ID: 901192837

View in Genome Browser
Species Human (GRCh38)
Location 1:7422723-7422745
Sequence TGCCTATGGAGTGGGTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 6, 3: 18, 4: 254}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901192837_901192850 18 Left 901192837 1:7422723-7422745 CCCTCACACCCACTCCATAGGCA 0: 1
1: 0
2: 6
3: 18
4: 254
Right 901192850 1:7422764-7422786 GCACATGCCACCTGGACACAGGG 0: 1
1: 0
2: 1
3: 27
4: 217
901192837_901192841 -10 Left 901192837 1:7422723-7422745 CCCTCACACCCACTCCATAGGCA 0: 1
1: 0
2: 6
3: 18
4: 254
Right 901192841 1:7422736-7422758 TCCATAGGCAGCTTCCCACATGG 0: 1
1: 0
2: 0
3: 20
4: 183
901192837_901192849 17 Left 901192837 1:7422723-7422745 CCCTCACACCCACTCCATAGGCA 0: 1
1: 0
2: 6
3: 18
4: 254
Right 901192849 1:7422763-7422785 GGCACATGCCACCTGGACACAGG 0: 1
1: 0
2: 3
3: 21
4: 185
901192837_901192848 10 Left 901192837 1:7422723-7422745 CCCTCACACCCACTCCATAGGCA 0: 1
1: 0
2: 6
3: 18
4: 254
Right 901192848 1:7422756-7422778 TGGGGCTGGCACATGCCACCTGG 0: 1
1: 0
2: 0
3: 22
4: 233
901192837_901192843 -9 Left 901192837 1:7422723-7422745 CCCTCACACCCACTCCATAGGCA 0: 1
1: 0
2: 6
3: 18
4: 254
Right 901192843 1:7422737-7422759 CCATAGGCAGCTTCCCACATGGG 0: 1
1: 0
2: 2
3: 10
4: 119
901192837_901192845 -4 Left 901192837 1:7422723-7422745 CCCTCACACCCACTCCATAGGCA 0: 1
1: 0
2: 6
3: 18
4: 254
Right 901192845 1:7422742-7422764 GGCAGCTTCCCACATGGGGCTGG 0: 1
1: 0
2: 2
3: 19
4: 206
901192837_901192844 -8 Left 901192837 1:7422723-7422745 CCCTCACACCCACTCCATAGGCA 0: 1
1: 0
2: 6
3: 18
4: 254
Right 901192844 1:7422738-7422760 CATAGGCAGCTTCCCACATGGGG 0: 1
1: 1
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901192837 Original CRISPR TGCCTATGGAGTGGGTGTGA GGG (reversed) Intronic
900577240 1:3389416-3389438 TCCCTATGGCGTGGGGCTGAGGG + Intronic
900648954 1:3721804-3721826 TGGCTGTGGAGTGGGTGCCAGGG + Intronic
901192837 1:7422723-7422745 TGCCTATGGAGTGGGTGTGAGGG - Intronic
901544690 1:9947161-9947183 TGTCTATGGAGTAGGCTTGAGGG - Intronic
901810647 1:11765313-11765335 TGCCTGTGGAGTGGGCTTGGGGG + Intronic
902253688 1:15173138-15173160 TGCCTAGGGAGTAGGTCAGATGG + Intronic
904466855 1:30713448-30713470 TGCCTATTGAGAGCGTGTAATGG - Exonic
906948476 1:50315704-50315726 GGGCTATGGAGTGGGGGTAAAGG - Intergenic
907256630 1:53184014-53184036 AGCTTATGGAGCGGTTGTGAAGG + Intergenic
908501874 1:64752128-64752150 TGGATAAGGAGTGGGTGAGAAGG - Intronic
909381815 1:75006974-75006996 TGCTTATGGACTGGATGTGGCGG - Intergenic
910426935 1:87127846-87127868 TGCGTATGGCGTGAGTGGGAGGG + Intronic
910772528 1:90844380-90844402 TGCCTATGGGGAGGGTAGGAAGG - Intergenic
