ID: 901196997

View in Genome Browser
Species Human (GRCh38)
Location 1:7445794-7445816
Sequence CTGCTGCTACAGAGGGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901196991_901196997 8 Left 901196991 1:7445763-7445785 CCTCTTCCTAAGCGATGAACATC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 901196997 1:7445794-7445816 CTGCTGCTACAGAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 39
4: 210
901196992_901196997 2 Left 901196992 1:7445769-7445791 CCTAAGCGATGAACATCTCAATT 0: 1
1: 0
2: 0
3: 2
4: 108
Right 901196997 1:7445794-7445816 CTGCTGCTACAGAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 39
4: 210
901196990_901196997 11 Left 901196990 1:7445760-7445782 CCTCCTCTTCCTAAGCGATGAAC 0: 1
1: 0
2: 0
3: 3
4: 82
Right 901196997 1:7445794-7445816 CTGCTGCTACAGAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 39
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901196997 Original CRISPR CTGCTGCTACAGAGGGCCAG GGG Intronic
900314882 1:2051525-2051547 CTGCTGCTGCAGAGAGGGAGGGG + Intronic
900357078 1:2270166-2270188 TTGCTGCAAGAGAGGGACAGAGG + Intronic
900706849 1:4086296-4086318 CTGCAGCTGCAGAGGGCTGGTGG + Intergenic
901196997 1:7445794-7445816 CTGCTGCTACAGAGGGCCAGGGG + Intronic
902082170 1:13828720-13828742 CTGCTGCCACAGAGGTCTATGGG - Intergenic
902463489 1:16598594-16598616 CTGCTCCTAATGAGGGCCTGAGG + Intronic
903031140 1:20465211-20465233 CTGCTCCCACAGAGGCCAAGGGG - Intergenic
903158031 1:21462109-21462131 CTGCTCCTAATGAGGGCCTGAGG - Intronic
904840179 1:33367597-33367619 GAGTTGCTAAAGAGGGCCAGAGG + Intronic
905280173 1:36844071-36844093 CTGCTGGGAGAGAGGGCCAAAGG - Intronic
905794374 1:40807397-40807419 CTGCTGCTTCTCTGGGCCAGAGG - Intronic
906030842 1:42718814-42718836 CTGCTGCTAGAAAGGGACTGTGG + Intergenic
906566748 1:46806353-46806375 CTGCAGCTACAGTGCCCCAGGGG - Intronic
906903556 1:49864556-49864578 CAGCAGCTACACAGGGCAAGGGG + Intronic
907268153 1:53275234-53275256 CTGCTCCTGCAGAGGGCAGGTGG + Intronic
908484902 1:64581669-64581691 CTCCTGCTACACAGTCCCAGGGG - Intronic
910355404 1:86347079-86347101 CTGCTGCTACAGTGGGAAAACGG + Exonic
911525268 1:98976907-98976929 CTGCTGCTATGATGGGCCAGGGG - Intronic
913447137 1:118961542-118961564 CTTCTGCTTCAGAGAGTCAGAGG - Intronic
913544184 1:119851124-119851146 CTGCTCCTAATGAGGGCCTGAGG + Intergenic
914603352 1:149228686-149228708 CTGCTGCTGCAAAGGGCTACAGG - Intergenic
914842759 1:151262070-151262092 CTGCTGCTATAGGGGGCCTCTGG + Intronic
915812924 1:158935064-158935086 CTGGTGCTAAAGAGGTCCAGAGG + Intronic
916166887 1:161972819-161972841 CTGCTGGAAGAGAGGGCTAGAGG + Intergenic
916691060 1:167190483-167190505 ATGATGCAAAAGAGGGCCAGGGG - Intergenic
