ID: 901191235

View in Genome Browser
Species Human (GRCh38)
Location 1:7411184-7411206
Sequence GCCCCTCCAAACCACAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 140}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901191235_901191239 -3 Left 901191235 1:7411184-7411206 CCATCACTGTGGTTTGGAGGGGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 901191239 1:7411204-7411226 GGCCGCGTCGGACCCTGGGATGG 0: 1
1: 0
2: 0
3: 9
4: 103
901191235_901191244 27 Left 901191235 1:7411184-7411206 CCATCACTGTGGTTTGGAGGGGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 901191244 1:7411234-7411256 AGTCATTTCGAAGCCTCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 99
901191235_901191245 28 Left 901191235 1:7411184-7411206 CCATCACTGTGGTTTGGAGGGGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 901191245 1:7411235-7411257 GTCATTTCGAAGCCTCCCTGGGG 0: 1
1: 0
2: 1
3: 4
4: 84
901191235_901191238 -7 Left 901191235 1:7411184-7411206 CCATCACTGTGGTTTGGAGGGGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 901191238 1:7411200-7411222 GAGGGGCCGCGTCGGACCCTGGG 0: 1
1: 0
2: 1
3: 4
4: 86
901191235_901191243 26 Left 901191235 1:7411184-7411206 CCATCACTGTGGTTTGGAGGGGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 901191243 1:7411233-7411255 CAGTCATTTCGAAGCCTCCCTGG 0: 1
1: 0
2: 1
3: 2
4: 98
901191235_901191237 -8 Left 901191235 1:7411184-7411206 CCATCACTGTGGTTTGGAGGGGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 901191237 1:7411199-7411221 GGAGGGGCCGCGTCGGACCCTGG 0: 1
1: 0
2: 0
3: 20
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901191235 Original CRISPR GCCCCTCCAAACCACAGTGA TGG (reversed) Intronic
901191235 1:7411184-7411206 GCCCCTCCAAACCACAGTGATGG - Intronic
902519970 1:17010765-17010787 GCCCCTCTGATCCACAGTGCTGG - Intronic
904743299 1:32695154-32695176 GCCCCTCCAAGCCAGAGGGATGG - Exonic
908547538 1:65176560-65176582 TCCCCTCCTCACCACAGAGATGG + Intronic
910047279 1:82932863-82932885 ACCATGCCAAACCACAGTGAGGG - Intergenic
912608378 1:111016748-111016770 GCAAGTCAAAACCACAGTGAGGG - Intergenic
912712883 1:111962066-111962088 GCTCATCCAAGCCCCAGTGATGG + Intronic
913333146 1:117683845-117683867 GCCACTCCACAGCACAGTGCTGG + Intergenic
914247870 1:145899269-145899291 GTCCCTCTGAACCACACTGATGG + Exonic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
924801101 1:247330380-247330402 CCCTCTTCAAACCACATTGAAGG + Intronic
1067364492 10:45612454-45612476 GCTCTTCCAAAACACAATGATGG - Intergenic
1069373247 10:67768749-67768771 GCCCCTACATACCACAGAAAAGG + Intergenic
1071548268 10:86545251-86545273 GCCCTTCCAAACCACATGGGTGG - Intergenic
1073843698 10:107527896-107527918 GCCACTCCAATTTACAGTGACGG - Intergenic
1075645625 10:124094112-124094134 GCCCCCCCAACCCAAAGTGCTGG + Intergenic
1077167442 11:1150240-1150262 GCCCCTGGAAACCACAGCGAGGG + Intergenic
1077338359 11:2015405-2015427 GCCTCCCCAAACCACAGCCAGGG + Intergenic
1079365965 11:19810268-19810290 CCCACTCCAAAACACAATGATGG - Intronic
1081330883 11:41798528-41798550 GCACCACCAAAGCACAGTGTAGG - Intergenic
