ID: 901205947

View in Genome Browser
Species Human (GRCh38)
Location 1:7496033-7496055
Sequence CAGCCCAGAGAGCTGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 361}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901205947_901205954 -5 Left 901205947 1:7496033-7496055 CCCAGGGCCAGCTCTCTGGGCTG 0: 1
1: 0
2: 2
3: 47
4: 361
Right 901205954 1:7496051-7496073 GGCTGCCCCAGGGAGCCGGAGGG 0: 1
1: 1
2: 6
3: 39
4: 332
901205947_901205962 24 Left 901205947 1:7496033-7496055 CCCAGGGCCAGCTCTCTGGGCTG 0: 1
1: 0
2: 2
3: 47
4: 361
Right 901205962 1:7496080-7496102 CCTGTGCAGACCCAGCCGCCAGG 0: 1
1: 0
2: 7
3: 45
4: 312
901205947_901205955 -4 Left 901205947 1:7496033-7496055 CCCAGGGCCAGCTCTCTGGGCTG 0: 1
1: 0
2: 2
3: 47
4: 361
Right 901205955 1:7496052-7496074 GCTGCCCCAGGGAGCCGGAGGGG 0: 1
1: 0
2: 2
3: 32
4: 344
901205947_901205958 1 Left 901205947 1:7496033-7496055 CCCAGGGCCAGCTCTCTGGGCTG 0: 1
1: 0
2: 2
3: 47
4: 361
Right 901205958 1:7496057-7496079 CCCAGGGAGCCGGAGGGGAGCGG 0: 1
1: 0
2: 7
3: 82
4: 717
901205947_901205952 -9 Left 901205947 1:7496033-7496055 CCCAGGGCCAGCTCTCTGGGCTG 0: 1
1: 0
2: 2
3: 47
4: 361
Right 901205952 1:7496047-7496069 TCTGGGCTGCCCCAGGGAGCCGG 0: 1
1: 0
2: 6
3: 77
4: 474
901205947_901205953 -6 Left 901205947 1:7496033-7496055 CCCAGGGCCAGCTCTCTGGGCTG 0: 1
1: 0
2: 2
3: 47
4: 361
Right 901205953 1:7496050-7496072 GGGCTGCCCCAGGGAGCCGGAGG 0: 1
1: 0
2: 9
3: 55
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901205947 Original CRISPR CAGCCCAGAGAGCTGGCCCT GGG (reversed) Intronic
900408307 1:2502028-2502050 CGGTCTGGAGAGCTGGCCCTGGG + Intronic
901084014 1:6599757-6599779 CAGACCAGAGCCCTGGGCCTTGG + Intronic
901127254 1:6938370-6938392 CGCTGCAGAGAGCTGGCCCTGGG + Intronic
901188360 1:7389236-7389258 GAGCCCAGAGAGCTGGCCAAGGG - Intronic
901205947 1:7496033-7496055 CAGCCCAGAGAGCTGGCCCTGGG - Intronic
901207961 1:7508146-7508168 GAGCCCAGAGAGGTGGAGCTGGG + Intronic
901323201 1:8351680-8351702 CAGCCCAGAAAGCTGACTGTTGG - Intergenic
901400928 1:9014768-9014790 CAGCACAGACAGGTGGCCCTCGG + Exonic
902332883 1:15739219-15739241 GCCCCCATAGAGCTGGCCCTGGG - Exonic
903028620 1:20446997-20447019 CACCCCACTGAGCTGGCACTTGG + Intergenic
903271345 1:22190334-22190356 CAGCCTTGGCAGCTGGCCCTGGG + Intergenic
903865005 1:26391688-26391710 CAGCTCAGAGAGGATGCCCTGGG - Intergenic
904613226 1:31736477-31736499 GTGCCCAGAGAGCTGGGCCAGGG + Intronic
906215220 1:44034550-44034572 CAGACCTGAGAGCTGTCTCTGGG + Intergenic
906662233 1:47591003-47591025 CTCCCCAGAGGGCTGGGCCTGGG - Intergenic
907249373 1:53127949-53127971 CCGCCCAGACTGCTGGCCCAGGG + Intronic
909482349 1:76139669-76139691 GAGCCCAGAAACCTGGCACTAGG - Intronic
913181154 1:116323047-116323069 CAGCTCACAGATTTGGCCCTTGG - Intergenic
913234075 1:116765304-116765326 CAGCCAAGGGAACAGGCCCTGGG + Intronic
914239959 1:145846650-145846672 GACCCAAGAGAACTGGCCCTGGG - Exonic
915296622 1:154925950-154925972 AAGCCCACAGAGCGGGTCCTGGG + Intronic
915637682 1:157197909-157197931 GAGCCCAGAGAGATGGACCAGGG + Intergenic
920211786 1:204333728-204333750 CCTCCCAGAGAGCAGGACCTGGG - Intronic
921761868 1:218924136-218924158 CAGTCCAGAGAGCTTGCTCAGGG - Intergenic
922485416 1:225969864-225969886 CAGCCGGCAGGGCTGGCCCTGGG + Intergenic
922729942 1:227944631-227944653 CAGCCCCGATGGCTGGCTCTGGG + Intronic
923301178 1:232642221-232642243 CAGGCTACAGAGCTGGTCCTTGG - Intergenic
1062812919 10:478964-478986 GAGCCCAGAGCGCTTGCCCCTGG - Intronic
1065419840 10:25530840-25530862 CAGACCAGAGAGCTGACACAAGG - Intronic
1066274633 10:33856747-33856769 CAGCACAGGGAGGTTGCCCTGGG + Intergenic
1066282092 10:33927519-33927541 CAGCCCAGTCATCTGACCCTGGG - Intergenic
1067221268 10:44345963-44345985 CAGACCACAGAACTGTCCCTGGG + Intergenic
1067833790 10:49625496-49625518 CTGCCCTGACAGCTGGCCTTTGG - Exonic