916890571 1:169108500-169108522 CTGCTGCGTCACAGGGGCAGGGG + Intronic
918238114 1:182599525-182599547 CTGCTGCAACGCAGGGTCAGGGG + Exonic
919698192 1:200601311-200601333 CTGCTGCTAAAAAGGGCCAGAGG + Intronic
921808044 1:219478380-219478402 CTGCTGCTGCTGAGGCCCTGGGG - Intergenic
923043135 1:230333915-230333937 CTGCTGGGACAGAAGGCCACAGG + Intronic
924157456 1:241193742-241193764 CTTCTGCTACAGAAAGTCAGAGG + Intronic
924608928 1:245558037-245558059 CTGCTTAGACACAGGGCCAGTGG + Intronic
1064060070 10:12129763-12129785 CTGCTGCTGGGGAGGCCCAGGGG - Exonic
1064147319 10:12835808-12835830 CTGCTGCTGCAGAGGGGGACTGG + Intergenic
1067020145 10:42789206-42789228 TTGATGCCACAGAGTGCCAGGGG - Intronic
1069566387 10:69466086-69466108 CTGCAGCTCCAGAGAGCCAGTGG - Intronic
1070139110 10:73723646-73723668 CTGATGCCACAGAGTGCCAAGGG + Intergenic
1071606575 10:86997275-86997297 CTGATGCCACAGAGTGCCAAGGG - Intergenic
1072683609 10:97524021-97524043 CTGCTGCTAAAGAAGGGCTGAGG - Intronic
1072924003 10:99600257-99600279 CTGCTGCTAGAGAGGGGCCTAGG - Intergenic
1073205453 10:101767048-101767070 TTGCTGCTACAAAGGGCCTCAGG - Intergenic
1074454562 10:113586081-113586103 CAGATGCACCAGAGGGCCAGGGG - Intronic
1075967936 10:126628855-126628877 CAGCCACTACAGAGGGGCAGGGG + Intronic
1077464815 11:2728685-2728707 CTGCTGGCCCAGAGTGCCAGGGG + Intronic
1081173289 11:39894084-39894106 CTGCTGCCCCCGTGGGCCAGAGG + Intergenic
1083626521 11:64074723-64074745 CTGCTGCCCCAGAGGCCCAGGGG + Intronic
1083636292 11:64122708-64122730 CTGGTGCTCCAGAGGCCAAGTGG + Intronic
1084086587 11:66857760-66857782 CTGCTGCTGCTGCTGGCCAGTGG + Exonic
1084965333 11:72741530-72741552 CTCCTCCCACAGAGGGCAAGGGG + Intronic
1085406323 11:76265182-76265204 CTGCTTAGACAGTGGGCCAGAGG + Intergenic
1088421146 11:109648386-109648408 CTGCTCCTACTGAGGGCCTCAGG - Intergenic
1089376148 11:117996214-117996236 CTGCTGCCAGAGTGGGCCAGAGG + Intronic
1089705331 11:120273652-120273674 CTGATGCAAGAGAGGCCCAGTGG + Intronic
1089787094 11:120915527-120915549 CTGCGGCTCCAGAGGCCCAGCGG - Intronic
1090426390 11:126609523-126609545 CTGCTGGGAGAGAGGGGCAGGGG + Intronic
1090754819 11:129780735-129780757 TTGGTGCTACAGAGGGCCCCTGG - Intergenic
1091674610 12:2479982-2480004 CTGGTGCCACAGAGGGGCAGGGG - Intronic
1092283105 12:7112247-7112269 CTGCTGGTATAGAGGACAAGGGG + Intergenic
1092296335 12:7202127-7202149 CTGCAGCTAGAGATGGTCAGGGG + Intronic
1092793452 12:12088816-12088838 CAGCTGCCACAGAGGCTCAGGGG + Intronic
1095725191 12:45444812-45444834 CTGCTGCAGCAGCAGGCCAGAGG - Intergenic
1095995020 12:48074738-48074760 CAGCTGCTACAGATGGTCACAGG - Exonic