911450219 1:98053238-98053260 TGCAAATGGAGTGGGAGTGGTGG + Intergenic
914767099 1:150648109-150648131 TACCTATGGAGTGGAAGTGTAGG + Exonic
915214386 1:154330106-154330128 TTCCTCTGGAGTGGGGGTGGGGG + Intronic
919350342 1:196444129-196444151 TACCTATGGAGTGTATGTGTGGG + Intronic
920232709 1:204481144-204481166 TGTGTATGGGGAGGGTGTGAGGG - Intronic
922551475 1:226497613-226497635 TGCCCAGGGAGTGGGAGGGAAGG + Intergenic
923402228 1:233626211-233626233 TGCTGATGGATTGGATGTGAGGG + Intronic
923591100 1:235320372-235320394 TTTCAATGGATTGGGTGTGAAGG - Intronic
923678870 1:236102896-236102918 GGCCTGTGAAGTGGGTGGGAAGG - Intergenic
924475101 1:244375952-244375974 TGCCTATGGGCTGGGTGCAATGG - Intronic
1063009056 10:2004497-2004519 TGCCCAGGGAGTGGGCATGACGG + Intergenic
1067476768 10:46572614-46572636 TGGTTCTGGAGTGGGTGTCAGGG - Intergenic
1067617970 10:47769166-47769188 TGGTTCTGGAGTGGGTGTCAGGG + Intergenic
1069202305 10:65635418-65635440 AGCATATGGTGTGGGTGTGGGGG - Intergenic
1069893662 10:71667267-71667289 TGTCTAGGGAGGGGGTGTGGAGG + Intronic
1070060634 10:72980304-72980326 TTTTTATGGAGTTGGTGTGATGG + Intergenic
1071713768 10:88074744-88074766 TGCCTCTGGCATGTGTGTGATGG + Intergenic
1072033027 10:91539276-91539298 GGCCTAAGGAGTAGGTGTGGGGG + Intergenic
1073451358 10:103611317-103611339 TGCCAATGCAGTGGCTGGGATGG + Intronic
1074391051 10:113058409-113058431 TGTTTTTGGAGTGGGTGAGAGGG + Intronic
1074713040 10:116193262-116193284 AGCCCCTGGAGTGGGTGTGGAGG - Intronic
1074763850 10:116686518-116686540 AGCCCAAGGAGTTGGTGTGAAGG + Intronic
1075687357 10:124373604-124373626 TTCGGGTGGAGTGGGTGTGAAGG + Intergenic
1076723175 10:132401573-132401595 TCCCTAGGGGGTGGGTGTGTGGG + Intronic
1077477298 11:2796553-2796575 TCCCCATGGAGAGGGTGTGTCGG - Intronic
1077648106 11:3944450-3944472 TGCCTGTGTAGTGGGAGTGGAGG + Intronic
1078016695 11:7621045-7621067 TGCTTATGGAGAGAGTATGAGGG + Intronic
1081350739 11:42049428-42049450 TGCAAATGGAGTGGGGTTGAGGG - Intergenic
1081604175 11:44517061-44517083 GGCCAGTGGAGTGGGAGTGATGG + Intergenic
1083401007 11:62423594-62423616 TGCCTGTGGACTTGGAGTGAAGG - Intergenic
1085103552 11:73822284-73822306 TGCCTTTGGGGTGGGGGTGCAGG - Intronic
1086196169 11:84142531-84142553 TGCCTCTGGTGTGTCTGTGACGG + Intronic
1086641342 11:89160477-89160499 TACCTCTGGAATGGGTGTGGAGG - Intergenic
1087043116 11:93820881-93820903 TCTCTATGGAGTGAGGGTGAGGG + Exonic
1088235912 11:107722301-107722323 TGCAAATGGAGCAGGTGTGATGG - Intergenic
1088348607 11:108859151-108859173 TGACTCTGCAGTGGGTGTTAAGG + Intronic
1089793724 11:120963493-120963515 TCTCTATGGTGTGTGTGTGAAGG - Intronic
1090641822 11:128736098-128736120 TTCCTGTTTAGTGGGTGTGAGGG - Intronic
