ID: 901207739

View in Genome Browser
Species Human (GRCh38)
Location 1:7506340-7506362
Sequence CAACCTTCCCCCTGGGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901207739_901207748 7 Left 901207739 1:7506340-7506362 CCCCACTCCCAGGGGGAAGGTTG 0: 1
1: 0
2: 0
3: 12
4: 173
Right 901207748 1:7506370-7506392 GGGCTTCCTCAACCCACCACCGG 0: 1
1: 0
2: 1
3: 11
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901207739 Original CRISPR CAACCTTCCCCCTGGGAGTG GGG (reversed) Intronic
900530734 1:3151805-3151827 CAGCTTTCACCCTGGGACTGTGG + Intronic
901207739 1:7506340-7506362 CAACCTTCCCCCTGGGAGTGGGG - Intronic
901401409 1:9017435-9017457 CAGCCTTCCTTCTGGGTGTGGGG - Intronic
901632674 1:10655560-10655582 CAGCCCTGCCTCTGGGAGTGGGG + Intronic
905943675 1:41884388-41884410 CAACCTGCCACCTGGGAGGATGG + Intronic
908087825 1:60655141-60655163 CAAGGTTACCCCTGGGATTGTGG + Intergenic
910963675 1:92786580-92786602 CTACCTTCACCTGGGGAGTGGGG + Intronic
913994985 1:143644234-143644256 CTACCTTCACCTGGGGAGTGGGG + Intergenic
914361176 1:146937787-146937809 CTACCTTCACCTGGGGAGTGGGG - Intergenic
914491411 1:148152836-148152858 CTACCTTCACCTGGGGAGTGGGG + Intergenic
919483091 1:198113338-198113360 CACCCTTCCCCCTGGAAGGAGGG + Intergenic
921511154 1:216032519-216032541 CAATTTTCCCCCTTTGAGTGTGG + Intronic
922814654 1:228439908-228439930 CATCCTTCCTCCTGGGTATGGGG - Intergenic
924708291 1:246515391-246515413 CAACCTTCAACATGGGAATGGGG - Intergenic
1067187699 10:44044370-44044392 CAATCTTCCCCCTGAGGGAGTGG - Intergenic
1069695129 10:70380867-70380889 CAAGCTTCCCACTGGGAGGCAGG + Intronic
1071059018 10:81548247-81548269 CACCCCTCCCTCTGGGAGTTTGG - Intergenic
1073792784 10:106956713-106956735 CAACCTTTCCCCAGTCAGTGTGG - Intronic
1076845734 10:133068695-133068717 GAAGCCTCCCCCTGGGTGTGTGG + Intergenic
1077176856 11:1195043-1195065 CCACCGTCCCCCTAGGCGTGCGG - Intronic
1077230591 11:1456710-1456732 CAACCTGCGGCCTGCGAGTGGGG + Intronic
1077882236 11:6360205-6360227 CAAACTTCCCCCGAGGAGGGAGG - Intergenic
1078451284 11:11442824-11442846 CATCCTAACCCCTGGGAGGGAGG + Intronic
1079863296 11:25701732-25701754 CAACCATCCCACTGGCTGTGAGG - Intergenic
1081834680 11:46143853-46143875 CCAGCTTTCCCCTGGAAGTGGGG - Intergenic
1081850007 11:46268980-46269002 CAAACTTCCACCTAGGACTGGGG + Intergenic
1083305113 11:61758024-61758046 CAACCTTGACCATGTGAGTGAGG - Intronic
1084006517 11:66326283-66326305 CAGCCAGCCCCGTGGGAGTGTGG - Intergenic
1086047162 11:82546806-82546828 CAACCTTCCCCCCTTGAATGGGG + Intergenic
1088833751 11:113559993-113560015 CAACCTCCACCCTGGGGGTAGGG + Intergenic
1089387582 11:118078359-118078381 CACCCTTCCCCCTTGGACAGTGG - Intronic
1089400681 11:118162641-118162663 CAACCTTCCCCTTGTGAGGCAGG + Exonic
