ID: 901192795

View in Genome Browser
Species Human (GRCh38)
Location 1:7422478-7422500
Sequence GGCCAGACCCCCTCTGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901192795 Original CRISPR GGCCAGACCCCCTCTGTGCT GGG Intronic
900141870 1:1142064-1142086 GGCCTGGACCCCTCTGTGCTCGG + Intergenic
900141885 1:1142103-1142125 GGCCTGGACCCCTCTGTGCTCGG + Intergenic
900224686 1:1527405-1527427 TGCCTGACCCCTGCTGTGCTGGG - Intronic
901192795 1:7422478-7422500 GGCCAGACCCCCTCTGTGCTGGG + Intronic
901260384 1:7866438-7866460 GTCCAGGCCCCCTCTGTGCAAGG + Intergenic
901871969 1:12143439-12143461 GGCCCCACCCACTCTGTCCTGGG + Exonic
905462230 1:38129334-38129356 TGCCAGGGCCCCTCTGTCCTGGG - Intergenic
906566723 1:46806184-46806206 GGGCAGGCACCCTGTGTGCTGGG + Intronic
907948282 1:59155723-59155745 TGCCAGGCCCTCTCTATGCTAGG - Intergenic
911686712 1:100785884-100785906 GGCCAGAACCATTCTGTGGTTGG + Intergenic
913720483 1:121587603-121587625 TGCCAGACTCCCGCTGTTCTGGG + Intergenic
915059546 1:153169582-153169604 GGCCAGAACCACTTTGTGGTTGG - Intergenic
916899345 1:169203615-169203637 GGCCAGAACCATTCTGTGGTTGG + Intronic
918252731 1:182718121-182718143 GGCCAAAGCACCTCTGTCCTGGG + Intergenic
920859493 1:209693912-209693934 TGCCAGACCCCCTGTATTCTTGG + Intronic
922999179 1:229992028-229992050 GGCCAGGCACCACCTGTGCTTGG - Intergenic
1066059061 10:31706312-31706334 GGGGACACCCCCTTTGTGCTTGG - Intergenic
1069634130 10:69914955-69914977 GAGCAGAGCCCCTCTTTGCTTGG - Intronic
1069677792 10:70260811-70260833 AGCCAGGTCCCCTCTGAGCTTGG + Intronic
1069957500 10:72060983-72061005 GGAGAGGCCCCCTGTGTGCTGGG - Exonic
1070299397 10:75192192-75192214 GGCCAGCCGGCCTCTGGGCTTGG - Intergenic
1070600615 10:77864019-77864041 GGCCAGCCTCCCTCTGACCTGGG + Intronic
1070972664 10:80580400-80580422 GGCCAGAACTACTCTGTGGTCGG + Intronic
1071526555 10:86362954-86362976 GGCCAGCGCCCCTCAGTGCTGGG - Intronic
1071722846 10:88164731-88164753 GAACAGACCCTCTTTGTGCTGGG + Intergenic
1072228573 10:93393223-93393245 CGCCAGGCCCCCTCTGTCCCCGG - Intronic
1075489000 10:122850085-122850107 GCCAAGACTCCCTCTGTCCTGGG - Intronic
1076362676 10:129900506-129900528 GGCCAGGCCTCCTCTGTCCCTGG - Intronic
1076685421 10:132196465-132196487 GGCCAGGGCCGCGCTGTGCTGGG - Intronic
1077014797 11:394741-394763 GGCCAGGCCCCACCTGTGCCTGG + Intronic
1079101418 11:17544397-17544419 GGCCAGCCGCCCTCGGAGCTGGG + Intronic
1083129686 11:60613460-60613482 GGGCAGACTCCCTTGGTGCTGGG - Intergenic
1083475463 11:62912449-62912471 GCCCAGACCCCCACTGAGCTAGG - Intronic
1084333969 11:68446333-68446355 GGCCAGAAGCCCTCTCTGCAAGG + Intronic
1084459045 11:69286088-69286110 AGCAAGACCCCCTGTGAGCTGGG - Intergenic
1084752259 11:71211857-71211879 GTCCAGATCTCCTCTGTGCATGG + Intronic
1085302403 11:75466282-75466304 TGCCTGCCTCCCTCTGTGCTGGG - Intronic
1086515200 11:87603946-87603968 GGCCAGCCCTCCTCTGTCTTGGG - Intergenic