1090844873 11:130522273-130522295 TGCCCAGGGAGTGGAAGTGAGGG + Intergenic
1090846498 11:130534045-130534067 TGGGTTTGGGGTGGGTGTGAGGG + Intergenic
1091587124 12:1822735-1822757 TGCCTGGGCAGTGTGTGTGATGG + Intronic
1092551499 12:9506845-9506867 TGCTTATGGCCTGGGTGTCATGG - Intergenic
1092645186 12:10563271-10563293 TGCCTTTGGGGTGTGGGTGAGGG - Intergenic
1093960970 12:25272385-25272407 TGCCTTTCTAGTGGGTGTAATGG - Intergenic
1095493028 12:42756168-42756190 TGCCTGTGGAGTGTGTTTCAAGG + Intergenic
1095778348 12:46033350-46033372 GGGCTATGGAGGGGGTGTGGAGG - Intergenic
1097966805 12:65590258-65590280 TGCCTCTGGAGAAGGTGTGCTGG - Intergenic
1098243226 12:68488857-68488879 TGCCAAGGGAGTTGGGGTGATGG + Intergenic
1098367357 12:69718832-69718854 TGACTCTGGAGTGGGGGTGAAGG + Intergenic
1099120370 12:78682176-78682198 AGCTGATGAAGTGGGTGTGAGGG + Intergenic
1100162322 12:91874785-91874807 GGCCTATGGAGGGGCTGTGTGGG + Intergenic
1100620610 12:96268931-96268953 AGCCTATGGGGTGGGGGTGGGGG - Exonic
1103007499 12:117433367-117433389 TGTGTATGGAGTGTGTGTAAGGG - Intronic
1103007538 12:117433811-117433833 TGTGTATGGAGTGTGTCTGAGGG - Intronic
1103637150 12:122316493-122316515 TGACTTTGGGGTGGGTGTGGTGG - Intronic
1106602964 13:31202764-31202786 TGCCTATTAAGTGGATCTGAGGG + Intronic
1107056375 13:36108766-36108788 TGTTTATGGAGTTGATGTGAGGG + Intronic
1107387343 13:39926274-39926296 TGCCTATTGTATGAGTGTGATGG + Intergenic
1111655084 13:91141737-91141759 TGTTTATGGAGTGGCTGTGTGGG + Intergenic
1112698962 13:101981959-101981981 TGCCTATGGGGTGGATCTCAGGG + Intronic
1115755895 14:36525545-36525567 GGCCATTGGGGTGGGTGTGAGGG + Intergenic
1116645402 14:47521957-47521979 TGCCTATGGGCTGGGTGCGGTGG - Intronic
1116819615 14:49615321-49615343 TGCCTTGGGATTGGGTGGGATGG + Intergenic
1119574177 14:75703209-75703231 TGGGGATGGAGTTGGTGTGAGGG + Intronic
1122411934 14:101529992-101530014 TGCCTTTGGGGTTGGTGAGAGGG - Intergenic
1122748036 14:103911251-103911273 TGCCAGTGCAGTGGATGTGAAGG + Intergenic
1122824375 14:104362488-104362510 GGCCTGTGGAGGGGGTGTGGGGG + Intergenic
1124134963 15:27027270-27027292 TGGCTATGAAGTGAGTGTGGGGG + Intronic
1124365218 15:29066237-29066259 TGCCTGTGGAGTGGGTTTTGAGG - Intronic
1124781988 15:32644748-32644770 TGCCCATGGAGTGGGTCCGAAGG + Intronic
1125381128 15:39088135-39088157 TGTCTATGGAATGGGTGTGATGG - Intergenic
1128358522 15:66944573-66944595 TGTCTACAGAGTGGATGTGAGGG + Intergenic
1129163035 15:73757884-73757906 TGCCTGGGGTGTGGGGGTGAGGG + Intergenic
1129220822 15:74130777-74130799 CGGCTATGGGGAGGGTGTGAGGG + Intronic
1129758227 15:78111507-78111529 TGCTGATGGGGTGGGTGTGGTGG - Intronic