1081963851 11:47157653-47157675 GCCCCTCCTGACCATAGTGAAGG + Intronic
1084466415 11:69325645-69325667 CCCCCTCCGAACCACACCGAGGG - Intronic
1085713347 11:78850638-78850660 GTCCCTTCAAGCTACAGTGATGG - Intronic
1087153884 11:94882616-94882638 TCCCCTCCAGAACACTGTGATGG - Intergenic
1088716856 11:112556122-112556144 GCCCCTCCAGGCCACAATCAGGG + Intergenic
1088909977 11:114183469-114183491 GCTCCTCTAGCCCACAGTGATGG + Intronic
1089358175 11:117869426-117869448 GCCCCTCCAACCCTCATTCATGG + Intronic
1202821343 11_KI270721v1_random:70587-70609 GCCTCCCCAAACCACAGCCAGGG + Intergenic
1100337830 12:93648860-93648882 GCCCTTCCAAAAAAAAGTGAAGG - Intergenic
1100733290 12:97497832-97497854 ACCCCTACAAACCACAGTAGCGG - Intergenic
1101182573 12:102235392-102235414 GCCCCACTCCACCACAGTGATGG + Intergenic
1102591689 12:113960951-113960973 GCCACTCCCAGCCACAGTTAAGG + Intronic
1102825950 12:115948160-115948182 ACCCCTACAAAGCAAAGTGAGGG + Intergenic
1102973255 12:117188293-117188315 GCCTCTGCAAACCAAAGTGTTGG - Intronic
1103323341 12:120104117-120104139 GCCCCTCCACACACAAGTGAAGG + Intronic
1106425521 13:29625182-29625204 GCCCACTCAAACCACAGAGATGG - Intergenic
1106759160 13:32850742-32850764 CCCCCTCCACACCAAAGTCAAGG - Intergenic
1109369999 13:61411584-61411606 GCCTCTCCACTCCACAGTCATGG - Exonic
1111946782 13:94673993-94674015 GCCCCTCCCAGACACACTGACGG + Intergenic
1113594935 13:111524502-111524524 GCAGCTCAAAACCACAGAGATGG - Intergenic
1114193516 14:20458384-20458406 GCCCCTCCAAACCTAAGTGAGGG + Exonic
1114800276 14:25766575-25766597 TCCCCTGCAGACCACATTGAGGG - Intergenic
1119817684 14:77584953-77584975 GCCCCTGCAGACCTCAGTGCTGG + Intronic
1123177122 14:106430638-106430660 GCCCAGCAAAACTACAGTGATGG - Intergenic
1123895375 15:24823687-24823709 GCCCCCGCAAACCACACAGAAGG - Exonic
1126971334 15:54115368-54115390 GCAGCACAAAACCACAGTGAAGG - Intronic
1129604706 15:77019222-77019244 GCCCCTCCACTCCACTGTTAGGG - Intronic
1129660189 15:77549029-77549051 CCCCCTCCAAGCCTCAGTGGTGG + Intergenic
1130236032 15:82134320-82134342 GACCCTCCAGGCCACAGAGAGGG + Intronic
1130891799 15:88139698-88139720 ACCCCTCCAAACATCAGAGAGGG - Intronic
1132171411 15:99660363-99660385 GCCACTCCTAACCACAGGGGAGG - Intronic
1133644293 16:7748766-7748788 GTCTGTCTAAACCACAGTGAAGG - Intergenic
1137659858 16:50195280-50195302 CCCCCTCCAAAGCACAGCTAAGG + Intronic
1141161926 16:81635007-81635029 GCCCTTCCGAAATACAGTGAGGG - Intronic
1141804687 16:86334897-86334919 GCCCCTCAATCCCAAAGTGAGGG - Intergenic
1144621286 17:16820131-16820153 ACCCATCCTGACCACAGTGAGGG + Intergenic
1148093165 17:45034759-45034781 GCCCCTCCAACTCACCGTGCCGG + Exonic
1148129674 17:45255326-45255348 GCCCCTCCTGACCACTGTGGAGG - Exonic
1148806431 17:50266339-50266361 GCCCCTCAAAACCCCAGAGGTGG - Intergenic
1148913199 17:50954336-50954358 CACCTTCCAAACCTCAGTGACGG + Intergenic
1155680481 18:28480833-28480855 CCCCCTCCTAACCAAAGGGAAGG - Intergenic
1156936074 18:42708935-42708957 GCTCCTCCAAAGCAAAGTGTAGG + Intergenic
1157451181 18:47790333-47790355 AGCCCTCCAACCCACAGTGTGGG + Intergenic
1159913242 18:74165861-74165883 ACCCCTCCTAACCACAGCCAGGG - Intergenic