1089659620 11:119977593-119977615 CAACATATCTCCTGGGAGTGGGG - Intergenic
1089865280 11:121626286-121626308 TCACCTTCCCCTTGGAAGTGGGG + Intronic
1090075194 11:123576228-123576250 CAGCCTTCCCTCGGGGAGTGGGG - Intronic
1090267692 11:125363834-125363856 CAACTTGCTCTCTGGGAGTGGGG + Intronic
1096979401 12:55719643-55719665 CCTCCTTCCCCCTGCGGGTGAGG - Intronic
1097052020 12:56229387-56229409 CTACCTGTCCCCTGGGAGTCAGG + Exonic
1097699792 12:62808377-62808399 CAACCTTCCCTCTGGTGGTAGGG - Intronic
1100125477 12:91419698-91419720 CAACTTTTCCCTTGGGAGTTAGG + Intergenic
1103748476 12:123142549-123142571 CAGCCTTCCCCATGGCAGTCAGG - Intronic
1106028854 13:25980157-25980179 CTTCCTTCCCGCTGGGTGTGGGG + Intronic
1106099101 13:26679205-26679227 CTGCCTCCCCACTGGGAGTGGGG + Intronic
1108160349 13:47632444-47632466 CGCCCCTCCCCCTGGGAGTTGGG - Intergenic
1108503239 13:51086797-51086819 CAGCCCTGCCCCTGGGAGTGAGG - Intergenic
1111040447 13:82740663-82740685 CAAGCTTCCCCATGGGACTTGGG - Intergenic
1113942627 13:114026331-114026353 CCACCCTCCCCCTGGGAGCCTGG + Intronic
1114635741 14:24185829-24185851 CAACCCTCACCCTGGGACAGGGG + Intronic
1116885280 14:50214804-50214826 CAACCTTGCCTCAGGGAGGGGGG - Intronic
1119306723 14:73613602-73613624 CAAATTTCCCCCAGGGAGGGCGG - Intronic
1119854986 14:77892933-77892955 GAACCTTCTCCCTTGGAGAGGGG + Intronic
1122012224 14:98759659-98759681 CAACCTGCCCTCTTGGAGTTGGG + Intergenic
1122409859 14:101520312-101520334 CAACCTCCCACCTGGGACAGAGG + Intergenic
1125350898 15:38766594-38766616 CAGCCCTCACCCTGGGAGAGTGG - Intergenic
1125608168 15:40953824-40953846 CAACCGTGCCCAGGGGAGTGAGG + Intronic
1129037083 15:72656960-72656982 CCAGCTTCCCCTTGCGAGTGGGG - Intronic
1129212804 15:74080265-74080287 CCAGCTTCCCCTTGCGAGTGGGG + Intronic
1129268419 15:74407168-74407190 CAGCCTTCCCTCGGGGAGAGAGG + Intergenic
1129397595 15:75260821-75260843 CCAGCTTCCCCTTGCGAGTGGGG - Intronic
1129401207 15:75285098-75285120 CCAGCTTCCCCTTGCGAGTGGGG - Intronic
1129729944 15:77924585-77924607 CCAACTTCCCCTTGAGAGTGGGG + Intergenic
1130285245 15:82549376-82549398 GATACTTCCCCATGGGAGTGAGG - Intronic
1131435568 15:92419031-92419053 AGACCTTCTCTCTGGGAGTGGGG - Intronic
1134122641 16:11596130-11596152 CAACCCTTCCCCTCGGGGTGTGG + Intronic
1139427788 16:66894017-66894039 TAACCTAGCCCCTGGGAGAGTGG + Intronic
1139442877 16:66977553-66977575 CATCCTTCACCCAGGGAGGGAGG + Intergenic
1139493794 16:67301581-67301603 CAGCCTTCCCACTGAGGGTGGGG - Intronic
1139636295 16:68260425-68260447 CTCCCTTCACCCTGGGACTGTGG + Exonic
1141646499 16:85370652-85370674 CAGCCGTCCCCATGGGAGGGAGG - Intergenic
1142794962 17:2300536-2300558 CAAGGAACCCCCTGGGAGTGAGG - Exonic