1130343875 15:83023675-83023697 TGCCTTTTGACTGGGTGTGGTGG - Intronic
1134096250 16:11420849-11420871 TGCCTGTGTACTGGGTGTGCGGG + Intronic
1134096897 16:11424162-11424184 TGGGCATGGTGTGGGTGTGACGG + Exonic
1135356246 16:21771604-21771626 TGTCTATGCAGTGGGTAGGAAGG - Intergenic
1135454737 16:22587743-22587765 TGTCTATGCAGTGGGTAGGAAGG - Intergenic
1137534141 16:49304775-49304797 TGCCGATGGATTGGATGTGGGGG + Intergenic
1137582579 16:49642664-49642686 TGCATTTGGAGGGGGTGGGATGG - Intronic
1137688307 16:50402215-50402237 TACCTATGGAGGGGGTGGGGAGG - Intergenic
1137748402 16:50840597-50840619 TGCATCTGTAGTGGGTTTGAGGG - Intergenic
1138196487 16:55056045-55056067 TGCATATGCAGTGTGTGTGGTGG - Intergenic
1142866748 17:2796072-2796094 GCCCTCGGGAGTGGGTGTGAAGG + Intronic
1142925076 17:3228398-3228420 TGGCTATAGACTGGGTGTGGTGG - Intergenic
1145849264 17:28075757-28075779 AGCTTATGAAGTGGGGGTGAAGG - Intronic
1147344298 17:39778513-39778535 TGCCTATGGGCTGGGTGCGGTGG + Intronic
1148183520 17:45624306-45624328 GGGCTAAGGAGTGGGTGAGATGG + Intergenic
1148265331 17:46221385-46221407 GGGCTAAGGAGTGGGTGAGATGG - Intronic
1148318252 17:46723762-46723784 TGGCCAGGGAGTGGGTGTGCTGG - Intronic
1148341149 17:46874202-46874224 TGGTTCTGGAGTGGGTGGGATGG + Intronic
1149309666 17:55381870-55381892 TGCCTGTGGAGAAGGTGAGAGGG + Intergenic
1151326182 17:73380948-73380970 TGGCTATGGGGTGGGGGTGCCGG + Exonic
1151439902 17:74121641-74121663 GCCCTATGGAGAGGGTGTGTGGG - Intergenic
1151504331 17:74516623-74516645 TGCCTCAGGAGAGGGTGTGAGGG + Intergenic
1156199430 18:34813186-34813208 TGCCTCTTGACTGGGTGTGGTGG + Intronic
1156450764 18:37265483-37265505 TGCCGTTTGAGTGGGAGTGAGGG - Intronic
1157293848 18:46427823-46427845 TGCCAAAGGAGTGGGAGAGAAGG + Intronic
1157454608 18:47814827-47814849 GGGCTTTGGAGTGGGTGGGAAGG - Exonic
1159017345 18:63112038-63112060 TGGCTATGGAGTGGGAGAGGAGG + Intergenic
1160240397 18:77118589-77118611 TGTCTGTGGAGTGTGTGTGTGGG - Intronic
1160295421 18:77632785-77632807 TGCATATTGGGTGGGTGGGAAGG + Intergenic
1163218393 19:15897330-15897352 GGCTTAGGGAGTGGGGGTGAAGG - Intronic
1163402223 19:17101083-17101105 TGCCTCTGGATGGGGTGGGATGG + Intronic
1164264839 19:23605398-23605420 AGCCCATAGACTGGGTGTGATGG - Intronic
1166100780 19:40570384-40570406 TGTCCATGGAGAGGGTGTGGGGG - Intronic
1166559084 19:43720052-43720074 TGCCTGGGGGGTGGGTGTGGAGG + Intergenic
1166997063 19:46724686-46724708 GGCCTCAGGAGTGCGTGTGACGG - Intronic
1167599092 19:50443563-50443585 TGCCTATGAAGTAGCTGTCAAGG + Exonic
925942194 2:8831320-8831342 TGACTATGTAGAGGGTGGGAGGG - Intronic
926584230 2:14668486-14668508 TGCTTATAGAGTGGGTATGAGGG - Intergenic
