ID: 901196936

View in Genome Browser
Species Human (GRCh38)
Location 1:7445517-7445539
Sequence CACCCAAGGTGACCCTGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901196929_901196936 -6 Left 901196929 1:7445500-7445522 CCCAGCCAGAGCAGAACCACCCA 0: 1
1: 0
2: 20
3: 91
4: 398
Right 901196936 1:7445517-7445539 CACCCAAGGTGACCCTGGACGGG 0: 1
1: 0
2: 0
3: 14
4: 171
901196926_901196936 20 Left 901196926 1:7445474-7445496 CCAGTGTGGCCCACAGGGAACGA 0: 1
1: 0
2: 0
3: 5
4: 140
Right 901196936 1:7445517-7445539 CACCCAAGGTGACCCTGGACGGG 0: 1
1: 0
2: 0
3: 14
4: 171
901196928_901196936 10 Left 901196928 1:7445484-7445506 CCACAGGGAACGAATGCCCAGCC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 901196936 1:7445517-7445539 CACCCAAGGTGACCCTGGACGGG 0: 1
1: 0
2: 0
3: 14
4: 171
901196927_901196936 11 Left 901196927 1:7445483-7445505 CCCACAGGGAACGAATGCCCAGC 0: 1
1: 0
2: 1
3: 6
4: 124
Right 901196936 1:7445517-7445539 CACCCAAGGTGACCCTGGACGGG 0: 1
1: 0
2: 0
3: 14
4: 171
901196930_901196936 -7 Left 901196930 1:7445501-7445523 CCAGCCAGAGCAGAACCACCCAA 0: 1
1: 0
2: 0
3: 15
4: 185
Right 901196936 1:7445517-7445539 CACCCAAGGTGACCCTGGACGGG 0: 1
1: 0
2: 0
3: 14
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901196936 Original CRISPR CACCCAAGGTGACCCTGGAC GGG Intronic
901196936 1:7445517-7445539 CACCCAAGGTGACCCTGGACGGG + Intronic
901416815 1:9122048-9122070 CACCCCTGCTGACCCTGGTCTGG + Intronic
902802303 1:18838114-18838136 CATCCCAGGTGACCCAGGAGAGG + Intergenic
905062089 1:35148903-35148925 CACCCACGGTGTGCCTGTACCGG - Intergenic
905796025 1:40817194-40817216 CAGCCAAGGTGCCCCTGGCAGGG - Intronic
906065208 1:42975554-42975576 CACCCTAGGTCACACTGGAAAGG - Intergenic
910267415 1:85352361-85352383 CACCCTTGATGACCCTGAACTGG + Intronic
910515738 1:88057918-88057940 CCCCAAAGATGACCCTGGTCCGG + Intergenic
910853291 1:91669823-91669845 CACCCATGGTGTGCCTGTACTGG - Intergenic
912053312 1:105560639-105560661 CACCCAAGGTGAGCCTACCCTGG - Intergenic
916078949 1:161220117-161220139 CTTGCAAGGTGACCTTGGACAGG - Intronic
917585896 1:176426085-176426107 AATCCAAGGTGACCAGGGACTGG - Intergenic
918796478 1:188904245-188904267 CACTCAAGGTAACTCTGGAGAGG + Intergenic
920061750 1:203231543-203231565 CATCTCAGGTGACCCTGAACAGG - Intronic
920517167 1:206593779-206593801 CCCCCCAGGTGACCGTGGTCCGG - Exonic
921074407 1:211687951-211687973 CACCCATGGTGTGCCTGTACCGG + Intergenic
921927006 1:220718942-220718964 CACCCACGGTGTGCCTGTACCGG + Intergenic
923238407 1:232057387-232057409 CACCCACGGGGATCCTGGAGAGG - Intergenic
1063685696 10:8235635-8235657 CACCTAAGGTGAACCTTGACAGG + Intergenic
1066389803 10:34969540-34969562 CACCCACGGTGTGCCTGTACCGG + Intergenic
1067171436 10:43910161-43910183 CAAGCAGGGTGACCCAGGACAGG - Intergenic
1068237584 10:54259296-54259318 GACCTAAGGTGACCCCAGACAGG - Intronic