1069602649 10:69717871-69717893 AAGCCCAGAGGGCTGGCCATTGG - Intergenic
1073955948 10:108871598-108871620 GAGTCCAGAGAGCTGACTCTGGG + Intergenic
1075209162 10:120476246-120476268 GAGTCCAAAGAGCTGGCCCTGGG - Intronic
1075516032 10:123109021-123109043 CAGACCAGAGAGCTGCCCCAGGG - Intergenic
1075583013 10:123636453-123636475 CAGCCCAGAGAAGGGGTCCTGGG + Intergenic
1076241001 10:128907345-128907367 CAGCACAGAGACCTGGCCTCTGG + Intergenic
1076450976 10:130556774-130556796 CGGTGCAGAGCGCTGGCCCTGGG - Intergenic
1076666240 10:132094586-132094608 CTGCCCAGAGAGCTGTCTGTGGG + Intergenic
1077094266 11:792681-792703 CTGGGCCGAGAGCTGGCCCTGGG + Exonic
1077170469 11:1163785-1163807 CACCCCAGGGACCCGGCCCTGGG + Intronic
1077239394 11:1502704-1502726 CAGGCCAGAGTGCTGCTCCTGGG + Intergenic
1077377212 11:2210688-2210710 CAGCCGAGGCTGCTGGCCCTGGG + Intergenic
1078728471 11:13954332-13954354 CAACCCAAAGAGCTGGCACCTGG - Intergenic
1079249304 11:18775536-18775558 CAGCCCAGGAAGCAGGCCTTGGG + Intronic
1079345950 11:19652389-19652411 CAGCCCTCACAGCTGACCCTTGG - Intronic
1081993960 11:47352009-47352031 CAGCCCAGGGACCTGGGCCTGGG - Intronic
1083110023 11:60397174-60397196 CAGCCCAGAGATGTGGCCTGGGG + Intronic
1083294043 11:61705806-61705828 CAGCCCTGAGGGTGGGCCCTGGG - Intronic
1083309926 11:61778941-61778963 CAGCCCCGGGATCTGCCCCTCGG - Intronic
1083725892 11:64627885-64627907 CTGCCCAGAGACCCGGGCCTGGG + Intronic
1083767404 11:64848393-64848415 CATCCCTGTGAGCTGGGCCTTGG - Intergenic
1083822931 11:65182765-65182787 CGGGCCAGGGAGCTGGGCCTGGG + Exonic
1083890930 11:65595502-65595524 CAGCTCAGAGGGCAGGACCTGGG - Exonic
1084375232 11:68772414-68772436 CATCCCAGACAGGGGGCCCTTGG - Intronic
1084442167 11:69180838-69180860 CAACCCACAGACCTGTCCCTTGG - Intergenic
1084675797 11:70633685-70633707 CACCCCAGAGAGAGGCCCCTGGG + Intronic
1085371720 11:76013553-76013575 CACCCCAGAGAGCTGGGTTTTGG + Intronic
1085479149 11:76807266-76807288 CAGCCCAGGGAGTAGGCCCCTGG + Intergenic
1089178166 11:116563132-116563154 CACTTCAGAGAGGTGGCCCTGGG - Intergenic
1089680725 11:120117554-120117576 CAGCCATTAGAGCTGTCCCTGGG + Intronic
1090084563 11:123640076-123640098 CAGCCCAGAGAGCAGTCCGAAGG + Intronic
1090185668 11:124737830-124737852 CTGGCCACAGTGCTGGCCCTGGG - Intergenic
1090400452 11:126445344-126445366 CAGCCCACAGGGCTGCGCCTGGG - Intronic
1090924942 11:131241259-131241281 CAGACCAGAGAGCTGCCCGGAGG + Intergenic
1090978314 11:131694628-131694650 CAGGACAGGGAGCTGGGCCTGGG + Intronic
1091140185 11:133228000-133228022 CTGCCCTGAGAGCTGGGGCTGGG + Intronic
1091239394 11:134042530-134042552 CAGCCCAGAGGAGGGGCCCTCGG + Intergenic
1091929515 12:4383565-4383587 AAGCCCAGGGAGGAGGCCCTGGG + Intergenic
1092479873 12:8850236-8850258 CTTCCCAGAGACCTGGCTCTGGG + Exonic
1095964544 12:47857969-47857991 AAGCCCAGAGAGTTTGCCCAAGG - Intronic
1096536349 12:52277574-52277596 CAGCCAAGCCAGCTTGCCCTTGG - Intronic
1097168463 12:57098707-57098729 CAGCTGGGAGAGCTGGCACTGGG - Intronic
1097238062 12:57553183-57553205 CAGTCCAGACAGCAGGCACTGGG - Intronic
1099861240 12:88228128-88228150 CAGCCTAGAGGGCTGTCCTTTGG - Intergenic
1099971674 12:89506754-89506776 ATGCCCACAAAGCTGGCCCTGGG + Intronic
1100530676 12:95458575-95458597 CAGGCCAGAGAGTGGGACCTGGG + Intergenic
1100689029 12:97019174-97019196 CAGTCCTGAGGGCTGGCCCAGGG + Intergenic
1101315966 12:103629134-103629156 CAGCCCTGACAGCTGTCCCCTGG + Intronic
1101332659 12:103769514-103769536 CAGGGCACAGAGCAGGCCCTAGG + Intergenic
1102179886 12:110904536-110904558 CTGCCGAGAGACCTGGGCCTGGG - Intronic
1102868165 12:116390930-116390952 GAGAGCAGAGAGCTGGCACTTGG + Intergenic
1102969508 12:117155332-117155354 CAGCCCACTGCGCCGGCCCTGGG - Intronic
1103899159 12:124294642-124294664 AGGCCCAAAGAGCTGGCCCTGGG + Intronic