1087166827 11:95012967-95012989 GTCCAGACCCGAACTGTGCTTGG - Intergenic
1089692105 11:120193330-120193352 GGCCAGTCCTCCGCTGTGTTGGG + Intergenic
1090541546 11:127711727-127711749 GGCCAGAACCCCTCCATGGTCGG - Intergenic
1091815156 12:3432131-3432153 GCCCAAACCCCCTCTGATCTGGG - Intronic
1092022984 12:5217462-5217484 GGAAAGTCCCCCTCTGTGGTTGG + Intergenic
1096866440 12:54566450-54566472 GTCCACAGCCCCTCTGTGCCTGG - Intronic
1097281007 12:57845657-57845679 GGCCAGAGCCCCTCCCTGCCCGG - Intronic
1097290493 12:57910403-57910425 GGCCTCACCCACTCTGTGCTTGG + Intergenic
1099894295 12:88625527-88625549 GGCCAGGCCCTGTCTGTGCTTGG - Intergenic
1101649164 12:106659217-106659239 AGCCAGACCCCAGCTGGGCTAGG - Intronic
1102012574 12:109627691-109627713 CTCCAGTCCCTCTCTGTGCTGGG + Intergenic
1102412683 12:112733776-112733798 TGCCATGCCCACTCTGTGCTGGG - Intronic
1103612109 12:122130163-122130185 TGCCAGGCCCCCTCTGGGCCAGG + Intronic
1106583748 13:31039145-31039167 GGCCAGCCCTCCACTGTGCATGG - Intergenic
1108921113 13:55675497-55675519 GGCCAGATGCACTCTGTGGTTGG + Intergenic
1109335630 13:60990554-60990576 GGCCAGGCCACACCTGTGCTTGG - Intergenic
1110197642 13:72808795-72808817 GGCCAGTCCCATTCTGTGCCAGG - Intronic
1112657988 13:101473600-101473622 GGCAAGTCCTGCTCTGTGCTGGG + Intronic
1112766576 13:102752102-102752124 GGGCAGAACCACTCTGTGGTTGG - Intronic
1113922369 13:113920266-113920288 TGCCAGGCCCCATGTGTGCTGGG + Intergenic
1113926806 13:113946363-113946385 GACCAGTCCCCCTCTGTGGTGGG + Intergenic
1120163539 14:81170319-81170341 GGTCAGACCCCTGCTGTGTTGGG - Intergenic
1120516678 14:85479403-85479425 GGCCACAGTCTCTCTGTGCTAGG - Intergenic
1120538199 14:85722822-85722844 GGCCAGAACCACTTTGTGGTGGG + Intergenic
1120875534 14:89371771-89371793 CCCCTGACTCCCTCTGTGCTGGG + Intronic
1122089386 14:99328231-99328253 GCCCAGAACCCTCCTGTGCTGGG + Intergenic
1122348666 14:101075575-101075597 GGCCACACCCCCTCTTTGGTGGG + Intergenic
1122657173 14:103269846-103269868 GGCCAGAACCACTCTGAGGTCGG - Intergenic
1123023380 14:105412389-105412411 AGACAGCCTCCCTCTGTGCTGGG - Exonic
1123197871 14:106633911-106633933 GACCACACCCTATCTGTGCTGGG - Intergenic
1123509229 15:20979392-20979414 GGACAGGCCCCCTCTGTGAGTGG + Intergenic
1123566452 15:21553139-21553161 GGACAGGCCCCCTCTGTGAGTGG + Intergenic
1123602714 15:21990425-21990447 GGACAGGCCCCCTCTGTGAGTGG + Intergenic
1124100628 15:26689680-26689702 AACCAGAACCACTCTGTGCTGGG + Intronic
1125279854 15:38031889-38031911 TGCCAGGCCCCCTCTGGCCTGGG + Intergenic
1127972123 15:63969903-63969925 TGCCAGACCCTCTCTGGGCCAGG + Intronic
1128235719 15:66065898-66065920 GGCCCCAGCCCCTCTGTGCCAGG - Intronic
1129519646 15:76177756-76177778 GTCCAGAGCTGCTCTGTGCTGGG + Intronic
1129672695 15:77616037-77616059 GGCCAGAGGCCCTCTGGCCTGGG - Intronic
1129885826 15:79036346-79036368 GGCCGGACCCTCTCTGTCCCTGG + Intronic
1132380958 15:101366446-101366468 GGCCAGACCCCCGCTACCCTGGG - Intronic