1068672019 10:59733135-59733157 CACCCATGGTGTGCCTGTACCGG - Intronic
1069683973 10:70305253-70305275 CAACCCAAGTGACCATGGACAGG - Intronic
1070586465 10:77770585-77770607 CCCCCTAGGAGACCCTGGAATGG + Intergenic
1070783884 10:79152080-79152102 CACCAGAGGTGACCTTGGGCAGG + Intronic
1073052467 10:100676991-100677013 CTCAAAAGGTGTCCCTGGACTGG + Intergenic
1074088005 10:110223324-110223346 CTCCCAAAGTGTCCCTGGCCAGG - Intronic
1075960883 10:126567006-126567028 CACCAAAGGTGGCCCTGGGTGGG + Intronic
1076356132 10:129855062-129855084 AACCCAGGGTGACCCTAGGCAGG - Intronic
1076533142 10:131158956-131158978 TCCCCCAGGTGACCCTGAACTGG + Intronic
1077283422 11:1755554-1755576 CAGCCAAGGTGCTCCTGGGCAGG + Intronic
1079005413 11:16788517-16788539 GACCTAAGGTGACTGTGGACAGG + Exonic
1083774479 11:64887831-64887853 TACCCAAGGTGGCCCTGGTGGGG - Intronic
1085239497 11:75040701-75040723 CACCCATGGTGTGCCTGTACCGG + Intergenic
1085239514 11:75040817-75040839 CACCCATGGTGTGCCTGTACCGG + Intergenic
1086973717 11:93110076-93110098 CACCCACGGTGTGCCTGTACTGG - Intergenic
1089620276 11:119718158-119718180 CACCCTGGGTGACCCTCGAGAGG + Intronic
1089844693 11:121449431-121449453 CAGGCAAGGTCACCCAGGACAGG - Intergenic
1090225477 11:125069710-125069732 AACAAAAGGTGCCCCTGGACAGG + Intronic
1091121955 11:133064527-133064549 CACACAAGGTGGCCCTGCAGCGG - Intronic
1092415891 12:8290276-8290298 CACCCACGGTGTGCCTGTACTGG - Intergenic
1096000547 12:48126209-48126231 CAGCCAAGGAGACTCTGGCCAGG + Intronic
1096207481 12:49735016-49735038 CACCCACGGTGTGCCTGTACCGG + Intronic
1097573041 12:61356679-61356701 GGCCCCAGGTGACCCTGTACAGG + Intergenic
1103563933 12:121806098-121806120 CACCAAAGGTGAGCCTGGCAGGG + Exonic
1107660506 13:42634392-42634414 GACCCAAGGTGTCCCTCAACAGG - Intergenic
1108092651 13:46865529-46865551 CAGTCCAGGTGACCCAGGACTGG - Intronic
1112005436 13:95249634-95249656 CACCTAAGTTGAAGCTGGACTGG - Intronic
1112210805 13:97375237-97375259 CTCCCAAGGTCAGACTGGACTGG + Intronic
1112363781 13:98740277-98740299 CACAGCGGGTGACCCTGGACAGG - Intronic
1113566497 13:111322599-111322621 TGCCCAAGCTGACCCTGGGCTGG + Intronic
1113966699 13:114156575-114156597 CAAGCAAGGAGACCCAGGACAGG - Intergenic
1115650681 14:35400871-35400893 CCTGCAAGGTGACCCTAGACAGG + Intergenic
1117308790 14:54501762-54501784 CACCCCACCTGACACTGGACAGG + Intergenic
1119225427 14:72941399-72941421 CACCCGTGGTGACCCAGGGCTGG - Intronic
1119880022 14:78092483-78092505 CCCCCAAGGTGGCCCTGGTGAGG - Intergenic
1122139164 14:99652156-99652178 CGCCCAAGGTAACCTTGGGCTGG + Intronic
1122983473 14:105201850-105201872 CACCCCAGCTCACCCTGGACAGG - Intergenic
1128647018 15:69385009-69385031 CACCCATTGGGAACCTGGACAGG - Intronic
1129474512 15:75775875-75775897 CACCCAAAGTCACCCTGGGGTGG - Intergenic
1131381898 15:91971098-91971120 CAAACAAGGTGACCTTGGCCGGG + Intronic
1132476818 16:143451-143473 GACCCTCGGTGACCCTGAACAGG - Intergenic
