ID: 901201277

View in Genome Browser
Species Human (GRCh38)
Location 1:7468802-7468824
Sequence GTTTAGGGATCTCTCTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 79}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901201275_901201277 -9 Left 901201275 1:7468788-7468810 CCTGGACCTTGATGGTTTAGGGA 0: 1
1: 0
2: 0
3: 7
4: 183
Right 901201277 1:7468802-7468824 GTTTAGGGATCTCTCTGACCTGG 0: 1
1: 0
2: 1
3: 8
4: 79
901201271_901201277 -7 Left 901201271 1:7468786-7468808 CCCCTGGACCTTGATGGTTTAGG 0: 1
1: 0
2: 0
3: 6
4: 90
Right 901201277 1:7468802-7468824 GTTTAGGGATCTCTCTGACCTGG 0: 1
1: 0
2: 1
3: 8
4: 79
901201273_901201277 -8 Left 901201273 1:7468787-7468809 CCCTGGACCTTGATGGTTTAGGG 0: 1
1: 0
2: 1
3: 6
4: 96
Right 901201277 1:7468802-7468824 GTTTAGGGATCTCTCTGACCTGG 0: 1
1: 0
2: 1
3: 8
4: 79
901201267_901201277 28 Left 901201267 1:7468751-7468773 CCATGGTTCTACTTTCTGTTGTT 0: 1
1: 1
2: 6
3: 89
4: 701
Right 901201277 1:7468802-7468824 GTTTAGGGATCTCTCTGACCTGG 0: 1
1: 0
2: 1
3: 8
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901201277 Original CRISPR GTTTAGGGATCTCTCTGACC TGG Intronic
901025765 1:6277999-6278021 GTTTAGAGCTCTGGCTGACCCGG + Intronic
901102924 1:6733282-6733304 GTTTGGGGAACCCTCTGCCCAGG - Intergenic
901201277 1:7468802-7468824 GTTTAGGGATCTCTCTGACCTGG + Intronic
904897561 1:33828398-33828420 GGTGAGGGGTCTCTATGACCCGG + Intronic
912078224 1:105905145-105905167 TTTTAGGCATCTCTCTCAACTGG + Intergenic
913014859 1:114722545-114722567 GTTTAGGCATCTCTAAGCCCGGG - Intronic
1064729237 10:18312635-18312657 GATTAGGGATCTGAATGACCTGG - Intronic
1066640280 10:37548488-37548510 GTTAAAGGATTTCTCTGAGCAGG - Intergenic
1067345880 10:45438919-45438941 CTTCTGGGGTCTCTCTGACCAGG + Intronic
1068994572 10:63187992-63188014 GTTTTGGGAACTCTCTGAGTAGG - Intronic
1070820777 10:79352919-79352941 TTTTAGGGATGTCTCTTTCCTGG + Intronic
1074343082 10:112653490-112653512 GCTTAGGGATCAATCTGGCCTGG + Intronic
1075635863 10:124029841-124029863 GTTCAGGGACCTGTCTCACCCGG - Intronic
1079860627 11:25666602-25666624 GTTAAGGGTTCTCTCTAATCTGG - Intergenic
1085713664 11:78853086-78853108 GGCTAGGAATCTCTCTGACATGG - Intronic
1092204205 12:6606006-6606028 GTTGAGGGAGCTCTCTGGGCTGG - Intronic
1097147969 12:56954671-56954693 GTTCAAGAAACTCTCTGACCTGG + Intronic
1103285883 12:119801336-119801358 GTTTAGGGAGCTCTCTGACAGGG - Intronic
1103336033 12:120190480-120190502 ATTTGGGGATCTCTCTAACCTGG + Intronic
1106788233 13:33128937-33128959 GTGTAGGGGCCTCTCTGACCAGG - Exonic
1108648829 13:52455729-52455751 GTTCAGGGATCTCACAGAGCGGG - Intronic
1108803059 13:54123032-54123054 ACTTAGGGAAATCTCTGACCTGG + Intergenic
1111349819 13:87013446-87013468 GTTTAGGCATCTCTCTAACTGGG - Intergenic
1115996979 14:39204494-39204516 GTCTATGGATCTCTCAGACATGG - Intergenic
1117793645 14:59367667-59367689 ATTTAGAGAGCACTCTGACCTGG + Intronic
1119566518 14:75633693-75633715 GCTTAGGGAACTCCCTTACCGGG - Exonic
1120175276 14:81287381-81287403 CTTTGGGAATATCTCTGACCAGG - Intronic
1120917606 14:89723514-89723536 GTTTAGTGATCTGTGTGGCCTGG - Intergenic
1122226371 14:100282877-100282899 GTTTAGGCAACTCTTAGACCAGG - Intergenic
1123114455 14:105888245-105888267 GTTTATGGAACTCTCTGCACAGG + Intergenic
1123116611 14:105897652-105897674 GTTTATGGAACTCTCTGCACAGG + Intergenic
1123118666 14:105906901-105906923 GTTTATGGAACTCTCTGCACAGG + Intergenic
1123403609 15:20008100-20008122 GTTTATGGAATTCTCTGCCCAGG + Intergenic
1123512945 15:21014745-21014767 GTTTATGGAATTCTCTGCCCAGG + Intergenic
1127967741 15:63936305-63936327 GTTTAAAGATTTCTCTGGCCAGG + Intronic
1131065531 15:89432963-89432985 GCTTAGGGATCTCCCAGAGCTGG + Intergenic