928124129 2:28604345-28604367 TGCCTTTGGAGTGGGAGTGGGGG - Intronic
928454393 2:31405878-31405900 TGACTTTGGAGTGGGAGTGACGG - Intronic
929975394 2:46629155-46629177 TTTCTCTGGAGTGGGTGTAAGGG + Intergenic
933883643 2:86697254-86697276 TGCCTATTGGCTGGGTGCGATGG + Intronic
934730990 2:96657578-96657600 TGCGGATGGAGGGGGTGGGATGG - Intergenic
935188877 2:100759672-100759694 TGCCTAAAGACTGGGTTTGAAGG - Intergenic
935899221 2:107772918-107772940 TCCCTAGGCAGTGGGTGTCAAGG - Intergenic
936150949 2:110022219-110022241 AGGCAAAGGAGTGGGTGTGAGGG - Intergenic
936193727 2:110349150-110349172 AGGCAAAGGAGTGGGTGTGAGGG + Intergenic
939290059 2:140182416-140182438 TGCCTATTGAGTGGTTCAGATGG + Intergenic
945575442 2:211524463-211524485 AGCCCATGGAGTGGGTGGGAAGG + Intronic
945813660 2:214577460-214577482 TCCCTAAGGAGTGGGAGTGAGGG + Exonic
945934346 2:215887617-215887639 GGCCTGTGGAATGGGTTTGAGGG - Intergenic
1169966184 20:11220231-11220253 AGCCTATAGAGTTGGTGGGAAGG - Intergenic
1172650825 20:36500310-36500332 TGCTGATGGAGTTGGGGTGAGGG - Exonic
1173351124 20:42246469-42246491 TGCCTGTTGATTGGGTCTGATGG + Intronic
1173358712 20:42320230-42320252 AGCCTATGGAGAGGTTCTGAGGG - Intronic
1174173072 20:48628945-48628967 TGTCTGGGGAGTGGGGGTGAGGG + Intronic
1175493800 20:59398471-59398493 TGCATGTGGAGGGGGTGTGGGGG - Intergenic
1177016624 21:15797569-15797591 TTCCTTTGGTGTGGGTGTGCTGG - Intronic
1177718184 21:24867291-24867313 TACCTATGGAGAGGGCGTGAGGG - Intergenic
1179769738 21:43605777-43605799 TGTTTATGGTGTGAGTGTGAGGG - Intronic
1179791450 21:43758113-43758135 TGCCCCTGCAGTGGGTGTTACGG + Exonic
1179908461 21:44436003-44436025 TGAGTATGGAGAGGGTCTGAGGG - Intronic
1180035347 21:45245510-45245532 CTCCTATGGGGTGGGGGTGAGGG + Intergenic
1180035354 21:45245539-45245561 TGCCTATGGAGTGAGGGTCAGGG + Intergenic
1180035369 21:45245576-45245598 TGCCTATGGGGTGGGGGTGAGGG + Intergenic
1180035384 21:45245612-45245634 TGCCTATGGGGTGGGGATGAGGG + Intergenic
1180035400 21:45245648-45245670 TGCCTATGGGGTGGGGGTGAGGG + Intergenic
1180035414 21:45245684-45245706 TGCCTATGGGGTGGGGGTGAGGG + Intergenic
1180035430 21:45245720-45245742 TGCCTATGGGGTGGGGGTGAGGG + Intergenic
1180035443 21:45245756-45245778 TGCCTATGGGGTGGGGGTGAAGG + Intergenic
1180241729 21:46512058-46512080 TGCGTGTGGAAGGGGTGTGAGGG - Intronic
1180729326 22:17969896-17969918 TACCTATGGAATGAGTGTGAGGG + Intronic
1182697299 22:32205917-32205939 TGCCCATGGAGAGGGGGTGGGGG + Intergenic
1182698127 22:32209924-32209946 TGCCCATGGTGAGGGGGTGAGGG - Intergenic
1183087336 22:35494390-35494412 TACTTATGGAGTGTGTATGAAGG + Intergenic
1183311351 22:37111634-37111656 TGCTTATGGATTGGCTGGGATGG + Intergenic