1132875283 16:2134426-2134448 CACCCAAGGAGACACTGTCCCGG + Intronic
1133438258 16:5798844-5798866 CACCCAAGCTGACGCTGGAGGGG - Intergenic
1133565848 16:6992541-6992563 AACCCAAGCTGACCTTGGAAGGG - Intronic
1134554227 16:15153271-15153293 CACCCAAGGAGACACTGTCCCGG + Intergenic
1137725425 16:50653555-50653577 CAGCCAAGGTGAGCCGGGCCTGG - Intergenic
1138348696 16:56335170-56335192 CCCCCAAGGTGACCTTGGAAGGG - Intronic
1138727192 16:59152673-59152695 CAGCCAACATGACCCTGGCCAGG - Intergenic
1140905121 16:79402961-79402983 CACCCATGGTTACCCTGTTCTGG + Intergenic
1142908228 17:3063100-3063122 CACAGAAGGTCACCCTGGTCAGG + Exonic
1142926337 17:3241161-3241183 CACAGAAGGTCACCCTGGTCAGG - Intergenic
1143270371 17:5670739-5670761 CAGGCAAGGAGACCCTGGGCAGG + Intergenic
1144813641 17:18018344-18018366 CAACCCAGGTGCCCCTGGCCTGG - Exonic
1145210778 17:21011485-21011507 CTCCCAAGGTGGCCCTGGGGAGG + Intronic
1145235036 17:21202287-21202309 GCCCCAAGGTGTCCCTGGCCTGG - Intronic
1147163866 17:38583017-38583039 CACCCAGGGTGTCTCTGGCCTGG - Intronic
1147979271 17:44264830-44264852 CACCTAAGGTGGCCCCAGACTGG + Intronic
1151180723 17:72325627-72325649 GACACAAGGTGAACCTGGGCAGG - Intergenic
1151564280 17:74888924-74888946 TCCCCATGGTGACCCAGGACAGG + Intronic
1152228398 17:79103036-79103058 CACCCCAGGGAACCCTGGCCAGG + Intronic
1152321711 17:79611552-79611574 CAACCCAGGTGACCCTTAACAGG + Intergenic
1152563345 17:81089500-81089522 CACTCAAGGGGCCCCAGGACGGG - Intronic
1152644339 17:81461836-81461858 CAGCCACCGTGGCCCTGGACAGG - Exonic
1160914362 19:1489778-1489800 ACCCCAAGGTGAGCCTGGCCTGG - Exonic
1161267676 19:3372348-3372370 AACTCAGGGAGACCCTGGACAGG - Intronic
1161289056 19:3483148-3483170 CACCCAGGGTGACCCAGCATCGG + Intergenic
1161534380 19:4809971-4809993 CCCCAAAGGGGACCCTAGACTGG - Intergenic
1162048486 19:8017524-8017546 CACCCAACGTGACAAGGGACGGG + Intronic
1162281693 19:9703132-9703154 CACCCACGGTGTGCCTGTACTGG + Intergenic
1163822092 19:19501902-19501924 CACCCTCGGTCACCCTGGGCCGG + Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1166809175 19:45505699-45505721 TACCCAAGGTCACACTGAACTGG + Intergenic
1168048476 19:53810957-53810979 CACACAAGGTGATGCTGGACTGG - Exonic
926491701 2:13532637-13532659 CACCCACGGTGTGCCTGTACCGG - Intergenic
927435059 2:23059596-23059618 CAGCTAAGGGGACCCAGGACAGG + Intergenic
935094784 2:99934141-99934163 CACCAGAGGTGCCCTTGGACTGG + Intronic
936077063 2:109408326-109408348 GACCCATGATGGCCCTGGACGGG + Intronic
938778473 2:134562481-134562503 CACCCAAGGTCATCCTTGCCAGG + Intronic
946182663 2:217958316-217958338 CACCCAAGGTGCCCCTTCATGGG + Intronic
947118459 2:226795642-226795664 CAGCCATGGTGGCCCTGGGCAGG + Exonic
947594374 2:231401523-231401545 CACCCACGGTGTGCCTGTACCGG + Intergenic
948893392 2:240917525-240917547 CACCCACGTGGACCCTGGTCAGG + Intergenic