1103936313 12:124479111-124479133 CTGCGCAGAGAGCAGGCCCGAGG - Intronic
1104010434 12:124926388-124926410 CAGCCCCGAGGGAGGGCCCTTGG - Intergenic
1104200639 12:126585233-126585255 CAGACCAGAGAGCTTTCTCTGGG + Intergenic
1104352497 12:128056989-128057011 GAGCCCAGGGTGCTGGCTCTAGG - Intergenic
1106273590 13:28180108-28180130 CAGCCTAGAAAGTTGGCCATAGG - Intronic
1106561912 13:30854169-30854191 CAGCCCAGAGAGAGGGCTTTTGG + Intergenic
1107263076 13:38518775-38518797 CAGCCCATGGACCTGGCCCTGGG + Intergenic
1107599470 13:41998647-41998669 CAGCTCAGAGAGGTCGCTCTTGG - Intergenic
1107867169 13:44714198-44714220 CAGCTCACAGAGCAGCCCCTTGG + Intergenic
1108279203 13:48844036-48844058 CAGCCCAGAAGGCTGGCTTTTGG + Intergenic
1108359978 13:49660050-49660072 CAGCACATAGACCAGGCCCTTGG - Intergenic
1110341760 13:74400969-74400991 CAGCCCAGGGAACTGGACTTTGG + Intergenic
1111096054 13:83517008-83517030 CAGCTCCTAGTGCTGGCCCTCGG - Intergenic
1112207880 13:97343509-97343531 CAGCCCATAGAGATGGCTCCAGG + Intronic
1113400605 13:109989256-109989278 CACCCCAGGGAGCTGGAGCTGGG - Intergenic
1113650229 13:112029249-112029271 CTGCCCAGTGAGCAGGACCTGGG + Intergenic
1113929961 13:113963103-113963125 CAGCTCTCAAAGCTGGCCCTGGG + Intergenic
1114674013 14:24429370-24429392 CAGCACTGAGGGCTGGACCTGGG + Exonic
1118352445 14:64982907-64982929 CAGGACTGAGACCTGGCCCTTGG + Intronic
1121006820 14:90496019-90496041 CAGCCCAGGGAACAGGCCCAGGG + Intergenic
1121645305 14:95514354-95514376 CAGCACTGAAAGCTGGCCCTTGG - Intergenic
1122362614 14:101176323-101176345 CAGCCCAGGGACCTGGCCTAAGG - Intergenic
1122945189 14:105005459-105005481 CAGCCCAGGCAGCAGGCCCGGGG + Intronic
1123034643 14:105466926-105466948 GAGCCCAGGCATCTGGCCCTCGG + Intronic
1123034994 14:105468374-105468396 CAGCCCTGGGCGCTGGGCCTTGG + Intronic
1124005429 15:25792314-25792336 GAGCCCAGAGACAGGGCCCTGGG + Intronic
1124354260 15:28983697-28983719 CTGCCCACAGAGCTGACCCCAGG - Intronic
1125414609 15:39439166-39439188 AAGCCCAGAGAGATGGTCCAGGG + Intergenic
1125679715 15:41523137-41523159 CATCCCAGGGTGCAGGCCCTCGG - Intronic
1126436747 15:48645212-48645234 AAACCCAGAGAGCTCGCCCGGGG - Intronic
1128054402 15:64689033-64689055 CAGCCCAGACAGTGGGGCCTGGG - Intronic
1128256465 15:66200975-66200997 CAGCCCAGCCATCTGGCCTTGGG - Intronic
1128300720 15:66564886-66564908 CAGCCCAGAGTCCTGGCTCTGGG - Intronic
1128308207 15:66613838-66613860 CAGCCCAGGGTTCTGGGCCTGGG + Intronic
1128345753 15:66851425-66851447 GAGCCCAGAGCGCTGGGCCCCGG + Intergenic
1128347675 15:66864847-66864869 CAGGCCAGTGAGGAGGCCCTGGG - Intergenic
1128711350 15:69874608-69874630 CAGTCCTGGGAGCTGGCCATTGG - Intergenic
1129331206 15:74828304-74828326 CAGCACAAAGCCCTGGCCCTTGG - Intronic
1129741030 15:77989752-77989774 CAGCCCCGAGGGCTGTCCCACGG + Intronic
1130783800 15:87073435-87073457 CAGTCCAAAATGCTGGCCCTTGG + Intergenic
1130867703 15:87946587-87946609 CAGCCCTGAGGGCTGGCCCCTGG + Intronic
1131027098 15:89152457-89152479 CAACCCAGAGGCCTGGTCCTGGG - Intronic
1132939704 16:2500648-2500670 CAGCCTGGACAGCTGGTCCTGGG + Intronic
1132952106 16:2568917-2568939 CAGCCCAGAGAGCGGTTCCCGGG - Intronic
1132962244 16:2631253-2631275 CAGCCCAGAGAGCGGTTCCCGGG + Intergenic
1133125344 16:3642559-3642581 CAGCACCGAGAGCAGGGCCTGGG - Intronic
1133384895 16:5361636-5361658 AAGCCCATAAAGCTGGCCCTGGG + Intergenic
1134297012 16:12955313-12955335 CAGCCTAGAGAGGAGGCCATTGG - Intronic
1134304235 16:13018074-13018096 TAGCTCAGAGTGCTGACCCTTGG + Intronic
1134405776 16:13957488-13957510 CAGCCTAGAGCGCTGCCCCGGGG + Intergenic
1134463981 16:14456767-14456789 CAGTGAGGAGAGCTGGCCCTAGG - Intronic
1137071747 16:35909930-35909952 CAGCCTAGAGGGCTGTCCTTTGG + Intergenic
1137277100 16:46942795-46942817 CAGCCCAGAGAGCTGCAGGTTGG + Intergenic