1096215737 12:49796657-49796679 GTGCTACCTCAGAGGGCCAGGGG - Exonic
1099328170 12:81246097-81246119 CTGCTGCTGCAGAGAGCAAGTGG + Intronic
1107692773 13:42968569-42968591 CACCTGCTCCAGAGGCCCAGAGG + Intronic
1107803283 13:44130809-44130831 TTACTGCCACACAGGGCCAGGGG - Intergenic
1109423562 13:62144959-62144981 CTGCTGCTGCTGAGGGCCTCAGG + Intergenic
1112911058 13:104483969-104483991 CTGCTGCTCCAGGTGGACAGTGG + Intergenic
1113140344 13:107141379-107141401 CTGCTGCACCAGAGGCCCAGGGG - Intergenic
1113451744 13:110414951-110414973 CTGCTGCTACAGAAAGACAGGGG - Intronic
1113697066 13:112354353-112354375 CGGTGGCCACAGAGGGCCAGTGG - Intergenic
1113900531 13:113794326-113794348 ATGGTGCTACACAGGGACAGGGG - Intronic
1114716888 14:24836056-24836078 CTGCTGCTCAAGACAGCCAGTGG + Intronic
1115770466 14:36661031-36661053 ACGCTGCCACCGAGGGCCAGGGG + Intronic
1121955122 14:98206486-98206508 CAGTGGCAACAGAGGGCCAGAGG - Intergenic
1123029593 14:105445406-105445428 TTGCTGTTACAGACGGCCAATGG + Exonic
1125379965 15:39077199-39077221 TTGCTGCTAGAAAGGGCCGGAGG + Intergenic
1127435850 15:58957482-58957504 TTGCTGCTGTAGGGGGCCAGAGG + Intronic
1128246252 15:66134690-66134712 GTGCAGCTACAGGGGCCCAGCGG + Intronic
1129363033 15:75036453-75036475 CAGCTGCTTCAGTGGGTCAGAGG + Intronic
1132174993 15:99706142-99706164 CCTCTGCTACAGAAGGCCAGGGG + Intronic
1132387741 15:101412161-101412183 CTGTTGCTGCAGAGGACAAGGGG - Intronic
1139122999 16:64043133-64043155 CTGCATCTACACTGGGCCAGGGG + Intergenic
1139658878 16:68406526-68406548 CTGCCGCTACCGAGGGCGACAGG - Intronic
1144912480 17:18694911-18694933 CTGATGCTGCAGAGGTGCAGTGG - Intergenic
1145065991 17:19761854-19761876 CTGCAGCTGCAGAGGCCCACGGG - Intergenic
1150248164 17:63691336-63691358 CTGAGGCTCCAGAGGCCCAGAGG + Intronic
1151324287 17:73369340-73369362 CTGCTGGTGCAGCGGGCCCGGGG - Intronic
1151354449 17:73550198-73550220 CTGCTGCAGCAGGGGGCCAGGGG + Intronic
1151568791 17:74915779-74915801 CTGCAGCTACGGAGGGCAGGAGG - Intergenic
1155991717 18:32285266-32285288 GCCCTGCAACAGAGGGCCAGAGG + Intronic
1156484407 18:37455844-37455866 CTGATGCCACTGAGGGCCAGAGG + Intronic
1157175805 18:45450899-45450921 CAGCTGCTACTGTGGGCCATTGG + Intronic
1157806270 18:50659991-50660013 CTGCTCCTCCCCAGGGCCAGTGG + Intronic
1159471797 18:68867156-68867178 CTACTGCTACTGAGCTCCAGGGG - Intronic
1160858990 19:1229786-1229808 CGGCTGCTGCAGATGGACAGTGG - Exonic
1162572462 19:11481064-11481086 CTGCTGCTATAAAGGGCTGGGGG - Intronic
1163700113 19:18782656-18782678 CAGCTGCTGCTGAGTGCCAGTGG - Intergenic
1164269583 19:23659784-23659806 CTGCTTTTCCAGAGGCCCAGAGG + Intronic
1165715591 19:38043923-38043945 CTGCTGCCACACACAGCCAGAGG - Intronic