1159944807 18:74436524-74436546 ACTCCTCCAAGCCACACTGAGGG - Exonic
1160542293 18:79630743-79630765 ACCCATCAAAACCACAGCGAGGG + Intergenic
1161279435 19:3437439-3437461 GCCCCTCCCTTCCACAGTGTGGG + Intronic
1163266355 19:16224773-16224795 GGCCCTCCACTCCACTGTGACGG - Intronic
1163391822 19:17035853-17035875 GCATCTCCAAACCCCAGAGAGGG - Intergenic
1166420652 19:42633567-42633589 GCTCACCCAAAGCACAGTGAGGG - Intronic
1166666815 19:44685024-44685046 GCCCCTCAAAGCCACAGTCTCGG - Intergenic
1167356833 19:49009796-49009818 GACCCTCAAGACCACAGAGATGG + Exonic
925352687 2:3212588-3212610 GCCCCGCAAAAACACAGGGAGGG + Intronic
928893773 2:36237620-36237642 GACCCTCCTAACCAAAGTCAGGG - Intergenic
929920088 2:46165630-46165652 GCCCCTCCAGTCCCCAGAGAAGG - Intronic
934712520 2:96525345-96525367 GCCCCTCCATACCACTGGCATGG + Intergenic
937246321 2:120496441-120496463 GCCCAGCAAAACGACAGTGATGG - Intergenic
944897030 2:204175815-204175837 GCCCCACTAAACCACAGTACTGG - Intergenic
948733989 2:239986932-239986954 ATCCCTCAAAACCACATTGAGGG + Intronic
1168865463 20:1082242-1082264 CTCCCTCCACACCCCAGTGAAGG + Intergenic
1169804983 20:9550169-9550191 GTTCCTCCAAATCTCAGTGAGGG + Intronic
1174118383 20:48243564-48243586 GCACTTACAAACCACCGTGAAGG + Intergenic
1174237141 20:49103241-49103263 GCCCTTCCAAACCCCAGCCATGG + Intergenic
1175656944 20:60779272-60779294 GCCCCTCCTAACCCCAGTCAAGG + Intergenic
1180211118 21:46295909-46295931 GCCCCTCCCCAGCACAGTGCTGG + Intronic
1180557718 22:16591414-16591436 TCCCCTGAGAACCACAGTGAGGG + Exonic
1181051334 22:20239547-20239569 TCCCCTCCAGGCCACAGTGGGGG - Intergenic
1181094673 22:20496901-20496923 CCCTCTCAAAACCACAGTGTGGG - Intronic
1182371551 22:29814728-29814750 CCCCTTGCAAACCACAGTGCTGG + Exonic
1182692913 22:32176200-32176222 TCCCCTCCAAACCACCGTGCAGG - Intergenic
1183112642 22:35662150-35662172 TCCCTTCCAAAGCACAGGGAGGG - Exonic
1184809051 22:46816255-46816277 TACCCTCCAAACCAAAGTGTGGG - Intronic
1185035910 22:48476786-48476808 CCCCATCCAACCCACAGTGGTGG - Intergenic
1185113993 22:48920784-48920806 GCCTCTTCTACCCACAGTGAAGG - Intergenic
950936179 3:16842005-16842027 TCCCCTCCCAGCTACAGTGAGGG + Intronic
950950509 3:16993333-16993355 GCACCTGCAAACCACAGGAATGG - Intronic
951868994 3:27339478-27339500 GCAAATCCAAACCACAATGAGGG + Intronic
953799488 3:46011431-46011453 GTCCCTCCAAGCCACACTGATGG + Intergenic
954515841 3:51175633-51175655 GCCCCTCCCAACTGCAGTGCAGG - Intronic
957536922 3:81518091-81518113 TCCCCCCCAAACCCCAATGAAGG + Intronic
965944605 3:174225088-174225110 GCCCTTCCCAACCAAAGTAAGGG - Intronic
968742332 4:2337544-2337566 GCCCCTCCAAAACAGAGTGGGGG + Intronic
973203511 4:47532461-47532483 GCCCCTCCAATCACTAGTGAAGG - Intronic
975344986 4:73283135-73283157 TGCCTTCCAAACCTCAGTGAAGG - Intergenic
976069135 4:81221339-81221361 GCCCCTCCAGGCAGCAGTGAGGG - Intergenic
982977909 4:162090518-162090540 GCCCATCAAAACCACAATCAAGG + Intronic
986964426 5:13253476-13253498 TCCCCCTCAAACCACAGAGAGGG + Intergenic
990321324 5:54632584-54632606 GCCCAGCCAAACCACTGAGAAGG + Intergenic