1138488216 16:57360380-57360402 GAGCCCAGAGAGGTCACCCTCGG - Intronic
1138558587 16:57786968-57786990 CACTCCAGAGAGCTGGAGCTGGG + Intronic
1139430940 16:66910759-66910781 CAGGACAGAGAGCTGGCCCTGGG - Intronic
1139528225 16:67529207-67529229 CAGGCCAGAGAGCGGGCTCAAGG + Intronic
1140693593 16:77509162-77509184 AAACCCACAGAGCAGGCCCTTGG + Intergenic
1141468987 16:84225785-84225807 CAGTCCAGAGAGGTGGCCAGAGG - Intronic
1142005011 16:87685486-87685508 CAGCCCAGGCAGCTGGTCGTGGG - Intronic
1142375936 16:89707181-89707203 CAGTCAAGAGGGCTGACCCTTGG + Exonic
1143020973 17:3917060-3917082 CAGCCGAGAGAGCCTGACCTCGG + Intergenic
1144955198 17:19015542-19015564 CAGTCCTGAGTGCTGGCCCGGGG - Intronic
1145282491 17:21478099-21478121 CAGCCTGGAGAGCTTGCCCAGGG + Intergenic
1145394982 17:22487656-22487678 CAGCCTGGAGAGCTTGCCCAGGG - Intergenic
1145935879 17:28714522-28714544 CAGACCAAAGAGCTGCCTCTTGG - Exonic
1145982332 17:29020415-29020437 CTGCCTAGAGAGCTAGGCCTAGG - Intronic
1146936892 17:36817670-36817692 CAGCCCATGAACCTGGCCCTGGG + Intergenic
1147477540 17:40727004-40727026 CTTCCCAGATATCTGGCCCTGGG - Intergenic
1147606354 17:41775885-41775907 CAACCCAGAGGGCTGGCACCGGG + Intronic
1147951305 17:44109461-44109483 CAGCCTACAGGGCTGGCCCCAGG + Intronic
1148000621 17:44385190-44385212 CAGGCCGGAGAGCTGGTGCTTGG - Exonic
1148737410 17:49872719-49872741 CAGCCCAGAGAGCATGTCCAGGG + Intergenic
1148808982 17:50278636-50278658 CACCCAAAGGAGCTGGCCCTGGG - Intronic
1149756492 17:59190807-59190829 CAGCCAAGAGAACTTGGCCTGGG + Intronic
1151147702 17:72056873-72056895 CAGCCCAGAGGCCTGGCCTGTGG + Intergenic
1151206932 17:72514816-72514838 AAGCCCACAGAGCTGGCCCCTGG + Intergenic
1151683910 17:75635909-75635931 CAGGCCAGACAGCTGCCACTTGG - Intronic
1151723853 17:75873696-75873718 CAGCCCACAGAGCCGGCCCAGGG - Intergenic
1151758600 17:76088400-76088422 CACCACAGTGACCTGGCCCTGGG - Intronic
1152014530 17:77741787-77741809 CAGCCCTGAGACCCTGCCCTGGG + Intergenic
1152542320 17:80982490-80982512 CACTCCACAGAGGTGGCCCTAGG - Intergenic
1153041017 18:812622-812644 CTGCCCGGAGAGCAGGCCCGCGG + Intergenic
1153935276 18:9914742-9914764 CAGCCCAGAGCGCACGCCCTCGG - Intronic
1154046705 18:10912708-10912730 AAGTCCAGAGAATTGGCCCTGGG - Intronic
1154174956 18:12080301-12080323 AAGGCCAGAGAGTTGGCCCTGGG + Intergenic
1156483776 18:37452022-37452044 CAGCCCAGAGAAGGGGCCCGTGG - Intronic
1157292893 18:46422608-46422630 AGGCACAGAGAGCTGGACCTCGG - Intronic
1157715694 18:49885483-49885505 AAACCCAGAGAGGTGGCCCTAGG + Intronic
1158386270 18:56995796-56995818 AAGCTCAGAGAGCTGACGCTGGG - Intronic
1159483748 18:69026577-69026599 AAGCCCAGAGTGCTGAGCCTGGG + Intronic
1160705616 19:528869-528891 CAGCCCAGGGTGGGGGCCCTGGG + Intergenic
1161009790 19:1954655-1954677 CTCCCCAGGGAACTGGCCCTGGG + Intronic
1161125758 19:2556347-2556369 CAGCTCAGGAAGCTGGGCCTGGG - Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1162302758 19:9853561-9853583 CTCCCCAAAGGGCTGGCCCTGGG + Intergenic
1162361971 19:10226052-10226074 CTACCCAGAGAGCAAGCCCTAGG + Intronic
1163608395 19:18288200-18288222 CAGTCCAGAGGGCAGGGCCTGGG - Intergenic
1164835099 19:31350851-31350873 CCGGCCTGAGAGCTGGCCCAGGG - Intergenic
1167333922 19:48873222-48873244 CAGCCCAGACACATGGCCCCAGG + Exonic
924987673 2:287230-287252 CTGCCCAGAGTGGTGGCCCACGG - Intronic
925201499 2:1970573-1970595 CAGGGCAGAGAGCTGGCTCAGGG + Intronic
925342361 2:3146372-3146394 CTGCCCAGGGAGCTCGCCCTGGG + Intergenic
925903050 2:8522439-8522461 CAGGCCAGAGACCTCGCCCCTGG + Intergenic
926028724 2:9567020-9567042 GAGCCCAGAGGGCAGGCTCTAGG + Intergenic
926060680 2:9802857-9802879 CAGCGCAGGGTGCTGTCCCTAGG + Intergenic
926227467 2:10978556-10978578 CAGCCCACAGGGCTTTCCCTGGG - Intergenic
926625269 2:15085440-15085462 CAGCACTGAGAGGTGGCCCTGGG - Intergenic