1202974817 15_KI270727v1_random:280227-280249 GGACAGGCCCCCTCTGTGAGTGG + Intergenic
1132623210 16:878024-878046 AGCCAGACCCCATGTGTGTTTGG - Intronic
1132719093 16:1307269-1307291 GGCCAGGCCCCCGCTGGTCTTGG + Intergenic
1132903471 16:2270719-2270741 GGCCAGAGCCCTGCAGTGCTGGG + Intergenic
1137492943 16:48948281-48948303 AGCAAGTCCACCTCTGTGCTCGG + Intergenic
1138198314 16:55070660-55070682 GGCAAGTCCCCCTTTGTGTTAGG + Intergenic
1139280921 16:65769810-65769832 GGCCAGAACCACTCTGTTGTTGG + Intergenic
1139340286 16:66263936-66263958 GGCCATCCCACCTCTGTTCTAGG - Intergenic
1141116188 16:81311910-81311932 GGACTGACCCACTCTGTCCTGGG + Intergenic
1142884870 17:2906191-2906213 GGCCAGCTCCTCTCTGTCCTGGG + Intronic
1143836482 17:9696798-9696820 GGCCCGTCCCTCACTGTGCTGGG + Intronic
1144439738 17:15270899-15270921 TGCCATACCACCTCTGTGCCTGG - Intergenic
1146705768 17:34999637-34999659 GGTCATACCCACTCTGGGCTGGG + Intronic
1147602383 17:41754533-41754555 GGCCTGGCGCCCTCTTTGCTGGG - Intergenic
1147995214 17:44356395-44356417 GGGGAGACCCCATCCGTGCTGGG + Intronic
1149609950 17:57952955-57952977 GGCCAGGCCTCCTCTGGCCTGGG + Intronic
1151479685 17:74362605-74362627 GGCCAGCCCCGCTCTGGGCAGGG - Intergenic
1151819163 17:76488060-76488082 GGCCAGTGCCCCTCGCTGCTTGG - Intronic
1152142155 17:78542972-78542994 GGCCATACCCACATTGTGCTGGG + Intronic
1152202005 17:78952633-78952655 GGCCAGGCCTCCTCTCTGATCGG + Intergenic
1152641907 17:81452744-81452766 GGCCAGGCCCCCGCCGTGCAGGG - Exonic
1153316444 18:3727262-3727284 GGGCAGACCCCATGTGTGTTTGG + Intronic
1153530910 18:6044745-6044767 GGGCAGACCTCTTCTGTGCTAGG - Intronic
1153910361 18:9701442-9701464 AGCCAGGGCCCCTCTGTCCTTGG + Intergenic
1155940261 18:31795561-31795583 GGCCAGAACCAATCTGTGGTAGG + Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1160653858 19:250154-250176 GGCCAGAACCTCTCTGTTGTGGG - Intergenic
1160835964 19:1124542-1124564 GGCCACCCACCCTGTGTGCTGGG - Intronic
1160957528 19:1700358-1700380 GTCAAGACCCACTGTGTGCTGGG + Intergenic
1161277739 19:3428312-3428334 GGCGAAACCCCATCTGTACTAGG + Intronic
1161614089 19:5260519-5260541 GGCAAGACCCCCAGAGTGCTGGG - Intronic
1162263080 19:9548075-9548097 GGCCTGAGCCCCCCTGTGGTGGG + Intergenic
1163764441 19:19154892-19154914 GGTAGGGCCCCCTCTGTGCTAGG + Intronic
1165013310 19:32864037-32864059 CCCCAGACACCCTCTGTGCCAGG + Intronic
1167260617 19:48455754-48455776 GGCCAGGCCCCCGCAGTGCCAGG - Exonic
927212294 2:20646309-20646331 GGTGAGACCTCCTGTGTGCTGGG + Intronic
927241060 2:20919818-20919840 GGCAAGACCCTCGCTGAGCTGGG - Intergenic
929564411 2:42975549-42975571 GGCCAAACGCCCGCTGGGCTGGG - Intergenic
932521190 2:72414541-72414563 GGACAGAGGCCCTCTGTGCAGGG + Intronic
934618812 2:95791836-95791858 GTACAGCCCCCATCTGTGCTAGG + Intergenic
934642081 2:96032721-96032743 GTACAGCCCCCATCTGTGCTAGG - Intronic
936611945 2:114010215-114010237 GTCCAGACCTCCTCTCTACTGGG + Intergenic