1171407299 20:24920051-24920073 CACCCATGGTGTGCCTGTACTGG + Intergenic
1174454204 20:50638163-50638185 CACCCAAGGTGTCTCTGCAGAGG + Intronic
1174472634 20:50771882-50771904 CACCCAAGGTGTCTCTGCAGAGG - Intergenic
1174661774 20:52219979-52220001 CACCCAAAGTGATCCTGACCAGG + Intergenic
1176032593 20:63020816-63020838 CACCCAAGGCCAGCCTGGAAAGG - Intergenic
1176171798 20:63699537-63699559 CACCCTGGGTGACACTGGGCAGG + Exonic
1178488008 21:33030973-33030995 CGCCGAGGGTGGCCCTGGACTGG + Intergenic
1178601787 21:34000722-34000744 CACCCAAGGCCACCTTGGAGGGG - Intergenic
1178924915 21:36766797-36766819 CACCCCAGCTGGCCCTGGGCTGG - Intronic
1181553354 22:23653494-23653516 CTCCCAAGGTGACTCTGGGAAGG - Intergenic
1183731871 22:39622739-39622761 CACTCAAGGAGGACCTGGACTGG - Intronic
1184097887 22:42326331-42326353 AATCCAGGGTGACCCTGGAGAGG - Intronic
949561349 3:5205603-5205625 CAACCAAAGTGAGCCTGGAAGGG - Intronic
949916461 3:8968360-8968382 AAACCATGGTGACCCTGTACAGG + Intergenic
952159643 3:30680940-30680962 CACCAAAGGGGGCCCTGAACAGG - Intronic
954700792 3:52449932-52449954 CACCCAGAGTGACCCAGGAAGGG - Intergenic
956151605 3:66249331-66249353 TACCAAAGGAGACCCTGGAATGG - Intronic
956705492 3:71995480-71995502 CACCCACTGTGACCCTGAGCAGG - Intergenic
958148533 3:89658494-89658516 AATCCAAGGTGACCATGGACTGG - Intergenic
961454203 3:127016206-127016228 CACTCCTGGTGACCCTGGCCAGG - Intronic
961795214 3:129404068-129404090 CGCCAAGGGTGACCCGGGACTGG + Intronic
969198809 4:5585203-5585225 CAGCCAAGGTTCCCCTGGACAGG + Intronic
970993454 4:22238648-22238670 CACCCAAGGTGGCCCAGGTGGGG + Intergenic
971027222 4:22600159-22600181 CACCCATGGTGTGCCTGTACTGG + Intergenic
979029928 4:115630596-115630618 GACCCTAGGAGACCCTAGACAGG + Intergenic
981777428 4:148386033-148386055 GACCCAAGGTGGTCCTGTACTGG + Intronic
982662893 4:158228156-158228178 CACCCACGGTGTGCCTGTACTGG - Intronic
985517771 5:355736-355758 CACGCAGGGTGCCCCTGCACAGG - Intronic
986318624 5:6609415-6609437 CAGCCAAGGTGAACCCGGGCTGG + Intronic
990581987 5:57174180-57174202 CACCAGAGGTGCCCCTGGCCTGG - Intronic
996009787 5:118469273-118469295 TACCCAAGATTCCCCTGGACTGG + Intergenic
997640391 5:135445109-135445131 CTGCCAAGGAGACCCTGGAGGGG - Exonic
999617160 5:153436740-153436762 CACCTCAGGTGAGCCTGGAAGGG - Intergenic
1001351824 5:170975040-170975062 CACAAAAGGTGTGCCTGGACTGG - Intronic
1002094634 5:176823694-176823716 CAGTCAGGGAGACCCTGGACAGG + Intronic
1002827033 6:783367-783389 CACACACGGTGGCCCTTGACGGG - Intergenic
1003892057 6:10572334-10572356 CAACCAAAGTGAACCTGGACTGG + Intronic
1004104911 6:12658308-12658330 CACCCAAAGTGATGCTGTACTGG + Intergenic
1006032272 6:31185947-31185969 CACCCATGGTGTGCCTGTACTGG - Intergenic
1007239905 6:40417334-40417356 CTCCCAAGGTGTGCGTGGACAGG - Intronic
1012375843 6:98560642-98560664 CACTGAAGGTGACCTTGGGCTGG + Intergenic