930028445 2:47044014-47044036 CTGCCCAGGGAGCTGTCCCCAGG + Intronic
931134903 2:59387486-59387508 CAGCCCAAGGTTCTGGCCCTGGG - Intergenic
931284723 2:60822431-60822453 CAGCCCATAGAGCAGGTCCTTGG - Intergenic
931711827 2:64994403-64994425 CAGACCAGAGCCCTGGGCCTAGG - Intronic
933123529 2:78573365-78573387 CAGCCCAGAGAGTTTACTCTGGG - Intergenic
934900867 2:98158885-98158907 CAGCCCAGGGAGCTGGGCCCTGG + Intronic
936080925 2:109432137-109432159 AAATCCAAAGAGCTGGCCCTGGG + Intronic
936145210 2:109976118-109976140 CAGCCCGGAGAGCTTGCCCAAGG - Intergenic
936199475 2:110395360-110395382 CAGCCCGGAGAGCTTGCCCAAGG + Intergenic
937411944 2:121684283-121684305 CAGCCCCGCCAGCTGGCCGTAGG - Intergenic
937437916 2:121894569-121894591 CAGCCATTAGAGCTGGCTCTTGG + Intergenic
937474299 2:122201397-122201419 CAGCCCATTGAGCAGGCACTGGG + Intergenic
937942064 2:127293865-127293887 CAGCCCAGCGAACTCGGCCTAGG - Intronic
938778479 2:134562500-134562522 CAGGCCACTGAGATGGCCCTTGG + Intronic
938924369 2:136025476-136025498 AGGCCCAGAGTTCTGGCCCTGGG + Intergenic
945235229 2:207626344-207626366 CCGCCCCAAGAGCTGGCCATGGG + Intergenic
947212164 2:227718148-227718170 CTGCCCAGAAAACCGGCCCTGGG - Intergenic
947593236 2:231396417-231396439 CTCCCCGGAGAGCTGGACCTTGG + Intronic
1170070172 20:12357981-12358003 CTGCCCAGTGAGCTTGTCCTTGG + Intergenic
1170937803 20:20824987-20825009 CAGAGCAGGGAGCAGGCCCTGGG - Intergenic
1171777420 20:29382163-29382185 CAGCTCAGAGACCTACCCCTAGG - Intergenic
1172484954 20:35292339-35292361 CAGCCCAGCGTGCGGGCCATGGG - Exonic
1172662322 20:36575645-36575667 CAGCCCAGAGATCTGGGCTCGGG + Intronic
1173384503 20:42575192-42575214 CAGCCAAGAGACCCGTCCCTTGG + Intronic
1173570405 20:44071992-44072014 CTGCCCACAGAGCTGGCCCAGGG + Intergenic
1173575825 20:44112547-44112569 AAGCCCAGGGAGATGTCCCTGGG - Exonic
1173810093 20:45950203-45950225 CTGCACAGTGAGCTGCCCCTGGG - Exonic
1175220712 20:57414962-57414984 CAGGCCAGAGAGCTGGACAGTGG + Intergenic
1176299056 21:5090068-5090090 CAGCATAGAGAGCCGGCCCAGGG - Intergenic
1178489731 21:33041788-33041810 CAGTCCAGGGAGGTGGCCCAGGG + Intergenic
1179667829 21:42924729-42924751 CAGCCTAGAGGGCTGTCCTTTGG + Intergenic
1179789293 21:43747196-43747218 CAGCCCACAGACCTGGACGTCGG + Intronic
1179857969 21:44171880-44171902 CAGCATAGAGAGCCGGCCCAGGG + Intergenic
1180043597 21:45292803-45292825 GACCCCTGAGAGCAGGCCCTGGG + Intergenic
1180105869 21:45617684-45617706 CAGCAGAGGGAGCTGGCCCGGGG - Intergenic
1180154958 21:45973226-45973248 CAGCCCCTAGAGCTGGGCCCCGG - Intergenic
1181864445 22:25844296-25844318 CAGCCCAGAGTGCTGGCGTGAGG + Intronic
1183122528 22:35741172-35741194 GAGCCCAGAGAGCTGCCCATAGG - Intronic
1183337119 22:37256244-37256266 CAGCCCAGGGAGCTGGGTTTGGG - Intergenic
1183647503 22:39134910-39134932 CAGCCCAGAGAGTGCGCCCCGGG + Intronic
1184096960 22:42321343-42321365 TAGCTCACAGAGCTGGCCATGGG - Intronic
1184109208 22:42385127-42385149 CCGCTCATAGAGCTTGCCCTGGG - Exonic
1184602319 22:45550909-45550931 AGGCCCAGAGAGCTTGCCCAAGG - Intronic
1184613828 22:45624340-45624362 CAGCCCAAAGAACTTGCTCTGGG + Intergenic
1185200759 22:49503040-49503062 GAGCCCAGAGATGTGGCCTTAGG - Intronic
950305851 3:11914987-11915009 CAGCCCAGAGAGCAGGGTCCGGG + Intergenic
950548840 3:13654598-13654620 CCCCCCAGAAAGCAGGCCCTGGG - Intergenic
950582333 3:13870768-13870790 CTGCCCCAAGAGGTGGCCCTGGG + Intronic
951941289 3:28081643-28081665 CAGCCCAGACAGCTGCACATGGG + Intergenic
952344034 3:32467819-32467841 CCGCCCAGCGCGCTGCCCCTGGG - Intronic
952867444 3:37863254-37863276 CCTCCCAGAGAGCTGGCCAAGGG + Intronic
953889013 3:46736676-46736698 CACTGCAGAGAGCTGGGCCTAGG - Intronic
954274321 3:49532520-49532542 CAGCCCAGCGATCTGCTCCTTGG - Exonic
954798073 3:53171667-53171689 CAGCTCAGAAGGCTGGCCCTGGG - Intronic
955392115 3:58529597-58529619 CAGCCCAGATAAATGGGCCTCGG + Intronic