1143981927 17:10877524-10877546 CAACCTTCCCTCTGTGAGTAGGG - Intergenic
1147168213 17:38604512-38604534 CAGCCTCCTCCCTGGGAGAGCGG + Intronic
1147254461 17:39173953-39173975 CCACCCTCCACCTGGGGGTGGGG - Exonic
1147773664 17:42885269-42885291 CAGGCTTCTCCCTTGGAGTGGGG + Intergenic
1147963981 17:44183517-44183539 CAGCATTGCCCCTGAGAGTGAGG - Intergenic
1147982399 17:44282588-44282610 CAACCTTCCTGCTGGGATTAGGG - Intergenic
1148860107 17:50600272-50600294 CACCATTCCCCCTGGGGATGGGG + Intronic
1149347280 17:55751294-55751316 CGACCTCCCCGCAGGGAGTGCGG + Intronic
1152065144 17:78108255-78108277 CCACCTTCCCCATGGGTGGGGGG - Exonic
1152272294 17:79331757-79331779 CCATCTTCCCACTGGAAGTGAGG + Intronic
1152693657 17:81733249-81733271 CAAACTGCCCCCTGGATGTGTGG - Intergenic
1153237483 18:3002143-3002165 GGACCTTCCCCCTGTAAGTGTGG - Intronic
1154009008 18:10559773-10559795 AGAGATTCCCCCTGGGAGTGAGG + Intergenic
1157077669 18:44483382-44483404 CAAATTTTCCCCTGGGAGTGAGG + Intergenic
1157516564 18:48315645-48315667 CACCCTTCCTACCGGGAGTGTGG - Intronic
1158551126 18:58437237-58437259 CAACCTTCAGCCTGGGTGTTGGG + Intergenic
1161265521 19:3361736-3361758 CAACCGTCCCTCCGGGAGTGCGG - Intronic
1164444411 19:28305025-28305047 TAATCCTCCCCCTGGGAGTAGGG + Intergenic
1164479295 19:28599038-28599060 CATGCTACCCCCTGGGGGTGGGG - Intergenic
1164826730 19:31289636-31289658 GAACCCCACCCCTGGGAGTGGGG - Intronic
1165825666 19:38704500-38704522 CCACCTTTGCCCTGAGAGTGGGG + Intronic
1167260609 19:48455744-48455766 CAGCATTCCCCCTGGCACTGCGG + Exonic
1167549021 19:50146813-50146835 CCACCTTACCCATGTGAGTGAGG + Intergenic
1167744452 19:51342361-51342383 CCAGCTTCCCCCTGGGGGTGGGG - Intergenic
926497483 2:13609077-13609099 CAACCTGCCTCCTGGAAATGTGG + Intergenic
927710097 2:25319621-25319643 CAGCCTTCCCACTGAGACTGGGG + Intronic
928255705 2:29720462-29720484 CAATCTTACCCCTGAGAGTAGGG + Intronic
928355068 2:30604957-30604979 CAACCTCCCACCTGTGTGTGGGG - Intronic
928951502 2:36817359-36817381 CAGCCTTCCCCCTGGGACTCAGG - Intergenic
929085847 2:38166543-38166565 CATCCTACTCCCTGAGAGTGGGG - Intergenic
929481278 2:42310632-42310654 CAAGCTTCTGGCTGGGAGTGGGG - Intronic
932826682 2:74947831-74947853 CACCCCTCCTCCTGGGAGTTTGG - Intergenic
933351231 2:81154542-81154564 CTACCTTCTCTCTGGGAGTCTGG - Intergenic
934780482 2:96966687-96966709 ATACCTTCACCCTGGGGGTGAGG - Intronic
939303940 2:140385124-140385146 CAACCTTCCAGCTGGGACTACGG - Intronic
940637875 2:156320316-156320338 CAGCCTTCGCCCTGAGGGTGGGG + Intergenic
944539828 2:200744422-200744444 CAAGCTTCCCCCTCAGGGTGCGG - Intergenic
946172034 2:217901318-217901340 CAACCTTCAGGCTGGCAGTGAGG + Intronic
947170554 2:227306736-227306758 CATCCGTGCCCCTGGGAGTCAGG - Intronic
