ID: 901207078

View in Genome Browser
Species Human (GRCh38)
Location 1:7503481-7503503
Sequence GCTGGCCACCTTCGCCGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901207070_901207078 -5 Left 901207070 1:7503463-7503485 CCCTCTGGCCTGGCCCTGGCTGG 0: 1
1: 0
2: 3
3: 81
4: 575
Right 901207078 1:7503481-7503503 GCTGGCCACCTTCGCCGAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 48
901207060_901207078 29 Left 901207060 1:7503429-7503451 CCCAGGTAGAGGACCATGGAGTT 0: 1
1: 0
2: 0
3: 10
4: 103
Right 901207078 1:7503481-7503503 GCTGGCCACCTTCGCCGAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 48
901207068_901207078 4 Left 901207068 1:7503454-7503476 CCTGGGTCTCCCTCTGGCCTGGC 0: 1
1: 1
2: 3
3: 65
4: 514
Right 901207078 1:7503481-7503503 GCTGGCCACCTTCGCCGAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 48
901207061_901207078 28 Left 901207061 1:7503430-7503452 CCAGGTAGAGGACCATGGAGTTG 0: 1
1: 0
2: 0
3: 7
4: 89
Right 901207078 1:7503481-7503503 GCTGGCCACCTTCGCCGAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 48
901207072_901207078 -6 Left 901207072 1:7503464-7503486 CCTCTGGCCTGGCCCTGGCTGGC 0: 1
1: 0
2: 10
3: 93
4: 646
Right 901207078 1:7503481-7503503 GCTGGCCACCTTCGCCGAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 48
901207065_901207078 16 Left 901207065 1:7503442-7503464 CCATGGAGTTGGCCTGGGTCTCC 0: 1
1: 0
2: 1
3: 18
4: 248
Right 901207078 1:7503481-7503503 GCTGGCCACCTTCGCCGAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901207078 Original CRISPR GCTGGCCACCTTCGCCGAAG GGG Intronic
900361049 1:2289311-2289333 GCCTGCCACCCTCACCGAAGAGG - Intronic
901207078 1:7503481-7503503 GCTGGCCACCTTCGCCGAAGGGG + Intronic
901733148 1:11294981-11295003 GCTGGCCACCTTCGAGGAGAGGG + Intronic
902268978 1:15289497-15289519 GCTGGACACCTTGGTGGAAGGGG - Exonic
906116174 1:43358858-43358880 GCCCGCCCCCTTCGCCGGAGAGG + Intergenic
1064354275 10:14603966-14603988 GCTGGGCCCCTTCCCCGCAGCGG + Intronic
1067295811 10:44974710-44974732 CCTGCCCACCTTCGGAGAAGTGG - Intronic
1072016558 10:91352832-91352854 GCTGCCCACCTTCTACTAAGAGG + Intergenic
1072663664 10:97379149-97379171 GCTGGCCACCTGCTCGGCAGAGG + Intronic
1075037839 10:119084065-119084087 CCTGGCCACCTTCGTTGAATAGG - Intergenic
1078367063 11:10715564-10715586 GCTGGGAACCTTCTCCAAAGGGG + Intergenic
1082807328 11:57459413-57459435 CCTGGCCACCGTACCCGAAGCGG + Intergenic
1097995333 12:65882056-65882078 GCTGTCCACCTTGTCCGGAGGGG + Intronic
1104479670 12:129096494-129096516 TCTGGCCACTTTCACCAAAGTGG - Intronic
1107570894 13:41657129-41657151 GCTGGCAACCTCAGCCAAAGGGG - Intronic
1122943595 14:104994660-104994682 GCTGGCCACCTCCGCATGAGGGG - Exonic
1133342361 16:5045026-5045048 CCTGGCCACCTTGGCCCAGGGGG + Intronic
1137375832 16:47951054-47951076 GCTGGCCACCTGAGCCAAAGCGG + Intergenic
1137848586 16:51715591-51715613 GCTGGCCAGCTTCAGCAAAGTGG - Intergenic
1138049176 16:53758459-53758481 GCTGGTCAGCTTCCCTGAAGAGG - Intronic
1139361525 16:66402737-66402759 GCTGGTCACCTACGACGAGGAGG + Exonic
1146272788 17:31495294-31495316 GCTAGCCAGCTTCGCCTGAGTGG - Intronic
1146371163 17:32266219-32266241 GGTGGCCGCCTGCGCCGAGGCGG + Exonic
1151472317 17:74326089-74326111 GTTGGCCGCCTCCGCCGAGGAGG - Intergenic
1151588304 17:75025297-75025319 GCTGGCCACCCAAGCCGCAGTGG + Intergenic
1161279106 19:3435409-3435431 TCTGCCCTCCTTCGCCGCAGCGG - Intronic
1162301777 19:9848734-9848756 GCTGCCCACCTCCTCCGAGGAGG + Intronic
1165385096 19:35505689-35505711 GCTGGACATCTTCGTCGGAGAGG - Intronic
1165826273 19:38707695-38707717 AGTGGCCACCTCCCCCGAAGCGG + Intronic
934583280 2:95465248-95465270 GCTGGCTACCTCTGCTGAAGGGG + Intergenic
934596170 2:95611466-95611488 GCTGGCTACCTCTGCTGAAGGGG - Intergenic
934786603 2:97014049-97014071 GCTGGCTACCTCTGCTGAAGGGG + Intronic
1175863200 20:62161083-62161105 GCTGGTCACCTGCGCCCGAGGGG + Intronic
1180753285 22:18141278-18141300 GCTGGCCACCTGCGCCAGCGGGG + Intronic
1183757722 22:39785562-39785584 GATGGCCACATTAGCCAAAGAGG - Intronic
956705487 3:71995462-71995484 GCAGGCCACCTTCCCCAGAGTGG - Intergenic
961372403 3:126439700-126439722 GCAGGACACCTTCGCCGGAGGGG + Exonic
962249099 3:133824051-133824073 GCTGTCCACCAACTCCGAAGGGG - Intronic
962365342 3:134775376-134775398 GCTGGCCCCCTTACCTGAAGGGG - Intronic
980988352 4:139717468-139717490 GCTGGGCGCCCTCTCCGAAGAGG - Exonic
1002853995 6:1021635-1021657 GCTGGCCACCCCAGCCGCAGTGG - Intergenic
1007956947 6:45926772-45926794 GCTGGCGGGCTTCGCTGAAGTGG - Intronic
1020016766 7:4835943-4835965 GGTGGCCACATTCTCTGAAGGGG - Intronic
1020156437 7:5728377-5728399 GCTGACCAGCTTGGCCGAAATGG + Intronic
1022132197 7:27414888-27414910 CCTGGCCACCTTCCCTGCAGAGG + Intergenic
1031509077 7:122626034-122626056 GGAGGCCACCATCGCCAAAGTGG + Intronic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1040768398 8:50943969-50943991 GCTCGCCACCATCTCGGAAGCGG - Intergenic
1049343121 8:142124357-142124379 GATGGCCTCCTTCTCCTAAGGGG - Intergenic
1049407628 8:142458678-142458700 GCTGGCCAGCTTCTGCGAGGTGG - Intronic
1049992141 9:1000297-1000319 GCTGGCCTCCCTCTCCCAAGGGG + Intergenic
1062627580 9:137450198-137450220 GGTGGCCACCTTTGCCAAAGTGG - Exonic