956111402 3:65873292-65873314 CAGGCCTGAGAGCTTGCCGTGGG - Intronic
960149055 3:114232462-114232484 TGGCCCAGAGGGCTGGCCCTGGG + Intergenic
960964327 3:123094382-123094404 CAGCCCAGAGTTCTGAACCTTGG - Intronic
962837823 3:139204425-139204447 CAGCCCAGAGAGCACAACCTAGG + Intronic
962897653 3:139730648-139730670 GTGCCCACAGAGCTGGCCCTGGG - Intergenic
963279422 3:143367648-143367670 CAGCACAGAGAGCCAGCCCACGG + Intronic
964273965 3:154988189-154988211 CAGCCCATGGGGCTGCCCCTAGG + Intergenic
964447659 3:156777103-156777125 AAGCCAAAAGAGCTTGCCCTTGG - Intergenic
966534272 3:181014542-181014564 CATCCCAAAGAGCTGTACCTGGG - Intergenic
967267308 3:187702001-187702023 AAGCCCAGTGAGCTGGCCCCTGG - Exonic
967941071 3:194767320-194767342 CAGCCCAAAGAGGTGGAACTGGG + Intergenic
967945586 3:194801485-194801507 TTGCCCAGAGAGCTTGCTCTGGG + Intergenic
967964899 3:194953387-194953409 CAGCCCAGAGAGCTGCACAAGGG + Intergenic
968313580 3:197703930-197703952 CAGCCCCGAGAGTTGGGCATTGG - Intronic
968530553 4:1089165-1089187 CAGCCCAGAAAGCAGCCACTGGG + Intronic
968901674 4:3435055-3435077 CCGCCCAGTGAGCTGCCCCAGGG - Intronic
968977210 4:3828188-3828210 GAGCCCAGAGAGCTGAGCCTGGG - Intergenic
969274408 4:6125193-6125215 CACCTCAGAGAGCTGGGGCTGGG - Intronic
969517742 4:7656943-7656965 CAGGCCAGTGAGCTGGCCGGGGG - Intronic
971455544 4:26840651-26840673 AAGCCCAGGAAGCTAGCCCTGGG - Intergenic
972179568 4:36446980-36447002 CAGCCAAGGGAACTGCCCCTTGG - Intergenic
973833462 4:54785389-54785411 CAGCCCACAGAGATGAGCCTAGG - Intergenic
973855334 4:55005451-55005473 GAGCCCTGAGAACTGTCCCTTGG - Intergenic
975722693 4:77263628-77263650 CAGACCAGATTTCTGGCCCTTGG - Intronic
976223648 4:82778314-82778336 CACCCCAGGGACCTGGCCCAAGG + Intronic
976384537 4:84440414-84440436 AAGCCAGGAGAGCTGGCACTGGG + Intergenic
976479673 4:85525960-85525982 CAGCTCTGAGAACAGGCCCTTGG - Intronic
976814623 4:89133215-89133237 CCTCTCAGAGAGCTGGGCCTAGG + Intergenic
977558876 4:98512513-98512535 CAGCCGGCAGAGCTGACCCTTGG + Intronic
978490134 4:109303042-109303064 CAGGCCAGAGAGGTGGCCCTCGG - Intergenic
983650778 4:170034467-170034489 CAGAACAGGGAGCTGGCGCTAGG - Intergenic
984755887 4:183325126-183325148 GACCCCAGCGAGCTGGGCCTGGG - Intergenic
985764449 5:1769400-1769422 GAGCCCAGACAGCTGCTCCTCGG - Intergenic
985870448 5:2550033-2550055 AAGGCCAGAGAGCTGGCTCCAGG + Intergenic
986292929 5:6414858-6414880 CAGCTCTGAGAGCTGTCACTGGG + Intergenic
986571156 5:9167617-9167639 GAGGCCTGAGAGCTGGCTCTTGG - Intronic
986995307 5:13601122-13601144 CAGCTCAGATATGTGGCCCTAGG - Intergenic
988662445 5:33286401-33286423 ATGCCAAGAGAACTGGCCCTGGG + Intergenic
990184765 5:53201155-53201177 CAGCCTAGAGGGCTGTCCTTTGG - Intergenic
990341355 5:54826292-54826314 CAGTCCAGAGACCTGAACCTTGG - Intergenic
993625562 5:90220499-90220521 CAGACCAAAGAGCTGGGCCAAGG + Intergenic
994119736 5:96100464-96100486 GAGTCCAGAGAGCAGGCCATAGG - Intergenic
995335571 5:110995132-110995154 CAGCCCAGAAATGTGCCCCTGGG - Intergenic
996642062 5:125767426-125767448 CAGCAAAGACATCTGGCCCTGGG + Intergenic
997253715 5:132410997-132411019 CAGCCTGGAGCGCGGGCCCTGGG + Exonic
998043156 5:138966289-138966311 CAGCCCTGGGTGGTGGCCCTTGG - Intronic
998183556 5:139962001-139962023 CAGCACAGAGAGCTGGTCATTGG + Intronic
998295306 5:140964508-140964530 CAGCTCAGAGACCTGGCCACTGG - Intronic
998398505 5:141835214-141835236 TCGCTCACAGAGCTGGCCCTAGG - Intergenic
999232439 5:150069718-150069740 TGGCCCAGAGAGGTGGACCTTGG + Intronic
1000018758 5:157301067-157301089 CAGGGCATAGAGCTGGGCCTTGG + Intronic
1000342947 5:160291530-160291552 CATCCCAGAAAGCTGACTCTGGG + Intronic
1001011278 5:168100990-168101012 CAGCCCAGAGAGCTGTCGGGTGG - Intronic
1001565420 5:172696617-172696639 CAGTCAAGAGCGCTGGCCCCAGG + Intergenic
