945-127370967 CCTTTCCCACTGCAGGATTAAGG + Intergenic
980869242 4:138592476-138592498 CCTTTTCTAAAGCATGAAGGAGG - Intergenic
980969779 4:139557136-139557158 CCATTACCACAGCAGCAAGGAGG - Intronic
982265049 4:153530821-153530843 CCTCTGCCACATCAGGAAAGTGG - Intronic
984261808 4:177451863-177451885 CCTTTTCCCCAGCTTGAATGTGG - Intergenic
986607923 5:9540748-9540770 CTCTTTCCACAGCAGGTTTGGGG + Intronic
987833067 5:23123937-23123959 CCTATTTCACAGCAGAAATTGGG + Intergenic
988972901 5:36487675-36487697 TCCTTTCCCCAGCTGGAATGGGG - Intergenic
989398097 5:40980113-40980135 ACATTTCCACATCAGGAATGTGG - Intronic
993771768 5:91937156-91937178 CTTTCTCCACATCAGCAATGAGG + Intergenic
993816813 5:92558728-92558750 CCTCCTGCACTGCAGGAATGAGG - Intergenic
993956148 5:94235297-94235319 CCTTTTCCATATCAGCAATAAGG - Intronic
993959132 5:94275271-94275293 CATTTTCCACTGCAGGAATTGGG + Intronic
995607568 5:113873517-113873539 CCTTTTCCTCAGCAGAAAGCTGG + Intergenic
996709088 5:126526127-126526149 CCTCTTCTACAGCAGGAAGGAGG - Intergenic
1001740555 5:174049647-174049669 CTTCTACCTCAGCAGGAATGAGG + Intronic
1004343535 6:14828164-14828186 CATTTCCCACAGCAAGAAGGAGG - Intergenic
1005083515 6:21980909-21980931 CAGTTTCCAGAGCAGGAAGGAGG - Intergenic
1005083549 6:21981076-21981098 CAGTTTCCAGAGCAGGAAGGAGG - Intergenic
1006436999 6:34030921-34030943 CCCTGTACACAGCAGGAGTGGGG + Intronic
1007431269 6:41778926-41778948 GTTTCTCCAGAGCAGGAATGTGG - Intronic
1007607748 6:43128888-43128910 CCTTGTGCACAGGAGGAAAGGGG - Intronic
1010407501 6:75521483-75521505 AAGTTTCCAGAGCAGGAATGAGG - Intergenic
1011515270 6:88146414-88146436 GCTTTTTCACAGCAGGGATATGG + Intronic
1012486450 6:99726766-99726788 CATCTTCCACAGCAGTAAGGAGG + Intergenic
1012865535 6:104613955-104613977 TCTTTTCCATAGCAGCAAAGTGG - Intergenic
1014485035 6:121988116-121988138 TCTTTTCCACGGCAGGGAAGGGG - Intergenic
1015994675 6:138986228-138986250 CCTTTTCAACAGGATGAATTTGG + Intronic
1016561964 6:145406243-145406265 CATCTTCCACAACAGGAAGGTGG + Intergenic
1016903296 6:149123492-149123514 CCTTTTCCATATCAACAATGAGG - Intergenic
1016997316 6:149969769-149969791 CTTTCTCCACAGCAGGAGGGTGG + Intronic
1018225619 6:161626036-161626058 CAGTTTCCTCATCAGGAATGAGG - Intronic
1018931205 6:168241604-168241626 CCATTTCTACAGGAGGAAAGGGG - Intergenic
1021863009 7:24925848-24925870 CCTTTTCCACATCACAAATCTGG - Intronic
1022213823 7:28238024-28238046 CCAGGTCCACAGCAGGAGTGCGG - Intergenic
1022991670 7:35714668-35714690 CCGTTCCCAGAGCAGGAATGAGG + Intergenic
1024006208 7:45226227-45226249 CCTACTCCCCAGCAGGGATGGGG - Intergenic
1024271795 7:47648155-47648177 GCTCTTCCAGAGCAGGGATGGGG - Intergenic
1024315224 7:48009852-48009874 CCTGTTCCTCACCTGGAATGGGG + Intronic
1024736758 7:52313363-52313385 GCTTTTCCACAGCAGGTGTGAGG - Intergenic