1016916165 6:149246554-149246576 CACCGCAGGTGTTCCTGGACTGG + Intronic
1022306004 7:29147100-29147122 CAAGCAATGTGACCCTGGATGGG - Intronic
1024063817 7:45717054-45717076 AAACCAAGGTGTCGCTGGACTGG - Exonic
1024588122 7:50858552-50858574 CACCCAGGGTGACCTGAGACAGG + Intergenic
1027540621 7:79459556-79459578 CACCCACAGTGTCCCTGGACTGG - Intergenic
1029485892 7:100840006-100840028 CACCCATGGTGTGCCTGTACCGG + Intronic
1030638542 7:111977937-111977959 TGCCCAAGTTGAGCCTGGACTGG - Intronic
1036693394 8:10959073-10959095 CACCCAAAGTGACCCAGGAGAGG - Intronic
1041012615 8:53559216-53559238 AGCCCAAGGTGACCAGGGACTGG + Intergenic
1045659528 8:104422809-104422831 CAGCCAAGATGGCCCTGGGCAGG + Intronic
1045847806 8:106658113-106658135 CACCCGAGGTCCCCCTGGGCTGG - Intronic
1048091591 8:131247054-131247076 GACCCAGTGTGACCCTGGACAGG + Intergenic
1048577827 8:135706807-135706829 CCCCTATGGTGACCCTGGAGAGG + Intergenic
1048880296 8:138866974-138866996 CTCCCAAGGTGCCCTTGGATAGG - Intronic
1049465038 8:142747245-142747267 CTTCCAAGGTGACCCAGGATGGG + Intergenic
1050920036 9:11188792-11188814 CACCCCAGGTTACCCTGGCTTGG + Intergenic
1052798029 9:32942009-32942031 CACACAAGATGTCCCTGGACAGG + Intergenic
1052978524 9:34430012-34430034 CTCCCAAGCTGTCCCTGGCCAGG - Intronic
1053224137 9:36337138-36337160 CACCCAAGGTGACCAATGGCTGG + Exonic
1053593001 9:39533231-39533253 CAGCCACGAGGACCCTGGACGGG - Intergenic
1053850739 9:42287939-42287961 CAGCCACGAGGACCCTGGACGGG - Intergenic
1054573305 9:66832046-66832068 CAGCCACGAGGACCCTGGACGGG + Intergenic
1058712925 9:107696812-107696834 CACTGAAGGTGACACTCGACTGG + Intergenic
1060518415 9:124280073-124280095 GGCCCCAGCTGACCCTGGACAGG - Intronic
1060891107 9:127189065-127189087 CACCCAGTGTGTCCCTGGCCTGG - Intronic
1061163504 9:128909612-128909634 CCCCCAAGGTGACCTTGAGCCGG + Intronic
1061843168 9:133371903-133371925 CACCAAAGGTCACACTGGAGAGG + Intronic
1061859626 9:133461211-133461233 AACCCAAGGTGACCCTGAAAAGG - Intronic
1062224794 9:135443792-135443814 CACCCATGGTGTGCCTGTACCGG - Intergenic
1062290163 9:135790759-135790781 GAACAAAGGTGACCCAGGACGGG - Intronic
1062329166 9:136029347-136029369 CTCTCAAGGAGACCCTGGAGTGG - Intronic
1062480096 9:136747135-136747157 CAGCCCAGATGACCCAGGACAGG + Intronic
1062729607 9:138101721-138101743 CAGCCAAGGAGCCCCTGGTCTGG + Intronic
1190218447 X:48495488-48495510 CACCCCAGGTGGTCCTGGCCAGG + Intergenic
1192923596 X:75733811-75733833 AATCCAAGGTGACCGGGGACTGG - Intergenic
1193717065 X:84945457-84945479 CACCCATGGTGTGCCTGTACCGG + Intergenic
1194399929 X:93430486-93430508 CACCCATGGTGTGCCTGTACTGG + Intergenic
1199688910 X:150291251-150291273 CACCCAGGATGCCCCTGGCCAGG + Intergenic
1199746363 X:150774351-150774373 CTCCCAAAGTGTCCCTGGCCAGG + Intronic
1199864586 X:151831311-151831333 CAGGCAAGGTGACCGTGGACAGG - Intergenic
1201696460 Y:16832268-16832290 CACCCATGGTGTGCCTGTACTGG + Intergenic