1002110519 5:176907083-176907105 AAGCCCAGAAAACTGGTCCTGGG + Intronic
1002496292 5:179614091-179614113 CAAGCCAGAGATGTGGCCCTAGG + Intergenic
1003528285 6:6916745-6916767 CAGTCCAGACAGAAGGCCCTGGG + Intergenic
1003679948 6:8243152-8243174 CAGCACAGAGAGCAGTCTCTGGG - Intergenic
1006192960 6:32220701-32220723 TGGCCCAGAGAGTTGGCCCCTGG - Intronic
1006466031 6:34195584-34195606 CAAGCCAGGGAGGTGGCCCTAGG + Intergenic
1006578269 6:35061541-35061563 CTGCCCAGGGAGCTGGCCTGAGG + Intronic
1006681126 6:35797382-35797404 CATCCCACAGGGCTGGCCGTGGG + Intergenic
1007836655 6:44679006-44679028 AAGCCCAGATAGCTGGTCCCAGG + Intergenic
1008660063 6:53658490-53658512 CAGGCCACAGTGCTGGACCTGGG + Intronic
1008872460 6:56288692-56288714 GTTCCCAGATAGCTGGCCCTCGG - Intronic
1013664232 6:112330293-112330315 CAGGCCAGCTAACTGGCCCTGGG + Intergenic
1014116197 6:117670890-117670912 CAGGCAAGAGAGCTTGCGCTGGG - Intergenic
1015551884 6:134420407-134420429 CAGCCCTGAGAAGTGGCCCCAGG + Intergenic
1016277620 6:142373310-142373332 CTGGCCAGAGAGATGGCTCTTGG - Intronic
1017988781 6:159468449-159468471 CAGAGGAGAGAGCTGGCCCTAGG - Intergenic
1018003229 6:159597761-159597783 GAGCCCAGAGAGGAGGACCTAGG + Intergenic
1018621453 6:165732971-165732993 CATCCCAGAGAACTGTCACTAGG - Intronic
1018916194 6:168134042-168134064 CAGCCCTGCTAGCTGCCCCTGGG + Intergenic
1018996939 6:168717202-168717224 ATGCCCAGAGGGGTGGCCCTGGG + Intergenic
1019526987 7:1484920-1484942 CAGCACAGAGACCCTGCCCTGGG - Intronic
1019546734 7:1581137-1581159 GAGCCCCCAGACCTGGCCCTGGG - Intergenic
1019631868 7:2053729-2053751 CAGCCCAGAATGCAGGGCCTGGG - Intronic
1019775979 7:2912508-2912530 CAGCCCATAGAGCAGGTGCTTGG + Intronic
1020248246 7:6447439-6447461 CAGCGCCGAGACCTGGCCCTGGG - Intronic
1022531509 7:31069803-31069825 GAGCCCAGAGAGGTGGCCGTGGG + Intronic
1023601130 7:41882866-41882888 CAGCCCATAGATATGACCCTGGG + Intergenic
1024229957 7:47356147-47356169 CCTCCAGGAGAGCTGGCCCTTGG - Intronic
1024361692 7:48475319-48475341 AAGACCAGAGAACTGGCCTTGGG - Intronic
1024777043 7:52799675-52799697 CAGCCCTGGGAGCTGACACTGGG + Intergenic
1024819266 7:53307913-53307935 AAGCCCAGACATTTGGCCCTAGG - Intergenic
1025145041 7:56494874-56494896 CTGCCTAGAGATCTGGCCTTGGG - Intergenic
1025202016 7:56968317-56968339 CAGCCCAGAGCCCAGACCCTAGG - Intergenic
1025669931 7:63608611-63608633 CAGCCCAGAGCCCAGACCCTAGG + Intergenic
1026563149 7:71467252-71467274 CCAACCAGAGAGCTGTCCCTAGG - Intronic
1026861639 7:73793887-73793909 CAGCCCATAGAGCAGGCACTGGG - Intergenic
1026873092 7:73865136-73865158 CAGCCCAGAGAGCCTGGCCCAGG - Exonic
1027139763 7:75648767-75648789 CTGCCCAGAGAGCAGACCCTGGG + Intronic
1028709642 7:93892231-93892253 CAGCCCAGAGAGATAGCCTTGGG + Intronic
1032455974 7:132073847-132073869 CAGCACAGAGAGCAGGCCCCGGG - Intergenic
1032552989 7:132803142-132803164 CAGCCCATAGAAGTAGCCCTTGG + Intronic
1033607177 7:142936187-142936209 CAACCCATAAAGCTGGTCCTGGG + Intergenic
1035057224 7:156043708-156043730 CAGCCCAGAGACATGGACTTCGG - Intergenic
1035146375 7:156821455-156821477 CAGCCCATAGATCTGCCCATCGG - Intronic
1035700932 8:1638929-1638951 CAGCCCAGAGAGCTGGGTCATGG + Intronic
1036709516 8:11069132-11069154 CAGCCCAGAAACATGGCCCTAGG + Intronic
1038176128 8:25183883-25183905 CAGCCCAGAGAGCATTCCCGTGG - Intergenic
1038256287 8:25954288-25954310 CATCCCAGAGGGCTGCCCGTTGG + Intronic
1040572952 8:48625641-48625663 CCGTCCAGGGAGCTGGTCCTGGG - Intergenic
1040897357 8:52382847-52382869 CAGCCAGGAGAGATGGCTCTCGG + Intronic
1041478459 8:58292143-58292165 TAGCCCAGAAAGGTGGCCATGGG - Intergenic
1042157770 8:65864013-65864035 CAGCCTAGAGGGCTGTCCTTTGG - Intergenic
1045327702 8:101128879-101128901 GAACCCAGAGAGGTGGCCCTAGG - Intergenic
1045800686 8:106097295-106097317 CAGTCCAGAGGGCCTGCCCTAGG + Intergenic
