ID: 901192984

View in Genome Browser
Species Human (GRCh38)
Location 1:7423533-7423555
Sequence TAATGACACCCGGCGGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901192984_901192992 3 Left 901192984 1:7423533-7423555 CCTCCCCCCGCCGGGTGTCATTA 0: 1
1: 0
2: 1
3: 4
4: 75
Right 901192992 1:7423559-7423581 CATTCTCTATTGTTCTACTTAGG 0: 1
1: 0
2: 3
3: 23
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901192984 Original CRISPR TAATGACACCCGGCGGGGGG AGG (reversed) Intronic
900335450 1:2160846-2160868 CAATCACCCCCGGCGGGGCGGGG - Intronic
900707032 1:4087227-4087249 TGATGACACCCAGCTGGGTGGGG + Intergenic
901192984 1:7423533-7423555 TAATGACACCCGGCGGGGGGAGG - Intronic
901429280 1:9202745-9202767 TAAATTCAACCGGCGGGGGGCGG - Intergenic
901722726 1:11212959-11212981 TAAGGACACGCAGCGGGTGGTGG + Intronic
906106318 1:43295050-43295072 TAATGACACCCGGCTGGGTGCGG + Intergenic
907470591 1:54671095-54671117 TAAAGACACCCAGCTGGGCGCGG + Intronic
908817200 1:68046814-68046836 TGATGACACCCACCGGGAGGTGG - Exonic
915561255 1:156689598-156689620 TGATGCCACCCGGCTGGGGCAGG - Intergenic
916668597 1:166990171-166990193 TAATGAGCCTTGGCGGGGGGTGG + Intronic
1067288552 10:44924813-44924835 GAATGCCACCTGGCGGGAGGAGG - Intronic
1071997884 10:91164172-91164194 TGATGACGCCCGGAGGGGCGGGG + Intronic
1072915126 10:99533082-99533104 TAATAAATCCCGGCGGGGGCGGG - Exonic
1075608252 10:123831917-123831939 TAATGACATCCTGTGGGTGGAGG + Intronic
1075738940 10:124681693-124681715 TAAGGACACACGGCTGGGAGCGG + Exonic
1079335219 11:19564842-19564864 TAATGACACTGGGCCGGGCGTGG + Intronic
1080647063 11:34195062-34195084 CAAAGATGCCCGGCGGGGGGGGG + Intronic
1080659577 11:34285100-34285122 TAATTAGACCAGGCGGAGGGGGG + Intronic
1081451091 11:43171666-43171688 TAATGTCACATTGCGGGGGGGGG - Intergenic
1089573831 11:119427396-119427418 CATGGACACCGGGCGGGGGGGGG - Intergenic
1089662306 11:119993557-119993579 TAAAGACAGCCAGCGGGGGCTGG + Intergenic
1091394348 12:144371-144393 GAATGTCACCAGGCGGGGGCAGG - Intronic
1104854664 12:131896077-131896099 GACTGACGCCCGGCGGGGAGGGG - Intronic
1113429526 13:110237386-110237408 GAATGTCTCCTGGCGGGGGGTGG - Intronic
1119554093 14:75540236-75540258 TAATGGCTCCCGGCGGGTGAGGG + Intronic
1120167238 14:81214353-81214375 TACTGAGACCCGGCCGGGAGCGG + Intronic
1132946000 16:2531781-2531803 AAGTGACACCCGGCCGGGCGCGG - Intergenic
1135609651 16:23855135-23855157 TAAAGAGAGCCGGCGGGGGAGGG + Intronic
1139941572 16:70609484-70609506 TGATGACACCCGGAGGTGTGGGG + Intronic
1142073076 16:88102065-88102087 TAAGGACACTGGGCGGGGGGCGG - Intronic
1144759743 17:17700610-17700632 AAACGACGCCCGGCGGGGAGGGG + Intronic
1144916451 17:18727511-18727533 CACCGACACCTGGCGGGGGGTGG - Exonic
1148486900 17:47996417-47996439 TAATGAGATCTGGCGGGGGAGGG + Intergenic
1148580500 17:48740170-48740192 TAAAGAAACCCGGCTGGGAGTGG + Intergenic
1150242699 17:63648072-63648094 TAATGACACACTGATGGGGGTGG + Intronic
1151574351 17:74944266-74944288 TGATGCCACCCGGGGCGGGGTGG - Intronic
1153000289 18:448997-449019 AAATGACACCCAGCGGGGAAAGG + Intronic