1184253164 22:43272279-43272301 AGCGTGTGGAGTGGGTGGGAAGG - Intronic
1184457408 22:44618915-44618937 GGCCTGTGGAGTGAGTGTGTGGG + Intergenic
1184572918 22:45337922-45337944 TTCCTATGAAGAGGGTCTGATGG + Intronic
949548402 3:5092120-5092142 TGCCTATGAAGTGGGGCTGCTGG - Intergenic
950501219 3:13365161-13365183 TTCCTCTGGGGTGGGTGTGAAGG - Intronic
951064158 3:18244429-18244451 GGCTTGTGGAGTGGTTGTGAGGG + Intronic
951999252 3:28766897-28766919 TGTCAATGGAGTGAGTGAGAGGG - Intergenic
952607368 3:35165449-35165471 TGGCTATGGAGAGTGAGTGAAGG + Intergenic
954684434 3:52362691-52362713 TGCCTATGGATGTGGTGTGGAGG + Intronic
954835705 3:53465810-53465832 TGCCTCTGGAGGGGATGAGAAGG - Intergenic
954861453 3:53694294-53694316 TGCTTACTGAGTGGGAGTGAGGG + Intronic
955891718 3:63657284-63657306 TGCCTCTGGAATGGGGGTGCAGG - Intronic
956045356 3:65190352-65190374 TGCCTATGGAATAGGAGGGATGG - Intergenic
956751654 3:72348291-72348313 TGCCTTTGAGGTGGTTGTGAGGG - Intergenic
956821110 3:72955070-72955092 TGTGTAAGGAGTGGGTGTAAAGG - Intronic
961946382 3:130693483-130693505 AGCCATTGTAGTGGGTGTGAAGG + Intronic
962094879 3:132283449-132283471 TGCCTGTGGAGTGGTGGAGATGG - Intronic
964065656 3:152575580-152575602 TGCCTATGCTGTGGTTGTGTTGG - Intergenic
967105379 3:186251266-186251288 TGCCCATGGAGTGAGTGGAATGG + Intronic
973162150 4:47032219-47032241 TGACTATGCAGAGGGTGTGTCGG - Intronic
973930375 4:55787381-55787403 TGTCTATAGAGTGGGAGAGATGG + Intergenic
974628732 4:64456601-64456623 TGTCTGTGGAGTGGGTTTTAGGG - Intergenic
975384256 4:73737246-73737268 TTCCTATGGCGTGGGTGGGAGGG + Intergenic
976455831 4:85246185-85246207 TCCCTAGGGCGTGGGTGTGCAGG + Intergenic
980470194 4:133240492-133240514 AACCCATGGAGTGGGTGGGAAGG + Intergenic
980583206 4:134781594-134781616 TGTTTCTGGACTGGGTGTGAAGG - Intergenic
980739836 4:136935820-136935842 TGCGTGTGGAGGGGGTGTGGGGG - Intergenic
981908840 4:149954498-149954520 TGCCTGTGGGGAGGGTGTCAGGG - Intergenic
982017427 4:151168809-151168831 TGCTTTTTGGGTGGGTGTGAAGG + Intronic
983912002 4:173250451-173250473 TGCTGATGGACTGGATGTGAGGG - Intronic
985283017 4:188305763-188305785 TGCCAATGGAGTGGGTTATAGGG - Intergenic
985717342 5:1470017-1470039 TTGCTATGGAGAGGGTGTGCTGG + Intronic
986019874 5:3791113-3791135 TGCCTCTGGAGTGGATGTGTTGG + Intergenic
990507547 5:56459321-56459343 TGCCCTTGGAGTGGGGGTGGGGG + Intronic
992617664 5:78560564-78560586 ATCCTAGGGAGTGGTTGTGAGGG + Intronic
998216554 5:140242009-140242031 TGCCTGTGAAGTGGGAATGATGG + Intronic
998478429 5:142441206-142441228 TGCCAAGGAAGTGGTTGTGAGGG - Intergenic
998635481 5:143949900-143949922 TGCCAAGGGTGTGGGGGTGAGGG - Intergenic