937297733 2:120819910-120819932 GGCCAGACCCAGCCTGAGCTGGG + Intronic
937829318 2:126402711-126402733 GGTCAGACACCCTCAGGGCTGGG - Intergenic
945736122 2:213602352-213602374 GGCGAGAGCCCCACTGTGCCCGG - Intronic
948461155 2:238130613-238130635 GGCCAGCCCCCCTCGGAGCGAGG + Exonic
948705551 2:239790047-239790069 GGCCAGACCCCCTGATTCCTTGG - Intronic
948709740 2:239818349-239818371 GGCCAGATGCTCTCTGGGCTGGG - Intergenic
948727358 2:239943201-239943223 CCCCAGGCCGCCTCTGTGCTTGG - Intronic
1168820766 20:772322-772344 GGACACACCCCCACTGTGCCTGG - Intergenic
1169065329 20:2691962-2691984 GGCCAGACGACTTCTGTGCCAGG + Intergenic
1172583325 20:36065195-36065217 GACCAGCCTCCATCTGTGCTTGG + Intergenic
1173473496 20:43341570-43341592 GGCCATACCCCACCTCTGCTTGG - Intergenic
1174925084 20:54750497-54750519 GGCCAGAACCACTCTGTGACTGG - Intergenic
1175914567 20:62419664-62419686 GGCCCGGGCCCCTCTGCGCTGGG + Exonic
1176170596 20:63694754-63694776 CTCCAGACCCCCACTGTGGTTGG - Exonic
1176271621 20:64238271-64238293 GGGCAGAGCCCCTCTGGGCAGGG + Intronic
1177267504 21:18803799-18803821 GGCCAGAACCACTCTGTGGTTGG + Intergenic
1178212808 21:30557029-30557051 AGCCATACCAACTCTGTGCTGGG + Intronic
1178974384 21:37208957-37208979 GGCCAGAGCCGCTCTTTGCCTGG + Intergenic
1179247823 21:39648921-39648943 CGCCAGAACCCGGCTGTGCTGGG + Intronic
1179822019 21:43942568-43942590 GACCAGGAACCCTCTGTGCTCGG + Intronic
1180087032 21:45512285-45512307 GGCCAGGCCTCCTCGCTGCTGGG + Exonic
1180711529 22:17842482-17842504 GGCCAGGCCCCCTCAGTGGTGGG - Intronic
1181043299 22:20203038-20203060 GGCCTGGCCCCATCTGTGCCTGG - Intergenic
1181083641 22:20429413-20429435 GGCCCCGCCCCTTCTGTGCTTGG - Intronic
1181409001 22:22704908-22704930 GGCCAGACCTGCTCATTGCTTGG - Intergenic
1181460952 22:23085705-23085727 GGCCAGAGGCCCTCTCTGCTGGG - Intronic
1182857235 22:33528587-33528609 GGCCAGAACCACTCTGTGTTGGG + Intronic
1183667070 22:39252333-39252355 GGCCAGAGCACATCTGTGCCCGG - Intergenic
1184277666 22:43419473-43419495 GGCAGGACCCCCTCTGTGCCAGG + Intronic
1184608042 22:45585653-45585675 GGCCCGGCCTCCTCTGGGCTGGG + Intronic
1185062543 22:48614591-48614613 GGCCAGACTCACACTGTGCCTGG + Intronic
1185375955 22:50482654-50482676 GGCCGGCACCCCTCTGTGCCTGG - Exonic
949218516 3:1600879-1600901 GGGCAGCCACCCTCTCTGCTGGG - Intergenic
949689065 3:6613755-6613777 GGCCAGACCCTTTCTGGACTGGG - Intergenic
949980950 3:9501379-9501401 GCCCAGGCCTCCTCTCTGCTGGG - Exonic
950113865 3:10438100-10438122 GCCCATACCCACTGTGTGCTGGG + Intronic
950685663 3:14617010-14617032 GGCCAGAACCACTCTGTGGTCGG + Intergenic
952234507 3:31464777-31464799 GGCCAGAGCCAGTCTGTGCATGG - Intergenic
953974790 3:47374229-47374251 GGCGTGAGCCCCACTGTGCTTGG + Intergenic
955701261 3:61684517-61684539 AGACAGAGCCCCTCTGGGCTTGG - Intronic
958625113 3:96613543-96613565 GGACAGAACCACTCCGTGCTTGG - Intergenic
959605297 3:108235507-108235529 GGCAAGACTCCTGCTGTGCTGGG + Intergenic