947240276 2:227987018-227987040 CAATCTTTCCCCTGGGATTTAGG + Intronic
947326784 2:228987927-228987949 CAAATTTCCCCCTGGGAATGTGG - Intronic
948829804 2:240593109-240593131 GAGCCTCCCACCTGGGAGTGAGG + Intronic
1170357650 20:15509680-15509702 CAAACTTCCTCTTTGGAGTGAGG - Intronic
1174796850 20:53529383-53529405 CAACCTTCAGCATGGAAGTGGGG + Intergenic
1174800219 20:53557178-53557200 CAACCCTCCTCCTGGGGGTCGGG + Intergenic
1176449910 21:6852984-6853006 GAACTTTCCGCCTGTGAGTGTGG + Intergenic
1178271410 21:31193345-31193367 CTACTTTCCTCCTGGGAGTCTGG + Intronic
1178436899 21:32567696-32567718 CCACCTTCCCTGTGGGACTGGGG - Intergenic
1179068902 21:38053610-38053632 AACTCTTCCCCCTTGGAGTGTGG - Intronic
1180948341 22:19708907-19708929 CCACCTTCCCCGTGGGAGCCTGG + Intergenic
950699423 3:14730066-14730088 CAATCTTCCACCTGGGAAGGAGG - Intronic
956528338 3:70189140-70189162 CAAGATTCCTCCTGGGGGTGAGG - Intergenic
958044835 3:88271018-88271040 AAACCTAGCCCCTGGGACTGTGG - Intergenic
958151051 3:89695756-89695778 CAAACTTCCACCTATGAGTGAGG - Intergenic
959462489 3:106644045-106644067 CAACCTTCCCTCTGCCACTGTGG + Intergenic
961650220 3:128413451-128413473 CTACCTCCCACCTGGCAGTGTGG + Intergenic
963751581 3:149185328-149185350 CCACCTTCTACCTGGGAGAGAGG - Exonic
968813873 4:2811950-2811972 CAACCTGCACCCTGGGTGTCAGG - Intronic
969265503 4:6061741-6061763 CTCGCTTCCTCCTGGGAGTGTGG - Intronic
970402935 4:15735293-15735315 CTAACTTCACCCTGGGACTGTGG + Intronic
971094934 4:23389989-23390011 CAACATTCACCCTGAGAGTGAGG + Intergenic
974341466 4:60618902-60618924 CAGCATTCCCCCTGCTAGTGAGG - Intergenic
974760308 4:66266165-66266187 CACCCCTCCTCCTGGGAGTTAGG - Intergenic
976375624 4:84342282-84342304 CACCCCTCCCCCTGGGAATTTGG - Intergenic
979775397 4:124583187-124583209 CACCCCTCCCCCTGCGAGTTTGG - Intergenic
979978391 4:127224827-127224849 CACCCCTTCCCCTGGGAGTTCGG + Intergenic
985049413 4:185974085-185974107 CTTCCTTCCTCCTGGGTGTGGGG + Intergenic
991654902 5:68894118-68894140 CAAGACTCCCTCTGGGAGTGCGG - Intergenic
999395020 5:151221826-151221848 CTACCAGCCCCCTGGGAGAGAGG - Intronic
999949983 5:156638258-156638280 TGCCCTTCCACCTGGGAGTGAGG - Intronic
1003665696 6:8109386-8109408 GAGCCTTCCTCCAGGGAGTGTGG - Intergenic
1005841910 6:29749136-29749158 GAACCTTCCCCTTCTGAGTGTGG - Intergenic
1007465689 6:42049593-42049615 CACCCCACGCCCTGGGAGTGAGG + Intronic
1007891759 6:45301050-45301072 CTACCTACCCCCTGGGAAAGTGG + Intronic
1010945571 6:81970020-81970042 CGCCCCTCCCCCTGGGAGTTCGG - Intergenic
1011216646 6:85012720-85012742 CAGGCTTGCCCCTGGGGGTGAGG + Intergenic
1012595454 6:101032750-101032772 CCACCTTCACACTGGGAGAGTGG + Intergenic