1166420154 19:42630412-42630434 GTGCTGCTGCAGGGTGCCAGTGG + Intronic
1167521081 19:49955538-49955560 CTGCTCCTACAGCTGGCCAGTGG - Intronic
1167607879 19:50491232-50491254 CTGCAGCTGCAGAGGCCCCGAGG - Intergenic
1167695718 19:51014738-51014760 CTGCTGATCCAGATGCCCAGAGG - Exonic
1202679150 1_KI270711v1_random:36041-36063 CTGCTCCTAATGAGGGCCTGAGG + Intergenic
925444032 2:3912097-3912119 CTGAAGCTAACGAGGGCCAGAGG - Intergenic
925776731 2:7343272-7343294 CTGCTGCATGACAGGGCCAGGGG - Intergenic
926120790 2:10240281-10240303 CTGCAGCTGCACCGGGCCAGAGG + Intergenic
926172384 2:10560511-10560533 CTGCTGCTGCAGCTGGCCTGGGG - Intergenic
926289664 2:11518504-11518526 CTGCTGCTGCAGTGGGCAGGGGG + Intergenic
927193576 2:20533133-20533155 CTGGTGCTGCAGAGAGCCAGTGG - Intergenic
927745075 2:25611555-25611577 CTGCAGATACAGAGGGCCAAGGG + Intronic
927917725 2:26947515-26947537 CTGCCCCTACACAGGGCCAGAGG - Exonic
928392090 2:30917958-30917980 CTGATGCTTCAGAGAGCCAGAGG - Intronic
936041032 2:109149651-109149673 CTGCTGCCACAGAGAGCCAAAGG - Intronic
936585704 2:113756276-113756298 CTGCTGCCACCGAGGGCAGGAGG + Intronic
937428095 2:121816506-121816528 CACCTGCCACAGAGGGCCAAGGG - Intergenic
937429201 2:121824511-121824533 CTGCTTGAAAAGAGGGCCAGAGG + Intergenic
938307108 2:130263851-130263873 CTGCAATTACAGTGGGCCAGTGG + Intergenic
938927326 2:136055868-136055890 CTGCTGCTGCTGAGTGCCAGTGG + Intergenic
941811074 2:169756632-169756654 CTGCTGCTCCAGAGGGCACGAGG + Intronic
942199338 2:173555047-173555069 CTGCTGCTAGGGAGGGCCCTAGG - Intergenic
946019851 2:216633587-216633609 CTGCTGCTACTGGGCGCGAGTGG + Exonic
946596177 2:221308165-221308187 TTGCTGCTGGAGAGGGCAAGTGG - Intergenic
948634899 2:239328760-239328782 CTGGAGATAAAGAGGGCCAGCGG - Intronic
948788017 2:240363126-240363148 CTGCTGGTCCCCAGGGCCAGGGG + Intergenic
948982385 2:241500971-241500993 CTACTGCTACAGATGCTCAGAGG + Intronic
1170086225 20:12535396-12535418 GTGCTGTTGCAGAGGCCCAGTGG + Intergenic
1170605800 20:17874361-17874383 CGGTTGCTACAGAGGGGCAGGGG - Intergenic
1171848174 20:30290508-30290530 CTGTTCCTGCAAAGGGCCAGGGG - Intergenic
1172768383 20:37363117-37363139 CTCCAGCTCCAAAGGGCCAGAGG - Intronic
1175747023 20:61464209-61464231 CTGCTGCTACAGATGCAGAGAGG + Intronic
1176293231 21:5057259-5057281 CTGCTGCAACAGAGGACCACAGG + Intergenic
1177414728 21:20779073-20779095 TTGTTGCTACAGAGGGCCCATGG - Intergenic
1177864878 21:26500556-26500578 CTGCTATTAGAGAGGCCCAGTGG + Intronic
1178420835 21:32442050-32442072 CTGGTAGTACAGTGGGCCAGTGG - Intronic
1179123342 21:38569066-38569088 AAGCTGCTAGAGAGGGACAGGGG - Intronic
1179594132 21:42430855-42430877 CTGCAGCAACACAGGCCCAGTGG - Intronic
