ID: 901193324

View in Genome Browser
Species Human (GRCh38)
Location 1:7425504-7425526
Sequence TGCCATGGAGGCTGCTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 1, 2: 6, 3: 39, 4: 260}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901193324_901193337 28 Left 901193324 1:7425504-7425526 CCTTCAGAGCAGCCTCCATGGCA 0: 1
1: 1
2: 6
3: 39
4: 260
Right 901193337 1:7425555-7425577 CAGGTGGGAAGCTATGGGTCGGG 0: 1
1: 1
2: 0
3: 15
4: 202
901193324_901193331 12 Left 901193324 1:7425504-7425526 CCTTCAGAGCAGCCTCCATGGCA 0: 1
1: 1
2: 6
3: 39
4: 260
Right 901193331 1:7425539-7425561 GTGTGAATGAGGCTGCCAGGTGG 0: 1
1: 0
2: 3
3: 29
4: 274
901193324_901193333 22 Left 901193324 1:7425504-7425526 CCTTCAGAGCAGCCTCCATGGCA 0: 1
1: 1
2: 6
3: 39
4: 260
Right 901193333 1:7425549-7425571 GGCTGCCAGGTGGGAAGCTATGG 0: 1
1: 0
2: 4
3: 22
4: 233
901193324_901193330 9 Left 901193324 1:7425504-7425526 CCTTCAGAGCAGCCTCCATGGCA 0: 1
1: 1
2: 6
3: 39
4: 260
Right 901193330 1:7425536-7425558 AGAGTGTGAATGAGGCTGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 294
901193324_901193329 1 Left 901193324 1:7425504-7425526 CCTTCAGAGCAGCCTCCATGGCA 0: 1
1: 1
2: 6
3: 39
4: 260
Right 901193329 1:7425528-7425550 ATAAAGGGAGAGTGTGAATGAGG 0: 1
1: 1
2: 1
3: 41
4: 459
901193324_901193334 23 Left 901193324 1:7425504-7425526 CCTTCAGAGCAGCCTCCATGGCA 0: 1
1: 1
2: 6
3: 39
4: 260
Right 901193334 1:7425550-7425572 GCTGCCAGGTGGGAAGCTATGGG 0: 1
1: 0
2: 0
3: 11
4: 188
901193324_901193338 29 Left 901193324 1:7425504-7425526 CCTTCAGAGCAGCCTCCATGGCA 0: 1
1: 1
2: 6
3: 39
4: 260
Right 901193338 1:7425556-7425578 AGGTGGGAAGCTATGGGTCGGGG 0: 1
1: 0
2: 0
3: 4
4: 155
901193324_901193332 13 Left 901193324 1:7425504-7425526 CCTTCAGAGCAGCCTCCATGGCA 0: 1
1: 1
2: 6
3: 39
4: 260
Right 901193332 1:7425540-7425562 TGTGAATGAGGCTGCCAGGTGGG 0: 1
1: 0
2: 2
3: 33
4: 316
901193324_901193336 27 Left 901193324 1:7425504-7425526 CCTTCAGAGCAGCCTCCATGGCA 0: 1
1: 1
2: 6
3: 39
4: 260
Right 901193336 1:7425554-7425576 CCAGGTGGGAAGCTATGGGTCGG 0: 1
1: 0
2: 3
3: 21
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901193324 Original CRISPR TGCCATGGAGGCTGCTCTGA AGG (reversed) Intronic