1047210425 8:122835987-122836009 CAGCCTAGAGGGCTGTCCTTTGG + Intronic
1048486123 8:134849190-134849212 CAGCCCTGAAATCTGGCCATGGG + Intergenic
1048965158 8:139609564-139609586 CAGCCCACAGGCCTGGCCCCTGG - Intronic
1049016106 8:139921260-139921282 CTGCCCTCAGATCTGGCCCTGGG - Intronic
1049989975 9:981561-981583 CAGCCCCAAGAGCCAGCCCTGGG - Intronic
1051120206 9:13744448-13744470 CAGGCCAAAGAGTTTGCCCTGGG + Intergenic
1051433924 9:17010506-17010528 TAGCCCAGAAAGCTGGAACTCGG - Intergenic
1053344991 9:37371561-37371583 CGGCCCTGAGTGCTGTCCCTAGG - Intergenic
1056167932 9:83956703-83956725 CTGCCCAGCGAGCTGCCCCGGGG - Exonic
1056235877 9:84593749-84593771 CTGCCTAGAGAGCTGGGCCTTGG - Intergenic
1056318533 9:85415019-85415041 AAGCCCAGAGTCCTGGCCCTTGG + Intergenic
1056395347 9:86176485-86176507 CACCCCACAGAGCTGTCACTGGG + Intergenic
1056788573 9:89610704-89610726 CAGGCCAGAGAGCTGGCGCCAGG - Intergenic
1057073742 9:92123031-92123053 CACCCCAGTGAGCAGGCCCAAGG + Intergenic
1057129318 9:92642118-92642140 GGGCCCAGCGAGCAGGCCCTGGG - Intronic
1057162312 9:92897055-92897077 GTGCCCAGAGATCAGGCCCTGGG + Intergenic
1057305991 9:93912315-93912337 GAGCCCAGGGAGCCTGCCCTGGG - Intergenic
1057311835 9:93947937-93947959 CAGCTCGGAGATCTGGCCCCGGG + Intergenic
1058537252 9:105974917-105974939 CAGCTCACAGATGTGGCCCTGGG + Intergenic
1059259967 9:112966216-112966238 CATCCTAGAGAGGTGGCCTTTGG + Intergenic
1059299011 9:113297982-113298004 CAGCCCACAGTGCTGGCCTCAGG - Exonic
1059790316 9:117635533-117635555 CTGCCCAGTGAGCTTCCCCTTGG + Intergenic
1060184759 9:121557619-121557641 CAGCCCCCAGAGCTTGGCCTTGG - Intergenic
1060521164 9:124294906-124294928 CAGCACAGAGTGGAGGCCCTGGG + Intronic
1060556867 9:124512470-124512492 CAGTCTAGAGAACTGGCCCCAGG - Intergenic
1060913618 9:127370487-127370509 CGGGCCAGAGAGCTGGGCCATGG - Intronic
1061793471 9:133070879-133070901 CCGCCCTCTGAGCTGGCCCTGGG - Intronic
1061796080 9:133086678-133086700 CCGCCCTCTGAGCTGGCCCTGGG - Intronic
1062358601 9:136176925-136176947 CACCTGAGAGAGCTGGCCCGGGG - Intergenic
1062364555 9:136202656-136202678 CAGCCCAGGGAGCTGGCTCCGGG + Intronic
1062490445 9:136802816-136802838 GATCCAAGAGGGCTGGCCCTGGG - Intronic
1062490471 9:136802884-136802906 GATCCAAGAGGGCTGGCCCTGGG - Intronic
1062490498 9:136802952-136802974 GATCCAAGAGGGCTGGCCCTGGG - Intronic
1062490524 9:136803020-136803042 GATCCAAGAGGGCTGGCCCTGGG - Intronic
1062490551 9:136803088-136803110 GATCCAAGAGGGCTGGCCCTGGG - Intronic
1062490576 9:136803155-136803177 GATCCAAGAGGGCTGGCCCTGGG - Intronic
1062490602 9:136803223-136803245 GATCCAAGAGGGCTGGCCCTGGG - Intronic
1062512985 9:136917598-136917620 CCGCCCAGTGAGCTGGCCAGGGG - Intronic
1185456007 X:311260-311282 CAGCCCAGGGGCCAGGCCCTCGG - Intronic
1185456019 X:311292-311314 CAGCCCAGGGGCCGGGCCCTCGG - Intronic
1187419649 X:19122840-19122862 CAGCCCAGCGAGCTCCTCCTTGG + Intergenic
1188306986 X:28571043-28571065 CTCCCCAGAGAGCTGTCCCAGGG + Intergenic
1190094506 X:47467734-47467756 CAGCACAGTGAGCGGCCCCTGGG - Exonic
1192282853 X:69702974-69702996 CAGCCTAGAGGGCTGTCCTTTGG + Intronic
1195010876 X:100731586-100731608 CCCTCCCGAGAGCTGGCCCTGGG - Intronic
1195917983 X:109954539-109954561 AGAGCCAGAGAGCTGGCCCTAGG - Intergenic
1196287167 X:113896318-113896340 CAGCTCAGAGATTTTGCCCTTGG + Intergenic
1197599224 X:128508088-128508110 CAACCCATAGAGGGGGCCCTGGG - Intergenic
1197981219 X:132219113-132219135 CAGCCTAGACTCCTGGCCCTGGG - Intronic
1198616402 X:138463102-138463124 CAGCACTGAGAGCTTGCCCCAGG - Intergenic
1199596934 X:149513408-149513430 CAGCCCAGAGCCCTGGCCCGTGG - Intronic
1199670801 X:150146712-150146734 GCTCCAAGAGAGCTGGCCCTTGG + Intergenic
1199673694 X:150166874-150166896 AGGCCCAGAGAGCTGGCACTGGG + Intergenic
1201460952 Y:14223858-14223880 CAGCAAGGAGATCTGGCCCTCGG + Intergenic