960143565 3:114174308-114174330 GGCCAGAATCCCTCTTTTCTGGG + Intronic
960613259 3:119573977-119573999 GGCCAGAACCAATCTGTGATTGG + Intergenic
960672824 3:120168739-120168761 GGCCTGACCCTCTCAGTTCTGGG - Intronic
961379749 3:126489124-126489146 TCCCAGACCCCCTCAGTCCTGGG + Intronic
961870066 3:129981010-129981032 GGCCAGAACCACTCTGTGGTTGG + Intergenic
962809183 3:138946956-138946978 GGCCGGAGCCCCTCTCTGTTGGG - Exonic
963189737 3:142456134-142456156 GGCAAAACCCCTTCTCTGCTGGG + Intronic
963197313 3:142546471-142546493 GTCCAGACTGCCTCTGAGCTTGG - Intronic
964473242 3:157076254-157076276 GGCCAGAGCACATCTCTGCTGGG - Intergenic
964511036 3:157452198-157452220 ACCCAGACCCCCGCTCTGCTTGG - Intronic
968699273 4:2047068-2047090 GGCCAGACCCGCGCCGTCCTGGG + Intergenic
968803454 4:2757409-2757431 GGAAAGACCCCATGTGTGCTTGG - Intergenic
969287076 4:6209490-6209512 GGCCAGACCCACCCTGTTCCTGG - Intergenic
969459674 4:7322300-7322322 GGCCATGCCCCCTCTGTCCTGGG + Intronic
977405955 4:96598686-96598708 GGCCAGAACCAGCCTGTGCTTGG - Intergenic
978200806 4:106021955-106021977 GGCCAGAACCACTTTGTGGTTGG - Intergenic
981828971 4:148978460-148978482 GGCCAGAAGGCTTCTGTGCTTGG - Intergenic
983411401 4:167403043-167403065 GGCCAGAACCACTCTGTGGTTGG - Intergenic
985521971 5:377967-377989 GGTCACACCCACTCTGTTCTGGG + Intronic
985606826 5:862358-862380 GCCCAGTGCCCCTCTCTGCTGGG + Intronic
985825317 5:2186760-2186782 GGCCAGACCCCCTCAGAGCATGG - Intergenic
985882184 5:2646533-2646555 GGCCAGAACCACTCTGGGGTCGG - Intergenic
987270656 5:16305011-16305033 GGCCAGACCCACTTTGTGGTCGG + Intergenic
989100910 5:37822182-37822204 GGTCAGGCCCCCTCTCTCCTGGG - Intronic
989205504 5:38805436-38805458 GGCCAGACCCTCCCTGAGCTGGG - Intergenic
990910066 5:60843963-60843985 GGCCAGGCCCTCCCTGGGCTCGG - Intronic
991144279 5:63282933-63282955 GGTCAGAACCCCTCCGTGGTTGG + Intergenic
992468362 5:77029686-77029708 GGCCAGAACTTCTCTGTGGTTGG - Intronic
992997457 5:82347241-82347263 GGACAGAAGCACTCTGTGCTGGG + Intronic
995853229 5:116568791-116568813 AGCCATACCACCTATGTGCTTGG + Intronic
996820498 5:127621281-127621303 GGCCAGAACCAGTCTGTGGTTGG + Intergenic
997142149 5:131393407-131393429 TGGCAGATCCTCTCTGTGCTTGG - Exonic
997893611 5:137696274-137696296 TGCCAGACCCACTGTGTGATTGG - Intronic
1000367091 5:160501801-160501823 GGCCAGAACCACCCTGTGGTCGG + Intergenic
1002102006 5:176862341-176862363 CGCCAGGCCACCTCGGTGCTGGG + Intronic
1002188660 5:177467828-177467850 TTCCTGACCCCCTCTTTGCTGGG - Intronic
1002427527 5:179185076-179185098 TTCCACATCCCCTCTGTGCTTGG - Intronic
1005591005 6:27327272-27327294 GGCCAGAACCAGTCTGTGGTTGG - Intergenic
1013750058 6:113395256-113395278 GGCCAGAGCCCCTGAGTGATGGG - Intergenic
1017354228 6:153483142-153483164 GGCCAGAACCACTCTGTGATTGG - Intergenic
1018082020 6:160267275-160267297 GGCCAGATTCTCTCTGTGTTAGG + Intronic
1018157215 6:160996721-160996743 GCCCAGACACTCACTGTGCTTGG + Intronic