1179864029 21:44206391-44206413 CTGCTGCAACAGAGGACCACAGG - Intergenic
1180288910 22:10778788-10778810 ACGCTGCTACAGACAGCCAGTGG + Intergenic
1180661703 22:17473161-17473183 CTGAAGCTGCAGAGGGGCAGTGG + Intronic
1180946513 22:19696726-19696748 CTGATGCTACAGAGCTCCTGAGG + Intergenic
1182273673 22:29171548-29171570 CCCCTGCTCCAGAGGCCCAGGGG - Intergenic
1182762491 22:32734098-32734120 CTGCTGCTTTAAAGGGCCTGGGG + Intronic
1184861410 22:47175034-47175056 CGGCTGCTCCTGAGGGACAGAGG - Exonic
1185182947 22:49373448-49373470 CTGCTGCCACAGGGGGCCTGTGG + Intergenic
949775795 3:7631158-7631180 CTGCTGCTCCAGACCACCAGTGG + Intronic
949875336 3:8623018-8623040 CTGCTGCTGCAGCCAGCCAGGGG - Intronic
950868717 3:16210864-16210886 CTGCTCCTAGAGAGGGCCTAGGG - Intronic
950887087 3:16372034-16372056 CTGCAGCTACCGAGGGCAAGAGG + Intronic
951181902 3:19668853-19668875 CTGCTGCTTCTTAGGGCCAAGGG - Intergenic
951589229 3:24245204-24245226 TTGATGAAACAGAGGGCCAGAGG + Intronic
951867387 3:27323350-27323372 CTGCAGGCACAGAGAGCCAGTGG - Intronic
952331427 3:32367490-32367512 CAGCTGCGGCTGAGGGCCAGGGG + Intronic
952824681 3:37514929-37514951 CATTAGCTACAGAGGGCCAGAGG - Intronic
953316611 3:41933272-41933294 CTGCTGGTCCAGAGGACCACTGG + Intronic
953351843 3:42221798-42221820 CAGCTGCTACAGGGATCCAGGGG - Intronic
955155085 3:56408821-56408843 CTGCTGCTCCTGGGGGACAGCGG - Intronic
956693851 3:71901896-71901918 CTGTGCCTACAGAGTGCCAGCGG - Intergenic
958023832 3:88027405-88027427 CTGCTGCTGCAGTTGGCCTGAGG + Intergenic
958161700 3:89824800-89824822 CTGCTGCTACAGAGATTCAGAGG - Intergenic
959262299 3:104098036-104098058 CAGCAGCTACAGAGGGCTGGTGG + Intergenic
959421688 3:106136168-106136190 CTGCTGCAGCAGGGTGCCAGTGG - Intergenic
961019913 3:123496846-123496868 CAGCTGGTTCAGAGGGCCCGGGG + Intronic
961642363 3:128372548-128372570 CTGGGGGTACAGAGGGCCTGGGG + Intronic
962024392 3:131531951-131531973 CAGCTGCTACCCAGGTCCAGGGG - Intergenic
963077025 3:141356295-141356317 CTGCTCATACAGTGGCCCAGGGG + Intronic
967134977 3:186505439-186505461 ATCCTGCTACAAAGGGCCAGAGG - Intergenic
967786740 3:193505280-193505302 CTGCTGTCACACAGGGCCAGAGG - Intronic
968641151 4:1715710-1715732 CTGCTCCTGCAGAGGGCCCTGGG + Intergenic
970278952 4:14433046-14433068 CCTCTGCTGCAGAGGACCAGTGG - Intergenic
970546857 4:17138562-17138584 CAGCTGCTATAGTGGGCCAGAGG - Intergenic
971527545 4:27639860-27639882 CTGTGGATACAGAGGGACAGAGG - Intergenic
972336338 4:38110107-38110129 CAGCTGCTACAAGAGGCCAGAGG - Intronic
973144867 4:46812872-46812894 CAGCTGCTTCATTGGGCCAGGGG + Intronic
977399214 4:96510310-96510332 CTGCCTCTACTGAGGGCCTGAGG + Intergenic