998680535 5:144461735-144461757 TGGCTAAAGAGTGAGTGTGAGGG - Intronic
999234053 5:150079958-150079980 TGACTGGGGACTGGGTGTGATGG - Intronic
999343715 5:150796238-150796260 TGCCAAGGGAGTTGGGGTGATGG + Exonic
999873779 5:155779832-155779854 TGCTTTTGTAGTGGGTATGAAGG + Intergenic
1001604532 5:172950566-172950588 TGACTATGTAGTGGGTATTATGG + Intronic
1001654444 5:173338726-173338748 TGGCTTTGGTGTGGGTGGGAAGG + Intergenic
1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG + Intergenic
1004233678 6:13854800-13854822 AGCCTGTGGAGTGGGTGGGAGGG + Intergenic
1004753581 6:18587843-18587865 TGACTATGGGTTGGGTGTGGTGG + Intergenic
1005417975 6:25621764-25621786 TGGCTATGGAGAGCGTGTGGGGG + Intergenic
1006359250 6:33578335-33578357 TGCCTGTAAAGTGGGTATGATGG - Intronic
1007096231 6:39214893-39214915 TGCCTTTGGGGTTGGTGGGAAGG - Intronic
1008511168 6:52277094-52277116 CTCCTCTGGAGTGGGTCTGACGG - Exonic
1010212523 6:73373424-73373446 TGTCTCTACAGTGGGTGTGATGG - Intronic
1010258780 6:73791077-73791099 TGCCTATGGATTGGTTGTTTGGG - Intronic
1011625976 6:89284176-89284198 TACCTTGGGAGGGGGTGTGAGGG + Intronic
1012279155 6:97308855-97308877 TGACTATCGGCTGGGTGTGATGG + Intergenic
1017845426 6:158254079-158254101 TGCCTATGGAGGAGGGGTCAAGG + Intronic
1017907917 6:158769532-158769554 TGGCCATGGAGTGGGGGTGGCGG - Intronic
1019025000 6:168952537-168952559 TGTCTATAGAGTGGGAGTCATGG - Intergenic
1019618712 7:1979128-1979150 ACCCCAGGGAGTGGGTGTGACGG + Intronic
1020964996 7:14854455-14854477 TGGTTATGGAGTGGGGGAGATGG + Intronic
1022585333 7:31603399-31603421 TGTCTGTGGAGTGGGTGGGGAGG - Intronic
1022627258 7:32050716-32050738 TGACTATGGAGAGGGTGAGTGGG - Intronic
1023473635 7:40552674-40552696 TGCCTATGGGGAAAGTGTGATGG - Intronic
1024009721 7:45257319-45257341 TGCCCATGGAGGGGGTGTGTAGG + Intergenic
1027747222 7:82091924-82091946 AGCCTATAGGGTTGGTGTGAAGG + Intronic
1028428310 7:90716253-90716275 CTCCTTTGGTGTGGGTGTGAGGG - Intronic
1031438121 7:121758289-121758311 TGTCTAAGGACTGGGAGTGAGGG - Intergenic
1032464596 7:132136111-132136133 TGGCTAGGGAGTGGGAGTGGGGG - Intronic
1032500748 7:132398002-132398024 AGCCTAAGCAGTGGGTCTGATGG - Intronic
1033491520 7:141848026-141848048 TGCCTACTGTGTGTGTGTGATGG - Intergenic
1035327834 7:158076307-158076329 TCCCTGGGGAGTGGGTGTGTGGG + Intronic
1035542863 8:455393-455415 TGACTTTGAAGTGGGTGCGAGGG + Intronic
1038446969 8:27611187-27611209 TGCAGATGGATTCGGTGTGAAGG - Intronic
1038460301 8:27710432-27710454 AGCTTAAGGAGTGGTTGTGAGGG - Intergenic
1038745074 8:30248010-30248032 TGGCTAGGGAGTAGGGGTGAGGG - Intergenic
1039128847 8:34237096-34237118 TGCATATGCAGTGGGAGTTAGGG + Intergenic
1042206151 8:66331901-66331923 TTCCTCTGGAGTGGGGGTGCAGG - Intergenic