1018841908 6:167523508-167523530 GCCCAGCCCACCTCTGTCCTGGG - Intergenic
1019082643 6:169445748-169445770 TGCCAGACCTCCGCTGTGATGGG - Intergenic
1019359864 7:599145-599167 GGCCAGGGCCACACTGTGCTCGG + Intronic
1020026940 7:4905968-4905990 GACCAGACTGCCTCCGTGCTGGG - Exonic
1023916355 7:44592250-44592272 TGCCAGACCCCTTCCCTGCTGGG - Intergenic
1026644443 7:72155631-72155653 GGCCAGAGACCCTTTGTACTAGG + Intronic
1026929479 7:74215874-74215896 CCCCACACCCCCACTGTGCTCGG - Intronic
1026970678 7:74465718-74465740 GGACACACCCCCTCTGTCCGTGG + Intronic
1027139062 7:75644206-75644228 AGCCAGCCACCCACTGTGCTGGG - Intronic
1028985229 7:97004096-97004118 GGCCTGCCCTCCTCTGTGCCTGG + Intergenic
1029650102 7:101885680-101885702 GGCCATGCCTGCTCTGTGCTCGG - Intronic
1032134406 7:129262505-129262527 GGCCAGAACCACTCCGTGGTTGG + Intronic
1034658943 7:152752608-152752630 GGCCAAAACCACTCTGTGGTTGG + Intergenic
1034954212 7:155324007-155324029 GACCATATGCCCTCTGTGCTTGG + Intergenic
1035266706 7:157693366-157693388 GGCCCGACCTCCGCGGTGCTGGG + Intronic
1035513390 8:209944-209966 GGCCAGAACCTCTCTGTTGTGGG - Intergenic
1036692637 8:10953550-10953572 GGCAAGACCCCGTCTGTGTTAGG - Intronic
1037528344 8:19749736-19749758 TCCCTGACCCCCTCTGAGCTGGG - Intronic
1041012485 8:53558617-53558639 AGCCTGACCCCCTCTTTCCTGGG - Intergenic
1043284393 8:78511617-78511639 AGCCAGAGGCCCTGTGTGCTGGG - Intergenic
1044070201 8:87751043-87751065 GGCCAGAACCACTCTGTGGCAGG - Intergenic
1044474641 8:92612081-92612103 AGCCAGAACCTCTCTGAGCTTGG + Intergenic
1044622871 8:94207714-94207736 GGACAGATGCCCTCTGTGGTAGG - Intronic
1046660753 8:116946187-116946209 TGCCAGAATCCCTCTGTGCCTGG + Intergenic
1048304715 8:133275878-133275900 TGCCAGACACATTCTGTGCTCGG + Intronic
1048326576 8:133443741-133443763 GGCCAGACTCCATCATTGCTCGG - Intergenic
1048470562 8:134700621-134700643 GGCCAGAGCTCCTCTGAGGTGGG - Intronic
1049393205 8:142382583-142382605 GGCCAGACCTTCTCTCTGCCAGG - Intronic
1049399036 8:142416656-142416678 AGCCAGCACCCCTCTGAGCTTGG + Intergenic
1049444044 8:142621942-142621964 GGCCAGACGCCCCCAGAGCTGGG + Intergenic
1049531622 8:143158256-143158278 GGCCTGCCCTCCTCTGGGCTGGG - Exonic
1049748983 8:144274703-144274725 GGGCAGCCCCCTGCTGTGCTGGG - Intronic
1052751674 9:32498148-32498170 GGCCAGACCCACTCTGTGGTTGG - Intronic
1056981355 9:91314864-91314886 GGCCAGAACCACCCTGTGGTTGG - Intronic
1057559088 9:96113358-96113380 GGCCAGACCCCCGCAGATCTTGG + Intronic
1059341908 9:113602133-113602155 GGGCACACTCCCTCTGTGCCTGG - Intergenic
1061295953 9:129676808-129676830 GGACAGAGCCCCTCTGAGCTGGG - Intronic
1062241155 9:135539619-135539641 GGCCAGTTTCCCTCTGTGGTGGG + Intergenic
1062720390 9:138039003-138039025 GGCAAAACCCCGTCTCTGCTGGG + Intronic
1195355878 X:104039766-104039788 GGGCAGACGCCCTCTGTGATTGG + Intergenic
1200889760 Y:8311031-8311053 GGCCACATCACCTCGGTGCTGGG - Intergenic