990493216 5:56321754-56321776 GCCCCTGAAAATCACCGTGAAGG - Intergenic
991950652 5:71944140-71944162 GCCCCTTGACACCACAGTGGAGG - Intergenic
993589506 5:89777673-89777695 GACCCCCCAAACCCCAGTCAAGG + Intergenic
995264218 5:110139184-110139206 GCCCCTGGGAGCCACAGTGATGG + Intergenic
998333817 5:141352463-141352485 GTTCCTCCCAACCACAGCGAGGG + Exonic
999693088 5:154165746-154165768 TCCCCACCAATCAACAGTGAGGG - Intronic
1007832063 6:44646334-44646356 GCTCCTAGAAACCACAGTGGTGG - Intergenic
1013301475 6:108808733-108808755 CCCCCTCCAAACCCAAGTGGTGG + Intergenic
1014075561 6:117230753-117230775 GCCCTGCAAAGCCACAGTGAAGG - Intergenic
1019122528 6:169814340-169814362 GCACCTGCAGACCACACTGATGG + Intergenic
1019514459 7:1433634-1433656 GACCCTCAAAGGCACAGTGAAGG + Intronic
1019731685 7:2632507-2632529 TACCCTCCAACCCCCAGTGAGGG + Intronic
1020766452 7:12328090-12328112 GCCCCTCCAACCTCCAGGGAAGG + Intergenic
1025959022 7:66204751-66204773 GTCCCTCCCAACCACAGAGGTGG - Intergenic
1026556876 7:71416099-71416121 GCCCCTCTCAACCACAATGCAGG - Intronic
1029195305 7:98801712-98801734 CCCCCTCCAGGCCACAGAGAAGG + Intergenic
1030625526 7:111842053-111842075 CACCATCAAAACCACAGTGAAGG + Intronic
1031536730 7:122942983-122943005 GCCCTTCTATACCCCAGTGAGGG - Intergenic
1032368956 7:131327646-131327668 TCCCCTCCAAGCCCCAGGGAAGG + Intronic
1034449350 7:151129110-151129132 GACCCTCCTAACCACAGACAAGG - Intronic
1035670454 8:1412980-1413002 GCCCTTCCTGACCACAGTGTGGG + Intergenic
1036523538 8:9514470-9514492 TCCCCTCCCAACCACAGAGGAGG + Intergenic
1039661967 8:39477643-39477665 GCCCAGCCAAACCATAGGGATGG + Intergenic
1039925293 8:41925660-41925682 GGCCCTCCAAGCCACAGTGGAGG + Intergenic
1041696379 8:60741394-60741416 GCTCCTCCAAACCACAGCTCAGG - Exonic
1042514105 8:69641872-69641894 CCCCCTCCAGAGCACAGTGAGGG - Intronic
1043333753 8:79148925-79148947 GCACCTGCAAACCTTAGTGAAGG + Intergenic
1044717805 8:95116643-95116665 GCCCAGCCTAACCACATTGAAGG + Intergenic
1045501907 8:102749926-102749948 GCCCCAACAAAGCACAGTGCGGG + Intergenic
1047334552 8:123923028-123923050 GCCCCTCCATAGTACAGGGAAGG - Intronic
1047363608 8:124192349-124192371 ACCTCTCCAAACAGCAGTGATGG + Intergenic
1048365023 8:133730953-133730975 TCCCCTGGAAGCCACAGTGAAGG - Intergenic
1049705392 8:144039850-144039872 GCCCCTCCAGACCACGGCGAGGG - Intronic
1051595140 9:18817747-18817769 TCTCCTCTAAACTACAGTGATGG - Intronic
1053442627 9:38128558-38128580 GCACCCCCAAAACACAGTCATGG - Intergenic
1055476695 9:76669760-76669782 GCTCCTCCAAAGCCAAGTGAGGG - Intronic
1059389061 9:113987457-113987479 CCCCCTCCATGCCACAGTGTTGG + Intronic
1061509136 9:131049836-131049858 ACCTCTCCACCCCACAGTGAGGG + Intronic
1062548529 9:137074969-137074991 CCCCCTCCCAAACTCAGTGAGGG + Intergenic
1186750935 X:12620406-12620428 GCCCCTCTCAACCACAGTCCAGG + Intronic
1186940706 X:14504355-14504377 GCTCTTTCTAACCACAGTGATGG - Intergenic
1187715404 X:22097584-22097606 GCCACTCCTAACCACAGGGGAGG + Intronic
1197715850 X:129705565-129705587 GCACCTTCAGACCACAGTGTGGG - Intergenic
1199718170 X:150522273-150522295 TGCCCTCCAATCAACAGTGAAGG - Intergenic