1042346852 8:67736307-67736329 TGTCCATGAAGTGGGGGTGAGGG - Intronic
1043709918 8:83403222-83403244 AGCCCATGGAGTGGGTGGGTGGG - Intergenic
1044740663 8:95323098-95323120 TGCCTCTGCAGAGGATGTGATGG + Intergenic
1045474230 8:102539415-102539437 TGCTTTTGGGGTGGGGGTGAAGG + Intergenic
1046023020 8:108688983-108689005 TGCCAAGGGAATGGGGGTGATGG + Intronic
1047698060 8:127422895-127422917 TGGCTATGGCATGGCTGTGAAGG + Intergenic
1048425522 8:134319664-134319686 AGCCCAGGGAGAGGGTGTGAGGG + Intergenic
1049006023 8:139856207-139856229 GGCCTGTGGAGTGGGGGTGGAGG + Intronic
1050473050 9:6012787-6012809 TGCTTATGGCCTGGGTGTCATGG - Exonic
1051300988 9:15650423-15650445 TAGCCATGTAGTGGGTGTGAAGG + Intronic
1051676007 9:19558873-19558895 TGCCTATATAGTGAGTGTGTGGG + Intronic
1051902643 9:22059651-22059673 TGCCTAGGGACTGTGTGTGGGGG + Intergenic
1052332108 9:27280828-27280850 TTCCTACGGACTGGCTGTGACGG - Intergenic
1052662327 9:31449809-31449831 TGCCTGTGGTGTGTGTGTGTGGG - Intergenic
1053234538 9:36441054-36441076 TGACTATGGAGTGGGAGAGTCGG + Intronic
1056268792 9:84925908-84925930 TGCCTGTGGAGTGTGTGAGCTGG + Intronic
1056639365 9:88357538-88357560 TGCCTATGGACTTGGTGTCCTGG + Intergenic
1056772023 9:89484520-89484542 TGTGTATGGACTGGGTGTGTGGG + Intronic
1056873631 9:90306930-90306952 TGCCAATGGAGTGGCTATGAAGG - Intergenic
1058648973 9:107157323-107157345 TGCTGATGGACTGGATGTGAGGG - Intergenic
1061252667 9:129435925-129435947 TGCATATGGAGGGGAAGTGATGG + Intergenic
1061317692 9:129807047-129807069 TACCTAGCGAGTGGGGGTGAGGG + Intronic
1062032417 9:134367670-134367692 TGCCTGTGCAGGGGGTGTGTGGG + Intronic
1185761666 X:2693334-2693356 TGTCTATGGGGTGGGTGGGTAGG + Intronic
1187211732 X:17238636-17238658 TGCATATGGAGTTGGTGGCAGGG + Intergenic
1187927087 X:24260467-24260489 TGGCAATGGAGTGGGTGGCAGGG - Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1190709325 X:53055019-53055041 TGTCTATGGAGTGTGTGTATGGG + Intronic
1190757363 X:53412607-53412629 AGCCAATGGAGTGGCTGAGAAGG - Intronic
1191729115 X:64314775-64314797 TGGGTATCGAGTGGGTGGGATGG + Intronic
1192507343 X:71696811-71696833 TGTCTCTGGAGTGGGTGTCGGGG + Intergenic
1192519353 X:71784741-71784763 TGTCTCTGGAGTGGGTGTCGGGG - Intergenic
1192618730 X:72655118-72655140 TGCATATGGCCTGGGTGTGGTGG + Intronic
1193298493 X:79860616-79860638 TGTCTCTGAAGTGGATGTGAGGG - Intergenic
1195598621 X:106721410-106721432 TCTCTATAGAGTCGGTGTGATGG + Intronic
1199025957 X:142938241-142938263 TGTCTAGGGATTTGGTGTGAAGG - Intergenic
1199981457 X:152922831-152922853 TGGCTTGTGAGTGGGTGTGATGG + Intronic
1200152978 X:153960294-153960316 TACATTTGGAGTGGGCGTGACGG - Exonic