1016028062 6:139309061-139309083 CAAAGTTCCAGCTGGGAGTGTGG - Intergenic
1016246467 6:141987046-141987068 CCACCTTCCCCCAGAGAATGAGG + Intergenic
1016404400 6:143715332-143715354 CAACCTTCCTGCTGGGGGTTAGG - Intronic
1017352588 6:153459411-153459433 CCACCTTCCCTGTGGGACTGAGG - Intergenic
1018144907 6:160877032-160877054 CCACCTTCCCTGTGGGACTGGGG + Intergenic
1018758915 6:166873475-166873497 CACCCCTCCTCTTGGGAGTGGGG + Intronic
1026808839 7:73445168-73445190 CCACCTTCCCTTGGGGAGTGGGG + Intronic
1032012940 7:128358843-128358865 CAGCCTTGCCTCTGGGAGTTTGG + Intronic
1033756505 7:144401336-144401358 CAATCTTCCCCCTGAGTCTGGGG + Exonic
1034957373 7:155343501-155343523 TAGCCGTCCCCCTGGCAGTGTGG - Intergenic
1035735812 8:1886908-1886930 CAACCACCCCCCTGGACGTGTGG - Intronic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1036168572 8:6460758-6460780 CTAGCTGTCCCCTGGGAGTGTGG + Intronic
1040795422 8:51285274-51285296 CAACCATCCCCCTGGGCTGGAGG + Intergenic
1040982492 8:53257842-53257864 CAAACTTCACCCTGGGATGGTGG + Intergenic
1044350352 8:91157746-91157768 CCACCTTCTACCTGGGAGAGAGG + Intronic
1044910574 8:97054226-97054248 CCACCTTACCCCTGGGAGAATGG + Intronic
1050649517 9:7760252-7760274 CAAGCTGCCCCCTGGGAATGGGG + Intergenic
1051236579 9:15006483-15006505 CAACTTTCTTCCTGGGAGTCTGG + Intergenic
1052662250 9:31449061-31449083 CACCCTTCCACCTGGGAAAGAGG + Intergenic
1053538848 9:38952629-38952651 ATTCCTTCCCCCTGGGAATGGGG + Intergenic
1054627292 9:67411290-67411312 ATTCCTTCCCCCTGGGAATGGGG - Intergenic
1055720228 9:79164850-79164872 CAAACTTGCCCCTGGGGGTGGGG + Intergenic
1059751243 9:117249613-117249635 CCACCTTCCCCCTGGTCTTGAGG + Intronic
1059964008 9:119595653-119595675 ATACCCTCCCCCTGGGAGTTTGG + Intergenic
1060976570 9:127768401-127768423 CAAACAGCCCCTTGGGAGTGAGG + Intronic
1061203005 9:129148061-129148083 CACCCTGCCCCCTGGGCCTGAGG + Exonic
1061570777 9:131476318-131476340 CCACCATCCACCTGGGAGTCGGG - Exonic
1061844928 9:133382176-133382198 CAACCTTCCCCATGTGGGTAAGG + Intronic
1062023994 9:134332146-134332168 CAGCTTTCCACCTGGGAGTGGGG - Intronic
1062134722 9:134919117-134919139 CCAGCTGCCCCCTGGGTGTGAGG + Intergenic
1203519273 Un_GL000213v1:31533-31555 GAACTTTCCGCCTGTGAGTGTGG - Intergenic
1189961264 X:46327065-46327087 CTTCCTTCCCCCTGTGTGTGTGG + Intergenic
1190878208 X:54474664-54474686 CTGCCCTCCCCCTGGGCGTGGGG + Intronic
1193468185 X:81871655-81871677 CAACCTTCACCCATGAAGTGGGG + Intergenic
1193600390 X:83503390-83503412 CATCCTTTCCCTTGGTAGTGAGG + Intergenic
1197148675 X:123195961-123195983 TAACCTTCCCCCAGGCAATGCGG + Intronic
1197892092 X:131278386-131278408 CAACACTGCTCCTGGGAGTGAGG - Intronic
1201147477 Y:11072928-11072950 CCACCCCTCCCCTGGGAGTGTGG - Intergenic