1026664900 7:72333838-72333860 CAGTTTCCTCACCAGGAATGAGG + Intronic
1029306422 7:99623249-99623271 CCCTAACCTCAGCAGGAATGTGG + Intronic
1034700840 7:153094450-153094472 CATCTTCCTCAGCATGAATGGGG + Intergenic
1036662176 8:10715618-10715640 CCTCTTCCTCAGCGGGAATCGGG + Intergenic
1036793587 8:11739945-11739967 CCTCTCCCACAGAAGGACTGGGG + Intronic
1037602414 8:20408491-20408513 CCGTTTCCTCAGCAGTAAGGTGG + Intergenic
1037893830 8:22638585-22638607 CCTTTTGGACAGCAGGAATGAGG + Intronic
1039775837 8:40735859-40735881 CCTTTTCCAGAGAAAGAAAGAGG + Intronic
1040636296 8:49277553-49277575 TGTTTTCCACATCAGCAATGAGG - Intergenic
1044145074 8:88702946-88702968 CATTTTCCACAACATGGATGGGG - Intergenic
1044271305 8:90247358-90247380 CCTTTTCCCCAACAAGATTGTGG + Intergenic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1047313072 8:123708542-123708564 CCATTTCCAAAGGAGAAATGAGG - Intronic
1047502520 8:125453211-125453233 CAATTTCCACATAAGGAATGAGG - Intergenic
1047646442 8:126875231-126875253 CCTTTCCCACAGCAGGAACGGGG + Intergenic
1048806205 8:138243480-138243502 GCTTTTCCACAGAAGAAAAGAGG - Intronic
1049404864 8:142447822-142447844 CCTTTCCCCCAGGAGGAAGGAGG + Intergenic
1049738165 8:144221114-144221136 CCCTCTTCACAGCAGCAATGTGG + Intronic
1050576155 9:6997705-6997727 CATTTTACACAGGAGGAAAGAGG - Intronic
1055100968 9:72465190-72465212 CCTTATCCCCAGCAGCAATCTGG + Intergenic
1055389800 9:75808059-75808081 CATTTTCCACAGCACCTATGAGG + Intergenic
1055769008 9:79696061-79696083 GCTTTTCAGCAGCAGCAATGTGG + Intronic
1056820516 9:89838558-89838580 CATTTTCCACACCAGGAAAAGGG - Intergenic
1057793716 9:98141214-98141236 CCTCTTCTACAGCAGGACAGGGG + Intronic
1060242153 9:121913178-121913200 CATTTTCCACAGCACTAATCTGG + Intronic
1061958215 9:133974557-133974579 CCATTTCCACAGTAGGAAGGTGG - Intronic
1185529129 X:803195-803217 GCTTTTCTCCAGCAGGAAGGGGG + Intergenic
1186803946 X:13120624-13120646 CATTTTCCACTGCAGCAATTTGG - Intergenic
1187558327 X:20374322-20374344 CATTTTCAGCAGCAGGTATGAGG + Intergenic
1187817672 X:23250443-23250465 CTTGTTACACAGCAGTAATGAGG - Intergenic
1188262180 X:28034777-28034799 TCTTTTCCACAGCAGGCACCAGG + Intergenic
1188884099 X:35528780-35528802 CCATTTCCACAGTTTGAATGAGG - Intergenic
1190876238 X:54462194-54462216 CTTTTTCAGCAGGAGGAATGAGG + Intronic
1191633456 X:63350754-63350776 CCTTTTCTTCATCAGGTATGCGG + Exonic
1194002090 X:88443145-88443167 TCTTTTCAACAGAAAGAATGGGG - Intergenic
1196908538 X:120462763-120462785 GCTCTTCCACTCCAGGAATGGGG - Intronic
1198375375 X:136033621-136033643 CCTTTTCCACAGCACTGATGGGG - Intronic
1199684683 X:150255644-150255666 CTTGTTCCACAGCTGGAAGGGGG - Intergenic
1199871520 X:151902686-151902708 CCTTTTCCACAACTGGCATAGGG - Intergenic