977874739 4:102135648-102135670 CTGGGGCTGCAGAGGACCAGCGG - Intergenic
978767396 4:112418328-112418350 CTGCCTTTACAGAGTGCCAGGGG + Intronic
978844976 4:113262551-113262573 CTACTGATACAGAGGGCCGATGG - Intronic
981774336 4:148347812-148347834 CCGCTGCTACAGTGGTGCAGTGG - Intronic
985577358 5:679554-679576 CCCCTGCTGCAGAGGCCCAGGGG - Intronic
985592290 5:771650-771672 CCCCTGCTGCAGAGGCCCAGGGG - Intergenic
985780803 5:1869789-1869811 CTGCACCTACAGAGGGCCCCGGG - Intergenic
986859176 5:11905389-11905411 CTGCTGAATCAGAGGGACAGGGG - Intergenic
989300305 5:39883862-39883884 CTGCTGCTACAAAGTGGAAGAGG - Intergenic
989443128 5:41495352-41495374 CTGCCCCTCCAGAGGGCCTGAGG + Intronic
990010878 5:50995769-50995791 CTGGTGCTACTGAGGCCAAGGGG - Intergenic
990976332 5:61564777-61564799 CTGCAGCCACAGAGGGCCATGGG + Intergenic
991569063 5:68035490-68035512 CCGCAGCTACAGAGAGCCAGAGG + Intergenic
995835360 5:116395164-116395186 CTGCTTCTTCAGAGGGAGAGGGG - Intronic
998540421 5:142976362-142976384 CTACTGCTTCTGAGGGACAGGGG + Intronic
999238282 5:150113075-150113097 CGGCAGCAACACAGGGCCAGGGG - Intronic
999691502 5:154149904-154149926 CTGTGGATACAGAGGGACAGAGG + Intronic
1000125376 5:158238649-158238671 CTGCTGCTGGAGAGGTCCACAGG - Intergenic
1000416044 5:160984771-160984793 CTGCAGCTACACAGTGCCAAAGG - Intergenic
1002043147 5:176528715-176528737 CTGCTGGCACTGAGTGCCAGGGG - Exonic
1003138159 6:3448875-3448897 ATGTTGCTACAGAGAGGCAGAGG + Intronic
1003145131 6:3504150-3504172 CCGCTGCTACCAAGGGGCAGAGG - Intergenic
1005870468 6:29971340-29971362 CTCCTGGTACATGGGGCCAGAGG + Intergenic
1006097277 6:31664011-31664033 GTGCTGCTCGAGCGGGCCAGGGG - Exonic
1006360813 6:33586029-33586051 CTGCTGTGACAGAGCCCCAGAGG + Intergenic
1007907500 6:45477087-45477109 CTGCTGCTTCAGGGACCCAGGGG - Intronic
1012507026 6:99958971-99958993 CTGCTGCTCCAGAGGACCTGTGG + Intronic
1013236429 6:108200883-108200905 CTGCTGCTGGGGAGGGCCTGCGG - Intergenic
1015581322 6:134728739-134728761 ATGGTGCCACAGATGGCCAGGGG - Intergenic
1016691955 6:146948307-146948329 CTGCTTCTAGAGAGGGCCTCAGG - Intergenic
1017209783 6:151842443-151842465 TTGCTGCAACAGACGGCAAGAGG + Intronic
1017759543 6:157557198-157557220 CTCCTGCTACAGCGTGCGAGAGG - Intronic
1018360800 6:163065553-163065575 CTGCAGCCACAGGGGGCCATGGG + Intronic
1018832039 6:167450786-167450808 CTGCTTCTTCAGAGGGCATGGGG - Intergenic
1018952650 6:168389190-168389212 ATGCTGCGACAGAGGCCCCGAGG - Intergenic
1019073698 6:169370189-169370211 CTGCTGCCTCAGGGGGACAGAGG - Intergenic
1019838318 7:3413298-3413320 CTGAAGCTAAAGAGGGGCAGGGG + Intronic
1021117857 7:16763759-16763781 CTGCTGCTGCTGATGGTCAGAGG + Intronic