1134018349 16:10904819-10904841 GATGCGGGATCTCTCTGCCCTGG + Intronic
1134091041 16:11391898-11391920 GTCTGGGGCTCTCTCTGCCCTGG - Intronic
1137289200 16:47040244-47040266 ATTTAGGGCCCTCTCTGAGCTGG + Intergenic
1140917439 16:79506825-79506847 CTTTGGGGCTCTTTCTGACCTGG - Intergenic
1140944803 16:79757998-79758020 GTTTAGGGTGGTCTTTGACCAGG - Intergenic
1149613639 17:57977905-57977927 GTTTAGAGATCACTCTGGCCAGG + Intronic
1152160474 17:78665395-78665417 GTTTGGGGATCCGGCTGACCTGG + Intergenic
1154065934 18:11106955-11106977 GCTTAGTGATCTATCTGCCCAGG - Intronic
1159344546 18:67183370-67183392 TTTGAGGGTTCTCTATGACCTGG + Intergenic
1159825056 18:73197675-73197697 CTTTAGTGATCTCTCTGCCTTGG + Intronic
1161463696 19:4415115-4415137 GTTGAGGGTGCTGTCTGACCGGG + Intronic
1165120747 19:33556899-33556921 GTTTTGGGACCTCTCTCTCCAGG + Intergenic
1166011924 19:39949095-39949117 GTTTGGAGATATCCCTGACCAGG + Intergenic
925133949 2:1513391-1513413 GTTTATGAATCTCTCAGACATGG - Intronic
928925903 2:36579264-36579286 GTTCTGGGATATCTCTGAACAGG + Intronic
929354427 2:41002457-41002479 GAAAAGGGATCTCTGTGACCCGG - Intergenic
936985434 2:118307918-118307940 CTTTTGGGAGCTCTCAGACCTGG - Intergenic
938717371 2:134033146-134033168 GTTTAGGGATCTCAATCACCAGG - Intergenic
941293743 2:163709626-163709648 GTTCAAGGATCTATCTGAACAGG + Intronic
944366421 2:198925556-198925578 TTTTATGGATATCTTTGACCAGG - Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
1173136423 20:40443141-40443163 GTTCTGGGTTCTCTCTGATCTGG + Intergenic
1173286074 20:41672404-41672426 TTTTGGGGATCCCTCTGACTGGG + Intergenic
1178891786 21:36526023-36526045 GTGAAGGGATATCTCTGAGCTGG - Intronic
1184373180 22:44095686-44095708 GTTTTGGGATCTAGCTGATCTGG + Intronic
1184442455 22:44525929-44525951 GTGTGGGGATCTCTCTGGCAAGG - Intergenic
953229468 3:41051820-41051842 GTTTAGGGTTCTCTCAGAAGTGG + Intergenic
960556235 3:119034305-119034327 GTTTAGTTACCTCTCTGACAAGG + Intronic
974415704 4:61603793-61603815 GATTTGGAATCTCTGTGACCAGG - Intronic
984431232 4:179651644-179651666 GTTAAGGGAACTCTCTAGCCTGG + Intergenic
987946346 5:24613963-24613985 GTTTGGGTATCTCTCTGAATAGG - Intronic
1005528044 6:26671799-26671821 CATTAGCTATCTCTCTGACCTGG - Intergenic
1005542751 6:26829840-26829862 CATTAGCTATCTCTCTGACCTGG + Intergenic
1006598542 6:35211107-35211129 GTTTAGGGATCCTTCTGCCAGGG - Intergenic
1010384297 6:75261611-75261633 GGTTAGGGGTCTGTCTGAGCTGG + Intronic
1013175298 6:107671247-107671269 GGTTAGGGAGCTCTCTGTGCTGG + Intergenic
1015585419 6:134771200-134771222 GTAAAGGGATCTTTCTCACCAGG + Intergenic
1016666389 6:146646518-146646540 GTTTAGGCATCTGTGTGCCCAGG + Intronic
1024411486 7:49048270-49048292 GTTTAGGTATCTATTTTACCAGG - Intergenic
1033775348 7:144603449-144603471 CTATAGGGATCTCACTGATCTGG - Intronic
1034344992 7:150380502-150380524 GATTAGGGATCGCTTTGACCAGG - Intronic
1035606442 8:933255-933277 GGTTAGGGAGCCCTCTGTCCTGG + Intergenic
1045697798 8:104829971-104829993 ATCTAGTGATCTCTGTGACCTGG + Intronic
1051607184 9:18927512-18927534 GTTTTGGGTTCTCTCTGTGCAGG - Intergenic
1055878786 9:80974003-80974025 GTTTAGGGAGCTCTGTGAGAGGG - Intergenic
1056099955 9:83291824-83291846 GTCTAGGGAACACTCTGACCAGG - Intronic
1062094191 9:134694624-134694646 GTTCTGGGATCTGTCCGACCAGG + Intronic
1188444393 X:30241639-30241661 ATTTAGTGCTCTCTCTGTCCTGG - Intergenic
1188476015 X:30592954-30592976 GTTCAGGGACTTCTCTGATCAGG + Intergenic
1188521697 X:31045039-31045061 GGTTAGGCATCTCTCTGCCCTGG - Intergenic
1193919063 X:87404139-87404161 TTTTAGCAATCTCTCTGACTAGG - Intergenic
1199433203 X:147784025-147784047 GTTTAGGGCTGCCTATGACCAGG + Intergenic
1199488508 X:148373497-148373519 GTTTGGAGACCTCTCTAACCAGG + Intergenic