1153482721 18:5563691-5563713 TAATGGCACCCAACTGGGGGTGG + Intronic
1163624596 19:18381963-18381985 TAAGGACACCAGGCTGGGCGCGG - Intronic
1164207178 19:23068721-23068743 TAATGTCACCTGGCCGGGTGCGG + Intergenic
1166320849 19:42018021-42018043 TACTGACTCCCGGCTGGGCGTGG + Intronic
930221479 2:48750811-48750833 AAATGACCCCCGGAGGGGGCAGG - Intronic
936052863 2:109238795-109238817 TGATGAAACCCGGCGAGGTGTGG + Intronic
945982946 2:216329088-216329110 TAAAAACACCCGGCCGGGCGCGG + Intronic
947263779 2:228253726-228253748 TAAGGACACCTGGCAGGGGAAGG - Intergenic
1171121753 20:22574892-22574914 TAATGTGAACCTGCGGGGGGCGG + Intergenic
1171946729 20:31385574-31385596 TAATGACACAGGGCTGGGTGTGG + Intronic
1178067428 21:28921101-28921123 TAATGACACAGGGGGTGGGGTGG - Intergenic
1183969623 22:41467154-41467176 AAATGACATCCGGCTGGGCGTGG - Intronic
1184242128 22:43216865-43216887 AGATGACACCTGGCGGGGGGTGG - Intronic
1184555892 22:45232950-45232972 CATTGACACCTGGCGGGGGTGGG - Intronic
1184743877 22:46444913-46444935 TAAAGACACCAGGCCGGGAGCGG + Intronic
949794646 3:7835073-7835095 CAGTGATACCGGGCGGGGGGGGG - Intergenic
950459045 3:13110298-13110320 TAAAGAAACCCGGCCGGGCGCGG + Intergenic
950741123 3:15052498-15052520 TAATGGCACCAGGCTGGGGCAGG + Exonic
968573136 4:1352928-1352950 AAGTGACACCCTGCGGGGAGTGG + Intronic
970195243 4:13545042-13545064 GAATGACACCCGGGCGGGAGGGG - Exonic
978098451 4:104807835-104807857 GAATGAGACTCGGCGGGGCGCGG - Intergenic
982088692 4:151861970-151861992 TAGTGAGTCCCGGCGGGGGCAGG + Intergenic
984973519 4:185210240-185210262 TACTTACCCCCGGCGGGCGGCGG - Intronic
988816590 5:34840228-34840250 AAATGACCCCGGGGGGGGGGGGG + Intronic
992004456 5:72463652-72463674 TTATGAGACCCGGAGGGGTGTGG + Intronic
993320492 5:86463539-86463561 TACTGACACCTGGTGGAGGGTGG - Intergenic
1001313930 5:170629642-170629664 TGATGCCACCCTGCAGGGGGAGG - Intronic
1006300850 6:33192884-33192906 TAATTACACGGGGCGGGGTGAGG - Intergenic
1013793124 6:113858145-113858167 AAATGAAACCTGGCTGGGGGCGG - Intronic
1015149059 6:130019185-130019207 TCGTGACACCGGGCGCGGGGTGG + Intronic
1018529312 6:164745677-164745699 TAGTAACACCCGGCCGGGCGCGG - Intergenic
1019399003 7:840450-840472 CAGTGACACCCGGCAGAGGGAGG - Intronic
1020137231 7:5594150-5594172 CCAGGACAGCCGGCGGGGGGAGG - Intronic
1025986651 7:66458778-66458800 TAATGAGACCTCGCGGGGAGAGG + Intergenic
1026166811 7:67917506-67917528 TTATGAGACCTGGCAGGGGGCGG + Intergenic
1029092162 7:98056911-98056933 TAATGACTCCCTGGGGGTGGCGG + Intergenic
1034559459 7:151870791-151870813 TGAGGCCACGCGGCGGGGGGAGG + Intronic
1038841899 8:31191924-31191946 TAATAACACCAGGCGGGGAGTGG - Intergenic
1045068686 8:98477689-98477711 TCATCACACTTGGCGGGGGGGGG + Intronic
1053492832 9:38523471-38523493 TAATGACAGCTGGTGTGGGGAGG - Intergenic
1203760559 EBV:11157-11179 TAATAACACCAGGCGGGGCTGGG + Intergenic
1187367542 X:18677008-18677030 TGATGACACCTTGCGAGGGGCGG - Intronic
1195100744 X:101552002-101552024 TAATGACACGGGGTGGGGGGGGG + Intronic
1196899855 X:120371956-120371978 TAATGACACTTGGCTGGGCGCGG - Intronic