1021971593 7:25970514-25970536 CTGCTGTAACAAAGTGCCAGAGG + Intergenic
1022134905 7:27438029-27438051 CAGCTGCCTTAGAGGGCCAGAGG + Intergenic
1024008457 7:45244968-45244990 TGGCAGCAACAGAGGGCCAGTGG + Intergenic
1025727512 7:64081079-64081101 CAGCTGCTGCAGAGTGCTAGTGG + Intronic
1026278909 7:68904405-68904427 CTGCTGCTGGAGAGGGCCTCAGG + Intergenic
1026456218 7:70574845-70574867 CTCCTCCTACAGAGGGCTAGTGG - Intronic
1027188886 7:75986720-75986742 GTGCAGCCACCGAGGGCCAGAGG - Exonic
1028068293 7:86415686-86415708 CTGCTGCTACAGTGGGGGTGGGG + Intergenic
1029259779 7:99293998-99294020 CTCCTGCAAATGAGGGCCAGAGG - Intergenic
1030213682 7:107021481-107021503 CTGCTCCTACAAAGCCCCAGAGG - Intergenic
1033482854 7:141759429-141759451 CTGTGGATACGGAGGGCCAGTGG - Intronic
1034320712 7:150178972-150178994 CAAATGCTACAGAAGGCCAGTGG + Intergenic
1034772025 7:153788276-153788298 CAAATGCTACAGAAGGCCAGTGG - Intergenic
1035061525 7:156073024-156073046 CTGCTGGCACAGAGGGCAGGCGG + Intergenic
1043656635 8:82674968-82674990 CCGCTGCAACAGAGTGCTAGTGG - Intergenic
1045996914 8:108373707-108373729 CTGCTTCTAGTGAGGGCCTGAGG - Intronic
1047251510 8:123184719-123184741 CTGCTGCTGCAGAGGGGCAGGGG + Intronic
1047384633 8:124397406-124397428 CTGCAGCTAGTGAGGGGCAGAGG - Intergenic
1047690504 8:127348845-127348867 CTGCTGCTGCTGTGGGCCTGAGG - Intergenic
1048509935 8:135053171-135053193 CTGCAGATACAGAGGGCCAATGG - Intergenic
1049329475 8:142042651-142042673 GTGATGCTGCTGAGGGCCAGCGG + Intergenic
1053454700 9:38225144-38225166 CAGCAGCTACAAAGGCCCAGAGG - Intergenic
1055829391 9:80360475-80360497 CTGCTGCTGCAGAGGGTGAGTGG + Intergenic
1056271877 9:84954921-84954943 CTGCTGCTTCTCAGGGTCAGGGG + Intronic
1060103332 9:120858276-120858298 CTTCTGATACAGATGGACAGTGG - Exonic
1060850673 9:126872526-126872548 CTGCTAGTACAGAGGGATAGAGG + Intronic
1061283401 9:129609779-129609801 AAGTGGCTACAGAGGGCCAGGGG + Intronic
1061375162 9:130219816-130219838 CTGCTGCCACACAGGGCCAAGGG - Intronic
1061681811 9:132246164-132246186 ATGCTGCCGCAGAGGGCCAGGGG - Intergenic
1062324197 9:136004587-136004609 CTGCTGTTACAGAGGGGCTGGGG - Intergenic
1062524713 9:136973542-136973564 CTGGTGCTACAGTGACCCAGGGG + Intergenic
1188951104 X:36376317-36376339 CTGCTGCTTCAGAGGACTAATGG - Intronic
1190603574 X:52117404-52117426 ATGCTGCTATAGTGGTCCAGGGG + Intergenic
1192550941 X:72052931-72052953 CTCCTTCTACAGAGGGCATGAGG - Intergenic
1192858624 X:75040759-75040781 CTGCTGCTGCAGAGGGATGGGGG + Intergenic
1199499968 X:148498303-148498325 CTGCTTCAAAAGAGGGGCAGGGG - Intergenic
1200145943 X:153926604-153926626 CCACTGGTACAGTGGGCCAGCGG - Intronic
1200834889 Y:7723778-7723800 CTGCAGCTACCGAGGGCAAGAGG + Intergenic